Effect of β3 -adrenoceptor Activation on interaction of Renal Adrenoceptors and Angiotensin II Receptors in Aging ApoE-/- mice

doi:10.21203/rs.3.rs-1721187/v1

PDF

Research Article

Effect of β₃ -adrenoceptor Activation on interaction of Renal Adrenoceptors and Angiotensin II Receptors in Aging ApoE^-/- mice

https://doi.org/10.21203/rs.3.rs-1721187/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

To investigate the effect of β₃-adrenoceptor (β₃-AR) activation on the interaction of renal adrenoceptor (AR) and angiotensin II receptor (ATR) subtypes in aging apolipoprotein E knockout⁽apoE^-/-)mice. 10 C57BL/6J mice served as normal control group (group A) and 50 age-matched apoE^-/- mice randomly divided into hyperlipidaemia model group (group B), atorvastatin treatment group (group C), low-dose β₃-AR agonist group (group D), high-dose β₃-AR agonist group (group E) and β₃-AR antagonist group (group F) were fed with high fat diet for 38 weeks, treatment in each group was given during the last 12 weeks of the high-fat diet. Then serum non-high density lipoprotein cholesterol (nHDL-C), blood glucose and insulin levels in each group were measured using an automatic biochemical detector. Expression of α_1A-AR, α_1B-AR, α_2A-AR, β₁-AR, β₂-AR, β₃-AR and angiotensin II type 1 (AT₁R) and type 2 (AT₂R) receptors in renal tissues were detected by RT-PCR and Western blot, respectively. Results showed that the serum nHDL-C, blood glucose and insulin levels significantly increased in hyperlipidaemia model mice (P<0.01), and the expression of α_1A-AR, AT₁R and AT₂R in renal tissues were significantly upregulated (P<0.01), with the expression of α_1B-AR, α_2A-AR, β₁-AR, β₂-AR and β₃-AR downregulated (P<0.01). Compared with group B, nHDL-C, glucose and insulin in aged apoE^-/-mice decreased in group D and E (P<0.01). β₃-AR agonist treatment could down-regulate the expression of α_1A-AR and AT₁R (P<0.05), and increased α_1B-AR, α_2A-AR, β₁-AR, β₃-AR and AT₂R expression in group D and E (P<0.05), and thus resulted in improved lipid and glucose metabolism in aging hyperlipidaemia ApoE^-/-mice, indicating that there are interaction between β₃- AR and different subtypes of AR, and between β₃-AR and ATRs, which may play a protective role in renal function injury caused by hyperlipidemia.

apolipoproteins E knockout mice

β3-adrenoceptor

angiotensin II receptor

subtype

interaction

It is well established that kidney plays an important role in maintaining the balance of blood pressure, water and electrolyte, the physical function of which is modulated by sympathetic nervous system (SNS) and rennin-angiotensin system (RAS) [1, 2]. Researches have shown that SNS and RAS, which are over-activated in many hyperlipidemia animal models, lead to the renal injury mediated by dyslipidemia [3, 4]. Dyslipidemia can induce epithelial-interstitial transformation of renal tubular epithelial cells, leading to renal tubule interstitial fibrosis, which may also promote mesangial cell proliferation and increase extracellular matrix deposition, resulting in glomerulosclerosis [5]. Our previous research found that activation of β₃-adrenoceptor (β₃-AR) in SNS and RAS can improve lipid and glucose metabolism disorders, thus delaying the occurrence of cardiac atherosclerosis and pancreatic injury in patients with hyperlipidemia [6, 7]. Whether β₃-AR activation has a protective effect on renal injury induced by hyperlipidemia and its mechanism remains unclear. The present study aimed to know the effects of β₃-AR agonist and antagonist on the expression of renal adrenoceptors (ARs) and angiotensin II receptors (ATRs), with particular attention to the issue that whether β₃-AR protected the renal function in high fat condition through the interaction between β₃-AR and other ARs, and between β₃-AR and ATRs.

Ethics statement

All animals were barrier-housed according to the standards for laboratory animals established by the People's Republic of China (GB14925-2001), and the experimental protocol was approved by the Committee on the Ethics of Animal Experiments of Capital Medical University (Permit Number: SCXK-2012-0001). To minimize animal suffering, the lowest number of animals required for a statistically valid result was used. All experiments were performed under sodium pentobarbital anesthesia.

Animals

Homozygous ApoE^-/-mice and wild type C57BL/6J mice (male, 10 weeks old, 22.85± 0.45g) were purchased from Beijing Vital River Laboratory Animal Technology Co Ltd.. All mice were adaptively barrier-housed for one week in an air-conditioned room without specific pathogens, with a light-dark cycle of 12 h. Then ApoE^-/-mice were given a high-fat diet containing 21% (w/w) fat and 0.15% (w/w) cholesterol from 11-48 weeks of age, while C57BL/6J mice (groupA, n=10) were given a normal diet. Autoclaved food and water were provided ad libitum [8].

