Ethical approval
All of the protocols for this study were approved by the Animal Care Committee according to the Animal Care and the Use Guidelines of the Institute of Subtropical Agriculture, the Chinese Academy of Sciences, Changsha, China (No. KYNEAAM-2015-0009).
Experimental design and animal management
Twenty-four goats (45 ± 3 d of gestation, Liuyang black goats, a local breed) were selected and tested by portable ultrasonography (Aloka SSD-500 with a 5-MHz linear probe, Aloka, Shanghai, China). Dams were randomly assigned into the control [100% of the nutrients requirements suggested in the Chinese Meat Goat Requirements (2004), n = 12] or restricted group (60% of the nutrients requirements, n = 12) according to body weight (BW) and litter size. All dams were placed within individual pens and fed a diet twice (0800 h and 1600 h) per day with a 50:50 ratio of concentrate to roughage, with free access to drinking water. The ingredients and composition of the experimental diet on a dry matter basis are shown in additional Table S1. The feeding of the restricted group was conducted by providing 60% of the feed allowance of the control group during days 45 - 100 of gestation, and the actual restriction level (1.04 kg/d for the control group vs 0.62 kg/d for the restricted group) was 60.2% after measurement of the daily feed allowance and refusal. At day 100 of gestation, six pregnant dams per group were selected for harvesting, and ten fetuses (three singlets, two sets of twins, and one set of triplets) in each group were obtained. The ratio of females to males was 7:3 in the control group and 6:4 in the restricted group.
After day 100 of gestation, feed restriction was removed, and the remaining dams were fed to supply 100% of the nutrients requirements and were managed as before during the following experimental period. After parturition, neonatal kids were nursed by their dams until preweaning between days 50 and 60. Preweaning was conducted by separating offspring from their dams in the daytime from 0800 to 1600 h, and a mixed diet of starter and fresh Miscanthus spp. was provided at a ratio of 20:80 during this period. Complete weaning was performed on day 60. Then, all kids were given ad libitum access to the above diet and had free access to drinking water. The ingredients and composition of the kid diet are shown in a Table S1. At 90 days of age, eight kids in each group were obtained for harvesting. The ratio of females to males was 3:5 in the control and 4:4 in the restricted group.
Body weight measurement and muscle tissue sampling
At day 100 of gestation and at day 90 after birth, the feeding of all selected animals was withdrawn for 24 h, while clear water was offered freely. The empty BW of fetuses and kids were reported previously [24]. Following electric shock and exsanguination, samples of semitendinosus (ST) and vastus lateralis (VL) muscle were collected from the kids, while the gross vastus muscle in the fetuses was sampled because it was difficult to dissect into individual muscles. The sliced tissue samples were immersed in 10% formalin fixing solution for histology measurement, while another aliquot of samples was quick-frozen in liquid nitrogen and then stored at -80°C for further analysis.
Histology
After fixation, the muscle samples were embedded in paraffin, sliced at a thickness of 8 μm using a rotary microtome (RM2016, Leica Microsystems Inc., Wetzlar, Germany), and stained with hematoxylin (AS1055A, Aspen Biological, Inc., Wuhan, China) and eosin (AS1094, Aspen Biological, Inc.) according to Zou et al. [12]. Ten different microscopic fields of each section and five sections per sample were randomly chosen to determine the muscle fiber area using the Image Pro Plus 6.0 software (Media Cybernetics, Bethesda, USA).
Quantitative real-time PCR
The extraction and qualification of total RNA and the analyses of messenger RNA (mRNA) expression levels were performed using the SYBR green-based method with gene-specific primers (Table 1) according to Zhou et al. [24]. A melt curve analysis was conducted to confirm specific product amplification. ACTG1 was used as the reference gene, and the real-time PCR data were calculated using the 2−ΔΔCt method [25]. The expression of mRNA was presented as the fold change relative to the reference gene.
Immunoblotting analysis
The extraction and qualification of total protein and the immunoblotting analysis were carried out according to the method described [26]. The primary antibodies of MyHCI (MYH7, No. MFCD00162703, Merck KGaA, Darmstadt, Germany), MyHC-IIa (MYH2, No. ab124937, Abcam plc. Cambridge, USA), MyHC-IIx (No. BM0096, Boster Biological Technology Co. Ltd, California, USA), and β-tubulin (No. 2146S, Cell Signaling Technology, Inc., Danvers, UK) were diluted according to 1:5000, 1:10000, 1:100 and 1:1000, respectively. The primary antibodies of AKT (No. AV06008-100UL, Merck KGaA, Darmstadt, Germany), p-AKT (No. 9275, Cell Signaling Technology, Inc., Danvers, MA, USA), PI3K (No. C312573, LifeSpan BioSciences, Inc., Seattle, WA, USA), p-PI3K (No. C358831, LifeSpan BioSciences, Inc.), mTOR (No. PLA0114, Merck KGaA), p-mTOR (No. 2971, Cell Signaling Technology, Inc.), and β-Actin (No. 4976, Cell Signaling Technology, Inc.) were diluted as 1/1000. The density of bands was quantified and then normalized to the reference protein of β-tubulin or β-Actin. The normalized values were used for comparison of the relative expression levels of the target proteins between the control group and the restricted group.
DNA methylation detection
Approximately 20 mg of frozen sample was ground in liquid nitrogen, and DNA was extracted using a DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The quantitative methylation analysis of multiple CpG sites was performed by the Beijing Genomics Institute (Guanzhou, China) using a Sequenom EpiTYPE system based on MALDI-TOF mass spectrometry according to Suchiman et al. [27]. The CpG-rich sequences for MYF5 and MYOD were selected using EMBOSS Cpgplot (https://www.ebi.ac.uk/Tools/seqstats/emboss_cpgplot/), and one CpG island was found in the primer regions of MYF5 and MYOD. The CpG island of MYF5 ranges from the site of -10 to +347 bp relative to the TSS site (10070240 - 10070597 in chromosome 5). The forward primer sequence of MYF5 was TTTATTTTGGGTAGTTTTTGGTTAGG tagged with the T7-promoter of aggaagagag, while the reverse sequence was CCCAAAAATATATAAAAAACCCCAA tagged with the sequence of cagtaatacgactcactatagggagaaggct. The product size was 558 bp from -44 to + 503 (10070196 to 10070753 in chromosome 5) and covered 41 CpG sites, among which 34 CpGs could be effectively quantified. The CpG island of MYOD ranges from the site of +159 to + 888 relative to the TSS site (47532862 to 47533591 in chromosome 15). The forward primer sequence of MYOD was TAGTTTTGGGAGTTTAGTGTGAAGG tagged with the T7-promoter of aggaagagag, while the reverse sequence was CCTTACAAACCCACAATAAACAA tagged with cagtaatacgactcactatagggagaaggct. The product size was 546 bp from -15 to + 530 (47532688 - 47533233 in chromosome 15) and covered 55 CpG sites, among which 42 CpGs could be effectively quantified. The spectral data were pre-processed and analyzed according to the method of Suchiman et al. [27]. The methylation level of the restricted group in each CpG site was expressed as the value relative to the control group.
Statistical analysis
Data were analyzed by a mixed model with treatment, gender and litter size as fixed factors, and initial BW of dams as the covariate. Statistical significance was considered at P < 0.05, and Sidak method was applied to compare means. All results are presented as the means and standard errors (SE).