Chemicals were purchased from Sigma-Aldrich (St. Louis, MO, USA) if not stated otherwise.
Full-Organ IVD Culture Model and Trauma Induction. The animal study was also approved by the institutional review board and animal care committee of the Sun Yat-sen university (2013A-204).
Animal Groups And Impact Loading
Thirty Sprague-Dawley rats (0.4–0.5 kg, male, 6-months-old) obtained from Sun Yat-sen university animal facility were euthanatized with 10% chloral hydrate at a dose of 5 ml/kg via intra-peritoneal administration. Subsequently, fifty-four Spinal segments (IVD/endplate with approximately 3 mm of the adjacent vertebral bodies) from L1/2 to L5/6 (3/animal) were isolated less than 4 fours, and flushed with 0.9% NaCI containing 50 µl/ml penicillin. The segments were trimmed transversely by bone saw (IsoMet, Buehler, Lake Bluff, IL) with the cranial and caudal cutting planes parallel to each other at a height of 7.08 ± 0.21 mm, and perpendicular with respect to the cranial/caudal axis of the segment. The segments were then randomly assigned into three groups: Control (n = 18), Low Impact (12 J/cm3, n = 18) and High Impact (25 J/cm3, n = 18). The specimens were then subjected to single impact load using a custom-made apparatus, which guarantees axial load. The impact force was recorded using a piezoelectric loadcell (Kistler) (Fig. 1A). Pilot-experiment revealed 25 J/cm3 as the threshold energy for endplate failure, at which the endplate was expected to fracture in half of the specimens. The height of each specimen was calculated as the vertical distance between the two vertebral cross sections, and was recorded before and after impact loading. Based on the pilot-experiment, the specimens with a height decrease more than 10% indicates endplate fracture, whereas less than 10% decrease indicates endplate intact.
After impact, samples were washed with 0.9% NaCI containing 50 µl/ml penicillin for three times, and then cultured at 37℃, 5% CO2 in DMEM (Dulbecco's Modified Eagle Medium, DMEM) with 2% fetal calf serum, 1% Pen/Strep, 50 mg/ml ascorbate-2-phosphate and 0.1% Primocin. Half of the samples were collected at day 7, and the other half were collected at day 14 for histology and mRNA analysis. The assignment of the specimens in each group was shown in Table 1.
Table 1
The assignment of the specimens in each group.
| Control | Low impact | High impact |
Endplate fracture | Endplate intact |
Real-time PCR | 9 | 9 | 5 | 4 |
Histology | 9 | 9 | 4 | 5 |
Histology
The specimens for histology were fixed with 4% paraformaldehyde for 24 hours at 4℃, then transferred to a sealed vial containing a solution of 70% ethanol and decalcifying agent for at least 30 days. The specimens were then sequentially dehydrated, split down the mid-sagittal plane, embedded in paraffin for histology sectioning. Serial sections were cut in the transverse plane at 8 µm with a microtome(HM360, Microm International AG, Switzerland), and then stained with hematoxylin ༆ eosin (H༆E), safranin O/fast green dyes (Fisher, Scientific, Pittsburgh, PA) by standard procedure and photographed under 40-200x magnification (Nikon Eclipse, Ti, Nikon, Tokyo, Japan ). All the sections were imaged under bright field and cross-polarized light.
The changes of the intervertebral disc degeneration were investigated. The disc degeneration assessment scoring system that we developed based on our prior work[13, 14] was used to assess the anulus fibrosus, the cellularity of the nucleus pulposus, and the matrix of the nucleus pulposus through sections (Table 2). Histomorphometric assessment was performed by an orthopedic researcher (L.S), who was blinded to the different treatments between groups. All histologic sections were reviewed one month after the first examination to determine the intraobserver reliability. The average score of the two measurements for each specimen was used for the statistical analysis.
Table 2
The scoring system of lumbar intervertebral disc degeneration.
Score | Nucleus pulposus | Annulus fibrosus | Border between the annulus fibrosus and nucleus pulposus |
0 | Bulging gel with abundant chondrocyte-like cells | Normal, compact fibrocartilage lamellae, without ruptured or serpentined patterned fibers | Normal |
1 | slight decrease(༜25%) in the number of cells | Serpentined patterned fibers in less than 25% of the annulus | less than 25% interrupted |
2 | moderate decrease(25 ~ 50%) in the number of cells, with focal mucoid degeneration | Ruptured, or serpentine patterned fibers in more than 25%,but less than 50% of the annulus | 25%-50% interrupted |
3 | severe decrease(༞50%) in the number of cells, diffuse mucoid degeneration and cleft throughout nucleus | Ruptured, or serpentine patterned fibers in more than 50% of the annulus | more than 50% interrupted |
Real-time Pcr Analysis
Followed by the RNeasy Mini Kit (Qiagen Inc., Duesseldorf, Germany), total RNA were extracted from the specimens using Trizol reagent (Ambion, Carllsbad, CA, USA). We selected 7 genes as marker for degenerative changes [9, 15](Table 3). cDNA synthesis was performed as described previously[16]. Each gene expression was quantified by real-time PCR using CFX96 Real-Time System (Bio-Rad, Herculus, CA, USA). Data were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and expressed as fold change in comparison with the control group.
Table 3
Sequences of primers used in the real-time PCR.
Name | GeneBank accession No. | | Sequence(5′-3′) |
GAPDH | NM_017008 | Forward | AGGTCGGTGTGAACGGATTT |
| | Reverse | GTCAATGAAGGGGTCGTTGAT |
Col1α1 | NM_053304 | Forward | AATGGTGCTCCTGGTATTGCT |
| | Reverse | GCACCAGTGTCTCCTTTGTTG |
Col3α1 | NM_032058 | Forward | GCACAAAGAGTCTCATGTCTGAT |
| | Reverse | CTAGACTCATAGGACTGACCAAGG |
MMP-9 | NM_031055 | Forward | ACCTGAAAACCTCCAACCTAC |
| | Reverse | GACTGCTTCTCTCCCATCATCT |
MMP-13 | NM_133530 | Forward | CCTGATGTGGGTGAATACAATG |
| | Reverse | GTCACATCAGACCAGACCTTGA |
IL-6 | NM_012589 | Forward | ACTTCACAAGTCCGGAGAG |
| | Reverse | TTGCCATTGCACAACTCTTC |
TGF-β | NM_021578 | Forward | CACTCCCGTGGCTTCTAGTG |
| | Reverse | GACTGGCCAGCCTTAGTTTG |
GAPDH, glyceraldehyde 3-phosphate dehydrogenase; Col1α1, collagenⅠα1; Col3α1, collagen Ⅲα1; MMP-9, Matrix metalloproteinases-9; MMP-13, Matrix metalloproteinases-13; IL-6, Interleukin-6 |
Statistical Analysis
SPSS 25.0 software (SPSS Inc., Chicago, IL) was used for univariate analysis of variance. The data between groups were compared by using t test. The results of histological scores were analyzed using the Wilcoxon signed ranks test, with a confidence interval of 95%. To assess intraobserver reliability, we used the intraclass correlation coefficient for average and single measurement. The agreement of intraclass correlation coefficient was rated as follows: 0 to 0.4, fair agreement; 0.41 to 0.60, moderate agreement; 0.61 to 0.8, substantial agreement, and 0.81 to 1.00, excellent agreement[17]. Statistical significance was indicated at P༜0.05.