Reagents
TRIzol LS reagent (Cat: 10296028) and lipofectamine 3000 (Cat: 130000) were purchased from Invitrogen (Waltham, MA, USA). The Realstar power SYBR kit (a311) was acquired from Genstar Biosolutions. miR-483-5p mimics, miR-483-5p hairpin-it real-time PCR kit, and U6 snRNA real-time PCR normalization kit (e01005) were purchased from Gene Pharma (Shanghai, P.R. China). qPCR primers were purchased from Sangong Biotech (Shanghai, P.R. China). The FKBP4 overexpression plasmid was obtained from Genechem (Shanghai, P.R. China). Horseradish peroxidase-conjugated goat anti-mouse IGG (115-035), anti-rabbit IGG (115-035), Alexa Fluor® 488-conjugated donkey anti-rabbit IGG (H+L) (711-545), and Alexa Fluor® 594-conjugated donkey anti-rabbit IGG (H+L) (711-585) were obtained from Jackson Immunoresearch (West Grove, PA, USA). Dual-luciferase reporter assay system (e1910), and DeadendTM fluorometric tunel system (g3250), were purchased from Promega (Madison, WI, USA). XhoI and NotIrestriction enzymes were purchased from Thermo Fisher Scientific (Waltham, MA, USA). We also purchase mouse AMH (anti-Mullerian hormone) ELISA kit (e-el-m0113c), mouse FSH (follicle stimulating hormone) ELISA kit (e-el-m0511c), and human/monkey/mouse E2 (estradiol) ELISA kit (e-el-0150c) from Elabscience (Houston, Texas, USA). Maintenance medium, consisting of Dulbecco’s Modified Eagle Medium (DMEM) and fetal bovine serum, was purchased from Gibco (Waltham, MA, USA). All other reagents were purchased from Sigma-Aldrich (Darmstadt, Germany).
Human serum collection
Six unrelated Han Chinese POI women were recruited in this experiment, of whom suffered secondary amenorrhea and with elevated levels of FSH >25 IU/L on two occasions at least one month apart, prior to 40 years-of-age. Patients were excluded with known chromosomal abnormalities, previous ovarian surgery, autoimmune disorders, somatic anomalies (particularly any reported as associated with syndromic POI) or radiotherapy and chemotherapy. Serum samples were obtained from normal and POI patients attending Shenzhen Second People's Hospital, Reproductive Medicine Centre (Shenzhen, China). All research involving human participants was approved by the Ethics Committees of Shenzhen Second People’s Hospital (45575561-0, Shenzhen, China) and informed consent was obtained from all participants.
The model of CDDP induced POI
Wild-type female C57BL/6J mice (4-week-old) were purchased from the Southern Medical University Animal Center (Guangzhou, China). All mice were housed in a constant light-to-dark ratio of 12:12 h under specific pathogen-free conditions in a university animal facility. Experimental POI was induced in 5-week-old females. The POI group received intraperitoneal injections of CDDP (2.5 mg/kg/d in saline) for 7 consecutive days, while the control group was injected with saline[10]. The diagrammatic representation of CDDP administration is shown in Figure S1.
Trypsin digestion and iTRAQ labeling
iTRAQ labeling was performed according to the manufacturer’s protocol (Applied Biosystems, Sciex)[13]. Briefly, 200 μg of each protein sample was reduced with TCEP Reducing Reagent at 60 °C for 1 h, and alkylated with MMTS Cysteine-Blocking Reagent at room temperature for 30 min. Then, proteins were digested with trypsin (Promega, USA) at 37 °C at a ratio of 1:50 (enzyme-to-substrate) overnight. Each sample was labeled separately with two of the eight available tags (control: 114 and 116 tags; cisplatin: 117 and 119 tags). All labeled peptides were pooled together.
Generation of miR-483-5p transgenic mice
miR-483-5p-floxed mice were obtained from Cyagen Biosciences (Guangzhou, China). We also purchased Gdf9-Cre mice from the Jackson Laboratory (stock no.011062). The Gdf9-Cre mice were mated with miR-483-5p-floxed mice to create female miR-483-5p transgenic mice (miR-483-5p TG), which exhibited oocyte-specific overexpression of miR-483-5p (Gdf9-Cre+, miR-483-5p TG). Females from the same litter that possessed miR-483-5p-LoxP, but without Gdf9-Cre (Gdf9-Cre-, miR-483-5p-LoxP), were used as controls. DNA was isolated from tail biopsies and genotyped by PCR.
