DOI: https://doi.org/10.21203/rs.3.rs-1708821/v1
Background: Alpha-fetoprotein (AFP) is a specific tumor marker for hepatocellular carcinoma (HCC) and promotes tumor cell proliferation in HCC, but the mechanism is not completely clear. This research aimed to supplement the mechanism of AFP in HCC.
Methods: Lentivirus transfected HCC cells for AFP knockdown and overexpression, CCK-8, clone formation, scratch assay, and 3D multicellular tumor spheroids（MCTS） formation assay verified the positive regulation of AFP on HCC. Co-immunoprecipitation, liquid chromatography-mass spectrometry (LC-MS/ MS), and bioinformatics techniques were used to identify proteins interacting with AFP and related pathways in HCC cells, and western blot, real-time quantitative PCR(RT-qPCR), and immunofluorescence were used to detect the expression changes of proteins associated with AFP pathways. The effect of AFP on the HCC cell cycle was detected by flow cytometry.
Results: AFP promotes the proliferation, migration, and the formation of MCTS of HCC cells. In HCC, AFP interacts with large tumor suppressor 2 (LATS2) and negatively regulates Hippo signaling pathway. AFP inhibits the phosphorylation of LATS2, which in turn inhibits the phosphorylation of yes associated protein (YAP). In addition, AFP was positively correlated with the expression of CyclinD1.
Conclusion: AFP negatively regulates Hippo signaling pathway through the LATS2/YAP axis and promotes the proliferation, migration, and formation of MCTS of HCC cells.
HCC is one of the leading causes of cancer-related deaths worldwide. According to the Global Cancer Statistics Report 2020[1], in the global cancer incidence and mortality rankings in 2020, HCC ranked Sixth and third, respectively. This indicates that the situation of HCC prevention and treatment is becoming increasingly serious. AFP is highly expressed in about 60–80% of HCC patients compared with normal liver tissue[2]. AFP is an important indicator for the diagnosis, treatment effect, and prognosis of HCC. High expression of AFP in HCC usually indicates a poor prognosis or a high risk of progression[3]. Due to the high expression and specificity of AFP in HCC, AFP has been used as one of the commonly used indicators for HCC screening and diagnosis in many regions of the world. AFP combined with abdominal ultrasound can improve the sensitivity of HCC surveillance[4]. AFP is listed as one of the items that must be detected in HCC surveillance in China[5]. AFP has been widely studied for its complex biological functions since it was first detected in the serum of HCC patients in 1964[6]. AFP regulates the proliferation, apoptosis, autophagy, immunosuppression and drug resistance of HCC cells through different signaling pathways. Studies have shown that AFP can bind to its receptor (AFPR) to induce intracellular Ca2+ increase and promote the proliferation of HCC cells depending on the CAMP-PKA pathway[7]. Phosphatidylinositol 3-kinase (PI3K)/ protein kinase B (AKT) pathway is often abnormally activated in human cancer and plays a variety of biological functions, which is one of the classic pathways for studying the occurrence and development of human tumors. In HCC, AFP binds to PTEN and promotes the PI3K/AKT signaling pathway by activating AKT, which inhibits autophagy[8], promotes proliferation[9], metastasis[10], and drug resistance[11] of HCC cells. AFP is also involved in the regulation of HCC cell apoptosis through a variety of pathways[12][13]. The immune system of the body has the function of monitoring tumors and can inhibit the growth of tumor cells through a variety of pathways. However, tumor cells can evade recognition and attack by the body's immune system through a variety of mechanisms, and thus survive and proliferate in the body. AFP plays an immunosuppressive role in HCC by inhibiting the maturation of dendritic cells (DCs)[14], inducing DCs apoptosis[15], inhibiting NK cell activity[16], and regulating Fas/Fas-L and PD-L1/B7-H4 pathways, helping tumor cells escape immune surveillance[17][18]. Although the biological role of AFP in HCC has been extensively studied, the related mechanism of AFP in HCC has not been fully elucidated. Therapy based on targeted AFP has not been well applied in clinical practice. Therefore, it is necessary to actively elucidate the mechanism of AFP in HCC.