At 36 weeks of age, ApoE^-/-mice (n=50) were randomly divided into the following 5 groups (n=10 per group): hyperlipidaemia model (group B), positive control (group C), low-dose β₃-AR agonist (groupD), high-dose β₃-AR agonist (group E)and β₃-AR antagonist (group F). Mice in groupA and B received vehicle (0.9% saline, intraperitoneal injection, twice a week). Mice in group C received atorvastatin at a dose of 10 mg/kg by gavage once a day. Mice in groupD received the β₃-AR agonist BRL37344 at a dose of 1.65 μg/kg by intraperitoneal injection, twice a week. Mice in groupE received the β₃-AR agonist BRL37344 at a dose of 3.30 μg/kg by intraperitoneal injection, twice a week. Mice in groupF received the β₃-AR antagonist SR59230A at a dose of 50 μg/kg by intraperitoneal injection, twice a week. All mice were treated for 12 weeks.

Reagents and drugs

The β₃-AR agonist BRL37344 and the β₃-AR antagonist SR59230A were obtained from Sigma Chemical Co. (St Louis, MO, USA). Atorvastatin was purchased from Pﬁzer Inc. (Dalian, China). Trizol reagent was produced by Invitrogen Co. (Carlsbad, CA, USA). Reverse transcription-polymerase chain reaction (RT-PCR) kit A3500 was obtained from Promega Co. (Madison, WI). Random primers were obtained from Invitrogen Co. (Shanghai, China). SYBR Green Real-Time PCR Master Mix kit was purchased from Katara Bio. (Shiga, Japan). Antibodies against α_1A-AR, α_1B-AR, α_2A-AR, β₁-AR, β₂-AR and β₃-AR, agiotensin II type 1 receptor (AT₁R) and β-actin were produced by Abcam Co. (California, USA). Secondary antibody was obtained from Sigma Chemical Co. (St Louis, MO. USA).

Measurement of glucose and insulin

All mice were fasted for 10 hours at 48 weeks of age and anesthetized using 1% sodium pentobarbital by intraperitoneal injection, and then blood samples were collected by retro-orbital sinus puncture. nHDL-C, Glucose (Glu) and Insulin (Ins) were detected using a Beckman CX7 (Beckman Coulter, Fullerton, CA, USA).

Quantitative real-time PCR

Total RNA was extracted from renal tissues with TRIZOL Reagent, which was then reverse transcribed into double-stranded cDNA using RT-PCR kit based on the manufacturer’s protocol. Quantitative real-time PCR (qRT-PCR) used a SYBR Green Real-Time PCR Master Mix kit (Katara Bio., Shiga, Japan). The reaction was performed as follows: 40 cycles of denaturation at 94℃ for 30s, annealing at 60℃ for 30s, and extension at 72℃ for 30s. Details of gene-specific primers were described in Table 1. The housekeeping gene β-actin was used as control. Results were normalized against β-actin and expressed as fold change for each gene using the 2^–ΔΔCTmethod [9].
Table 1 Sequences of the primers used in this study. The sizes of the PCR products were given in base-pairs (bp).

Genes

NCBI number

Forward primers (5’-3’)

Reverse primers (5’-3’)

Sizes (bp)