Real-time quantitative PCR (qRT-PCR)
Total RNA and miRNA were purified with RNAiso Plus reagent, and TRIzol LS reagent, respectively. Then, total RNA was reverse transcribed into cDNA with the RETRO-script Reverse Transcription Kit, and qRT-PCR was performed, in triplicate reactions, on a StepOne Plus Real-Time PCR System (Applied Biosystems, Waltham, MA, USA), using the RealStar Power SYBR Kit. Next, miR-483-5p was reversed transcribed and used for quantitative RT-PCR with the Hairpin-it Real-Time PCR kit. Quantitative expression data were then acquired for the ratio of FKBP4 to Gapdh (FKBP4/ Gapdh); U6 and Gapdh genes were used as endogenous controls in order to normalize the data for differences in the amount of total miRNA and RNA. We also determined miR-483-5p-tissue (cell)/U6 and miR-483-5p-serum/miR-39-3p ratios. Data were acquired using the ΔΔCt method [31] and used to determine the fold change in expression between the POI and control groups. The primers used for qRT-PCR were as follows: has-miR-483-5p: forward:5¢-AGAGCACAAGACGGGAGGAA-3¢, reverse:5¢-TATGGTTGTTCACGACTCCTTCAC-3¢, mmu-miR-483-5p: forward: 5¢-CCACCTAAGACGGGAGAAGA-3¢, reverse:5¢-TATGGTTGTTGTGCTCTCTGACTC-3¢, U6 snRNA: forward: 5¢-CGCTTCGGCAGCACATATAC-3¢, reverse: 5¢-TTCACGAATTTGCGTGTCATC-3¢, Cel-miR-39-3p: forward: 5¢-CGTCGATCACCGGGTGTAAA-3¢, reverse:5¢-TATGGTTGTTCTGCTCTCTGTCTC-3¢, FKBP4: forward: 5¢-CCTCTCGAAGGAGTGGACATC-3¢, reverse: 5¢-TCCCCGATCATGGGTGTCT-3¢, Gapdh: forward: 5¢-TGTGTCCGTCGTGGATCTGA -3¢, reverse: 5¢-TTGCTGTTGAAGTCGCAGGAG -3¢.
Cultivation of primary GCs
C57B6/J mice were injected with PMSG (5 IU, Sigma, St. Louis, MO) to increase GCs number, and hCG (5 IU, Sigma, St. Louis, MO) was injected after 48 hours later then kill the mouse after 14 hours. Ovaries were removed and the GCs were extracted by puncturing ovaries. Collected GCs were centrifuged by Trypsin Solution (SangonBiotech) (37 °C, 3 min), then add DMEM/F12 Medium with 10% FBS into the cell suspension. GCs were maintained at 37°C in a humidified atmosphere containing 5% CO2. Cells that have the same growth were randomly divided into four groups: control group, miR-483-5p group, miR-483-5p+FKBP4+CDDP group and miR-483-5p+CDDP group.
Cell line, DNA transfection, and miRNA interference
The HeLa (human cervical cancer cells) cell line was cultured in maintenance medium consisting of DMEM supplemented with 10% fetal bovine serum (FBS) and the KGN (human granulosa cells) cell line and primary GCs was cultured in maintenance medium consisting of DMEM/F12 supplemented with 10% FBS. The cells were maintained under standard cell culture conditions of 5% CO2 and 95% humidity. The miR-483-5p mimics, and the FKBP4 overexpression plasmid, were transfected using Lipofectamine 3000 in accordance with the manufacturer’s instructions.
Western blotting
After treatment, ovaries were homogenized and lysed for 10 min at 100°C in buffer (62.5 mM Tris-HCl [pH 6.8], 10% glycerol, 2% SDS, 50 mM DTT, and 0.01% bromophenol blue). Cell and tissue lysates were then separated by 8-12.5% SDS-PAGE, and electro-transferred to nitrocellulose membranes (GE Healthcare Life Sciences, Beijing, China).The membranes were then blocked in 5% non-fat dried milk for 1 h at room temperature, washed, and incubated with rabbit polyclonal anti-FKBP4 (1:1000, ABclonal, A5643) primary antibody, rabbit polyclonal anti-PARP (1:500, CST, 9542S), and mouse polyclonal β-Actin (MG3) mouse monoclonal antibody (1:3000, Ray antibody Biotech, RM2001) at 4°C overnight. The membranes were then washed, incubated with secondary antibodies for 1 h at room temperature, and immunoreactive proteins visualized using an Enhanced Chemiluminescence Kit (Bio-Rad). β-Actin served as an internal control. The quantitative analysis of protein expression was carried out with ImageJ software 1.8.0 (NIH, Bethesda, Maryland, USA).