In our study, AFP expression was elevated in Huh-7, Hep3B, and HCC-LM3 cells compared with normal liver cell line LO2. AFP was found to promote the proliferation, migration, and formation of MCTS of HCC cells by negatively regulating the Hippo pathway. Further research showed that AFP inhibits the phosphorylation of LATS2, which in turn inhibits the phosphorylation of YAP. LATS2 and YAP are important cascade molecules in the Hippo signaling pathway, and inhibition of their phosphorylation has a negative regulatory effect on Hippo signaling pathway. This is a new insight into the mechanism of AFP in HCC cells. This data provides additional evidence for targeting AFP in combination with other therapeutic strategies for HCC.
HCC cell lines Huh-7, Hep3B, and HCC-LM3 were purchased from the China Center for Type Culture Collection(CCTCC Wuhan, China), the human immortalized normal hepatocyte cell line LO2 was a generous gift of Dr. Gang Chen at Lanzhou University Basic Medical College. Huh-7, HCC-LM3, and LO2 Cells were cultured in high-glucose Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin, Hep3B Cells was cultured in Minimum essential medium༈MEM༉ containing 1% NEAA supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin. All above cells were incubated in a humidified incubator containing 5% CO2 at 37℃.
The CMV enhancer-AFP-3flag-polyA-EF1A-zsGreen-sv40-puromycin and hU6-AFP-CBh-gcGFP-IRES-puromycin lentiviral vectors were purchased from GeneChem Co., Ltd (Shanghai, China). According to the manufacturer's instructions, the AFP knockdown and overexpression stable transfection clones were constructed with puromycin, which were validated by real-time quantitative PCR (RT-qPCR) and western blot (WB) analysis.
Total protein was extracted from target cells with RIPA (1%PMSF) and protease inhibitors and was quantified by the BCA Protein Assay Kit (Solarbio). The proteins were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS–PAGE, Beyotime) and then electrotransferred onto polyvinylidene difluoride (PVDF) membranes. After blocking with fat-free milk, the protein was incubated with primary antibody and secondary antibody respectively. Finally, the protein expression was detected by the chemiluminescence method.
Total RNA was extracted from the indicated cells by using the RNA Easy Fast Tissue/Cell Kit(TIANGEN BIOTECH (BEIJING) CO., LTD, BEIJING, China). Standard cDNA synthesis reactions were carried out using FastKing RT Kit (TIANGEN) reverse transcriptase according to the manufacturer's instructions. For RT-qPCR analysis, reverse transcribed products were amplified using SYBR Green SuperReal PreMix Plus (TIANGEN). Relative mRNA levels were normalized to GAPDH, the relative expression of the target gene transcripts was analyzed by using the 2^(-∆∆CT) value. The sequence of relevant primers is presented in Table 1.
Cells were seeded into 96-well plates with 6×10^3 cells per well for 100ul, and cell viability was determined after 24, 48, and 72h culture, respectively. Cells were incubated in 10% CCK-8 diluted in a normal culture medium for an additional 2h. The absorbance at a wavelength of 450nm was used to estimate the viable cells in each well.
Based on the protocol established in a previous study[19], cells were resuspended at a density of 3000 cells/well on a 96-well U-bottom ultra-low adhesion culture plate (PerkinElmer, USA). The growth of MCTS was recorded by an Olympus microscope every 24 hours. The morphologic parameters "Roundness", "Solidity", and "Sphericity Index(SI)" of the MCTS were measured and calculated using ImageJ software[20].
Indicated cells were seeded into a 6-well plate at a density of 1×10^6 cells per well, respectively. After cell monolayer fusion, scratch wounds were created on monolayer cells, and serum-free medium was replaced for further culture for 48h. The migration area at 0, 24, and 48 hours was recorded respectively. The following formula was used to calculate the mobility of cells according to the previous description[21], wound closure% :(At=0h- At=Δh)/At=0h×100%. where “At= 0h” is the area of the wound measured immediately after scratching (time zero), and “At=Δh” is the area of the wound measured h hours after the scratch is performed.