In situ hybridization
The sequence of the probe (Exiqon) for mmu-miR-483-5p, containing the locked nucleic acid and digoxigenin-modified bases, was: /5DigN/CTCCCTTCTCTTCTCCCGTCTT/3Dig_N/. Signals were detected using anti-Digoxigenin-AP (Roche), NBT/BCIP was used as a chromogen, and images were acquired using an AXIO Scope A1 (Zeiss). Densitometry analysis of the in situ hybridization images were performed with ImageJ software 1.8.0.[32].
Luciferase assay
The FKBP4 mRNA 3¢ untranslated region (3¢UTR) (GenBank: NM_010219.4) was amplified from mouse cDNA, and the mutation binding region was amplified using mutant primers. PCR products, and the empty psiCHECK-2 vector, were then digested with XhoI and NotI restriction enzymes and subsequently ligated by T4 ligase. The primer sequences were as follows: FKBP4 mRNA 3¢UTR: forward: 5¢-CCGCTCGAGGGGTGGAGACAGAAGCGTAG-3¢, reverse: 5¢-ATTTGCGGCCGCTGACACCATCTAAAACTACCCCC-3¢, FKBP4 mutant binding region: forward: 5¢-CCGCTCGAGCTCGGGTGGGTGGAGACAGA-3¢, reverse: 5¢-ATTTGCGGCCGCAAGAAAAGTAGGGTTGAGAGG-3¢. miR-483-5p mimics and/or the FKBP4 plasmid were then transfected with Lipofectamine 3000 in accordance with the manufacturer’s instructions.
The FKBP4 mRNA 3¢UTR expression or mutant binding region plasmids were co-transfected with miR-483-5p, or negative control (NC) mimics into HeLa cells, respectively. Cells were then analyzed with dual-luciferase reporter assay system, that was applied in accordance with the manufacturer’s instructions. Luminescent signals were quantified using a luminometer (Glomax, Promega)[33].
Tissue collection and morphological analysis
Tissues were first fixed in 4% Paraformaldehyde solution for 24 h and then embedded in paraffin wax. Sections of 4 µm thickness were then prepared for hematoxylin and eosin (H&E) staining. At least five sections (taken 100 µM apart) representative sections from each ovary each group were photographed for follicular assessment. A follicle was deemed to be present if the oocyte contained a germinal vesicle. Follicles were counted and classified according to their health status and development stage, as either a healthy follicle (primordial, primary, secondary, or antral follicle), or an atretic follicle, in accordance with classifications described previously[34].
The terminal deoxynucleotidyl transferase mediated dUTP nick-end labeling (TUNEL) assay
For TUNEL analysis, sections were first deparaffinized, and then rehydrated. Sections were then permeabilized with 20 μg/mL of proteinase K, and incubated with TUNEL reagents in accordance with the manufacturer’s guidelines. Next, the sections were counterstained with DAPI. TUNEL-positive signals were then quantified. Every 25th section in each ovary were analyzed, using the incubation with the enzyme as a positive control, or without the enzyme as a negative control. Images were acquired with a FluoView FV1000 confocal microscope (Olympus, Tokyo, Japan). The relative level of apoptosis was presented as the proportion of apoptotic cells in granulosa cells on each follicle.
Immunofluorescence staining
For immunofluorescence staining, sections were first deparaffinized and then rehydrated. Next, 4 µm sections were incubated with rabbit polyclonal anti-connexin 43 primary antibody (1:100, Immunoway, YT1046), rabbit polyclonal anti-connexin 37 primary antibody (1:100, ABclonal, A2529), anti-ki67 primary antibody (1:300, ABclonal, 9129), or anti-FKBP4 (1:100, ABclonal, A5643) primary antibody. This was then followed by incubation with Alexa-Fluor-488- or Alexa-Fluor-594-labeled secondary antibody, as appropriate. Finally, the sections were counterstained with DAPI and immunofluorescent images were acquired using a FluoView FV1000 confocal microscope (Olympus, Tokyo, Japan).
Enzyme-linked immunosorbent assays (ELISA)
For ELISA, we first separated the supernatant from blood samples by centrifugation at 3000×g for 10 min. Next, we used ELISA to determine the levels of AMH, FSH, or E2; for this we used specific kits for each hormone in accordance with the manufacturer’s instructions. The absorbance of the reaction mixture was determined with a spectrophotometer at 450 nm. Hormone concentrations were determined from standards by means of a four-parameter logistic curve drawn on log-log graph paper.
Statistical analysis
Statistical analysis was calculated using GraphPad Prism version 8.0 (GraphPad Software, San Diego, CA). Data are given as mean ± SEM. The Student’s t-test was used to compare data between the two groups of samples. One-way analysis of variance (ANOVA), and the post hoc Tukey test, were used to analyze samples when ≥3 groups were involved. P < 0.05 was considered to be statistically significant.