Co-Immunoprecipitation, Protein identification, and bioinformatics analyses
According to the manufacturer's instructions, AFP monoclonal antibody was incubated with Huh-7 cell lysate overnight and then further incubated with G/A agarose beads (Absin, Shanghai China) for 3h. Immunoprecipitation (IP) results were verified with Western blot after washing with washing buffer. The proteins interacting with AFP in the complex were analyzed by liquid chromatography-mass spectrometry/mass spectrometry (LC-MS/MS), and path analysis was extracted using the KEGG Mapper platform's search path tool. The interaction between bait protein and target protein was further verified by co-immunoprecipitation. Then, the target protein was used as a decoy protein and AFP expression was detected in its protein cleavage complex.
The cells were grown to 50% confluence on the 24-well plate glass coverslips. After the cells were fixed, permeated, and blocked, the primary antibody was added and incubated at 4℃ overnight, and the fluorescent secondary antibody related to horseradish peroxidase was incubated at room temperature for 2 hours. Coverslips were then mounted on slides with an anti-fluorescence quenched seal reagent containing DAPI. Representative images were acquired on a Leica TCS SP5 confocal microscope objective at 20× magnification. Representative images are shown as analysis using ImageJ software.
Many previous studies have confirmed that AFP is a factor promoting tumor proliferation in HCC, and these were consistent with our experimental results. Western blot and RT-qPCR verified that AFP was highly expressed in HCC cell lines Huh-7, Hep3B, and HCC-LM3 compared with normal liver cells LO2, and the Huh-7 cell line with the highest expression level was selected for subsequent experiments (Fig. 1A-B). Then we further verified the biological characteristics of AFP promoting the growth of HCC cells by knockdown and overexpressing AFP. Western blot and RT-qPCR assay confirmed the successful knockdown or overexpression of AFP by lentiviral transduction with the full sequence of AFP in Huh-7 cell lines.
The CCK-8 and colony formation assay showed that the proliferation of Huh-7 cells with knockdown AFP(AFP-KD) was markedly suppressed in comparison to the control cells, while overexpressed AFP(AFP-OE) produced the opposite result (Fig. 2A-B). Scratch assay confirmed that the migration ability of Huh-7 cells after AFP-KD was decreased at 24, 48, and 72h, respectively, compared with a normal control group. On the contrary, the migration ability of Huh-7 cells after AFP-OE was significantly enhanced (Fig. 2C).
To simulate the effect of AFP on HCC in an environment that may recently resemble in vivo, we performed a 3D MCTS formation assy. The results showed that the roundness, solidity, and Sphericity Index (SI) of MCTS after AFP-KD were lower than those of the normal control group, while the results of AFP-OE were the opposite (Fig. 3A-B). These results suggested that AFP can promote the compactness/ spheroidization of HCC in the 3D environment. In summary, our data demonstrated that AFP promoted the proliferation, migration, and MCTS formation of HCC in vitro.
To further understand the molecular mechanisms of AFP in HCC progression, we examined potential AFP interacting proteins in Huh-7 cells by immunoprecipitation (IP) and LC-MS/MS analyses. A total of fifty proteins that may interact with AFP were identified. KEGG retrieval revealed that AFP plays a role in the cascade reactions of the Hippo signaling pathway. LATS2, a key protein of the Hippo signaling pathway, was detected in the immunoprecipitation complex using AFP as bait protein. Western blot analysis was performed on the immunoprecipitation complex, and the expression of LTAS2 protein was successfully detected. LATS2 related protein complex was obtained from Huh-7 cells using LATS2 monoclonal antibody and agarose beads, and the complex was conducted western blot assay successfully detected AFP (Figure.4), confirming the interaction between AFP and LATS2. These results suggest that in Huh-7 cells, AFP interacts with LATS2 and may play a regulatory role in tumor cells through the Hippo signaling pathway.
To clarify the effect of AFP on LATS2, we conducted an AFP knockdown and overexpression assay transfected with lentivirus. Western blot results showed that the phosphorylation level of LATS2 increased significantly after AFP knockdown. After overexpression of AFP, the level of LATS2 phosphorylated decreased significantly (Fig. 5A). High and low expression of phosphorylated YAP was observed in the knockdown and overexpression of AFP, respectively (Fig. 5A). Immunofluorescence staining and confocal microscopy showed that the fluorescence expression of phosphorylated YAP increased with AFP knockdown, while the results of overexpression of AFP were reversed (Fig. 5B). Therefore, we believe that AFP negatively regulates Hippo signaling pathway by inhibiting the phosphorylation of LATS2 and then YAP.
Previous studies have shown that YAP can directly regulate the cell cycle by acting on the CyclinD1. After the YAP gene is knockdown, the expression of CyclinD1 is reduced, resulting in the accumulation of G0 and G1 phase cells and the significant loss of S phase cells in mesothelioma cell lines[22]. In our study, the expression of CyclinD1 was decreased after AFP knockdown, and flow cytometry showed a reduced proportion of S phase cells, while the opposite was observed after overexpression of AFP (Fig. 5C-D). To confirm that the cell cycle changes are achieved by cascade reaction of the YAP/CyclinD1, we added YAP inhibitor Verteporfin into Huh-7 cells, and the results showed a significant decrease in CyclinD1 expression (Fig. 5C). These data suggest that AFP is positively correlated with the expression of CyclinD1 through LATS2/YAP axis.
AFP is a glycoprotein with a molecular weight of 69kD. AFP is not expressed in normal adult liver tissue, but is highly expressed in HCC, it is the most commonly used serum marker for the diagnosis of HCC and plays an important role in the occurrence and development of HCC. In this study, AFP promotes HCC cell proliferation, migration, and MCTS formation. Further studies showed that AFP negatively regulated the Hippo signaling pathway through interaction with LATS2, promoted the expression of Cyclin D1, and promoted the proliferation of HCC cells by regulating the cell cycle.
LATS2 is a serine/threonine kinase located in the centrosome and regulates spindle formation during mitosis[23][24]. As an important member of the tumor suppressor gene family, LATS2 plays an important role in the cell cycle and tumor development due to its high genetic conservatism. Many studies have shown that LATS2 regulates tumor outcome by regulating multiple signaling cascades of carcinogenic or tumor suppressor factors[25][26][27][28]. However, more studies on the tumor inhibition mechanism of LATS2 are based on the LATS/YAP axis in the classical Hippo signaling pathway. The Hippo signaling pathway is composed of a series of kinase cascades, including MST1/2-SAV1, LATS1/2-MOB1A/B, and YAP/TAZ in mammals. Hippo signaling pathway plays an important role in regulating blastocyst and embryonic stem cell development, cell differentiation, tissue regeneration, homeostasis, and controlling organ size, gene mutations or modification of protein levels in each component of the Hippo signaling pathway can lead to diseases such as cataract, Sveinsson Retinal Atrophy (SCRA), arrhythmic cardiomyopathy (AC), type A aortic dissection and cancer, especially playing an important role in the occurrence and development of malignant tumors[29]. LATS2 is an important negative feedback member of the Hippo pathway, and its mediated negative feedback loop prevents the overactivation of effector YAP/TAZ and plays a tumor-suppressive function. In tumor cells, when LATS2 is mutated or modified abnormally, the cascade of the Hippo pathway is destroyed, leading to tumor progression. LATS2 is expressed in HCC cell lines, and decreased LATS2 expression can reduce the dephosphorylation of YAP protein in HCC cells, promote the nuclear aggregation of YAP, and promote the invasion of HCC through LATS2/YAP/TEAD2 axis[30]. Other studies have shown that the decreased expression of LATS2 in HCC cells is an independent factor for the poor prognosis of HCC patients[31]. There are many factors in HCC that can change the outcome of HCC by regulating LATS2. The RNA-binding protein FUS promotes the expression of LATs1/2 through its interaction with LATs1/2, activates the Hippo pathway, and promotes the progression of HCC[32]. WWC2 activates LATS1/2 and phosphorylates the transcriptional coactivator YAP, which inhibits the invasion and metastasis potential of HCC cells by negatively regulating Hippo signaling pathway[33]. Long non-coding RNA CRNDE promotes epigenetic inhibition of LATS2 in HCC cells, and promotes proliferation, migration, and chemotherapy resistance of HCC cells[34]. By directly acting on LATS2, mir-103 inhibits LATS2-induced YAP phosphorylation and promotes HCC metastasis and epithelial-mesenchymal transformation[35]. In this study, we confirmed that AFP is a new upstream effector of LATS2 and inhibits Hippo signaling pathway by inhibiting LATS2 phosphorylation.
In addition, we found that the phosphorylation level of YAP decreased after AFP knockdown. YAP, another core component of the Hippo pathway, is phosphorylated by activated LATS1/2 kinase and inactivated in the cytoplasm[36], while non-phosphorylated YAP/TAZ translocates to the nucleus and induces the expression of target genes by binding to transcription factors, such as members of the TEA domain(TEAD) family[37]. YAP is highly expressed in a variety of malignant tumors, including esophageal cancer (EC), gastric cancer (GC), colorectal cancer (CRC), and HCC, and is associated with poor prognosis[38]. In HCC, YAP is associated with higher differentiation stage of cancer cells and higher AFP level, which is a key driver of HCC[39]. As a transcription coactivator, YAP forms a complex with TAZ, TEAD, and binding protein-1 (AP-1), which directly binds to the enhancer of the target gene to synergically activate and regulate the S-phase of mitosis of the target gene[40]. When the Hippo signaling pathway is inhibited, YAP phosphorylation is reduced and transferred to the nucleus, where it binds with TEAD to form a cotranscriptional complex that promotes the expression of Survivin, CTGF, JAG1, CYR61, and other proliferative genes and promotes the migration and proliferation of cancer cells[41]. In addition, YAP can also promote the expression of CyclinD1 through the YAP/TEAD/CyclinD1 axis, and promote the progression of the cell cycle from the G1 phase to the S phase, leading to tumor growth[42][43]. Our results are consistent with those reported above, suggesting that AFP promotes the proliferation of HCC based on the LATS2/YAP/CyclinD1 pathway.
In this study, we supplement a novel target of AFP promoting tumor proliferation and migration in HCC and explain the related mechanism pathways. However, we lack further exploration of the details of how AFP leads to reduced phosphorylation of LTAS2, and our experimental results have not been verified in vivo, but this will be the focus of our next research.
AFP negatively regulates Hippo signaling pathway through the LATS2/YAP axis and promotes the proliferation, migration, and formation of MCTS of HCC cells. These results suggest that targeting AFP in combination with restoring the suppressed Hippo pathway may be a novel therapeutic strategy for HCC. It is of great significance for supplementing the existing HCC therapeutic strategy and improving the therapeutic outcome of HCC.
AFP Alpha-fetoprotein, HCC hepatocellular carcinoma, MCTS multicellular tumor spheroids, LATS2 large tumor suppressor 2, YAP yes associated protein, AFP-KD knockdown AFP, AFP-OE overexpressed AFP, NC normal control group.
Ethics approval and consent to participate：Not Applicable.
Consent for publication: Not Applicable.
Availability of data and materials: The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.
Competing interests: The authors declare that they have no competing interests.
Funding: This work was supported by Doctoral students Training Research Fund of Lanzhou University Second Hospital (YJS-BD-32) and Science and technology projects in Chengguan District of Lanzhou City (2014-4-4).
Authors' contributions：All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Guangxian Leng, Fahong Wu, Hongxia Gong，Guiyuan Liu, Hangzhi Wei, Hanwei Ma, Mancai Wang, Yin Kong and Youcheng Zhang. The first draft of the manuscript was written by Guangxian Leng and Fahong Wu. Writing-review and editing was performed by Youcheng Zhang and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.
Acknowledgements: Not Applicable.
Table.1
The sequence of AFP and GAPDH primers
|
Gene |
Accession No. |
Sequence(5,→3,) |
|
|
AFP |
NM_001134.3 |
forward |
GCGGCTGACATTATTATCG |
|
reverse |
TGTTTCATCCACCACCAAG |
||
|
GAPDH |
NM_002046.7 |
forward |
CATCACCATCTTCCAGGAG |
|
reverse |
CTTGAGGCTGTTGTCATACTTC |
||