α_1A-AR

α_1B-AR

α_2A-AR

β₁-AR

β₂-AR

β₃-AR

AT₁R

AT₂R

β-Actin

NM_013461

NM-007416

NM_007417

NM_007419

NM_007420

NM_013462

NM_177322

NM_007429

NM_007393

GCAGCGGAGTAAGCAGTG

TCCAGGGAAAAGAAAGCAGCCAA

CAAGATCAACGACCAGAAGT

TGGCTTACTGGCTTGTCTTG

GGACAACCTCATCCCTAA

CAGTCCCTGCCTATGTTTG

TGCTCAGAAACGGGGACAC

GATGGAGGGAGCTCGGAACT

TCCATCATGAAGTGTGACGT

AGCCAGCAGAGGACGAAG

GGGTAGATGATGGGGTTGAGGCA

GTGCGACGCTTGGCGATCT

TTTCCACTCGGGTCCTTG

AGAGTAGCCGTTCCCATA

TTCCTGGATTCCTGCTCT

CTCTGAAGTAGCCCACCTGTTA

AATTTGGAGTTGCTGCAGTTCAA

GAGCAATGATCTTGATCTTCAT

124bp

188bp

120bp

135bp

169bp

165bp

177bp

143bp

112bp

Western blot

Protein expression of α_1A-AR, α_1B-AR, α_2A-AR, β₁-AR, β_2-AR, β₃-AR and AT₁R in renal tissues was detected by western blot (WB). Total protein was extracted with RIPA buffer (50 mM Tris/HCl pH7.4, 150 mM NaCl, 2mM EDTA, 1% NP-40, 0.1% SDS). The protein concentration of the kidney was quantiﬁed using the Bradford protein assay. The samples were boiled for 5 min followed by loading on a 10% sodium dodecylsulfate polyacrylamide gel (SDS-PAGE) and transferred to polyvinylidene diﬂuoride membranes. After transfer, the membrane was blocked for 2 h at room temperature with 5% nonfat dry milk in Tris-buffered saline-Tween (TBST; 20 mM Tris, 500 mM NaCl, pH 7.5, 0.1% Tween 20). The membranes were then incubated with diluted primary antibodies against α_1A-AR (rabbit polyclonal, 1:250), α_1B-AR (rabbit polyclonal, 1:1000), α_2A-AR (rabbit polyclonal, 1:500), β₁-AR (rabbit polyclonal, 1:1000), β₂-AR (rabbit polyclonal, 1:1000), β₃-AR (rabbit polyclonal, 1:1000)，AT₁R (rabbit polyclonal, 1:1000) in 5% nonfat dry milk in TBST for 2 h at room temperature. After washing three times with TBST, the membranes were incubated with a secondary antibody (goat anti-rabbit IgG-HRP, 1:5000) conjugated to horseradish peroxidase in 2.5% nonfat dry milk in TBST for 1 h at room temperature. The immunoreactive proteins were detected by enhanced chemiluminescence (ECL). The WB results were quantiﬁed by measuring the relative intensity compared with the control using Quantity one 4.6 (Bio-Rad, California, USA)[10].

Statistical analysis

The data was analyzed with SPSS23.0, and GraphPad Prism 8.0 was used for plotting. All data was expressed as means ± SE.M. One-way ANOVA was used to determine the difference between groups. Post-hoc comparisons were performed using a Bonferroni t-test (equal variances) or Dunn's multiple comparison test (unequal variances). A value of P<0.05 was considered statistically significant.

Effects of β₃-AR on serum nHDL-C, glucose and insulin levels

Serum parameters at time of sacrifice were shown in Table 2. Compared with group A, ApoE^-/-mice fed with high fat diet (group B) exhibited severe hyperlipidaemia, hyperglycemia and hyperinsulinemia (P<0.01). β₃-AR agonist groups (1.65 ug/kg and 3.30 ug/kg) at the end of treatment period had lower values of nHDL-C, glucose and insulin (P<0.01) compared with group B. However, no significant change in glucose was observed between group C and group B.

Table 2 Effects of β₃-AR on plasma glucose and insulin levels.

	A	B	C	D	E	F
nHDL-C(mmol/L)	0.70±0.05	19.41±0.40^a	10.32±0.45^ab	14.31±0.31^abc	12.78±0.55^abcd	18.43±0.32^a
Glu（mmol/L）	7.55±0.83	15.39±1.05^a	14.25±0.94^a	11.51±0.72^abc	10.87±0.78^abc	15.04±0.10^a
Ins（ng/ml）	1.28±0.26	7.26±0.34^a	6.26±0.54^ab	4.79±0.25^abc	4.35±0.27^abc	7.14±0.31^a

Results are expressed as the means ± S.E.M. Glu: glucose, Ins: insulin, A: normal control group, B: hyperlipidaemia model, C: positive control, D: low-dose β₃-AR agonist, E: high-dose β₃-AR agonist, F: β₃-AR antagonist. ^aP <0.01 versus group A. ^bP <0.01 versus group B. ^cP <0.01 versus group C. ^dP < 0.01 vs group D.

Effects of β₃-AR on mRNA expression of renal ARs and angiotensin II receptors (ATRs)

The mRNA expression of renal ARs and ATRs were analyzed by qRT-PCR. As shown in Fig.1, compared with group A, the mRNA expression of α_1A-AR, AT₁R and AT₂R were significantly up-regulated (P<0.01), and α_1B-AR, α_2A-AR, β₁-AR, β₂-AR and β₃-AR were significantly down-regulated (P<0.01) in apoE^-/-mice (group B). Compared with group B, atorvastatin (group C) and β₃-AR agonist (group D and E) both decreased α_1A-AR and AT₁R mRNA expression (P<0.05), with α_1B-AR, α_2A-AR, β₁-AR and AT₂R mRNA expression increased (P<0.05)，and group E had the most significant effect on mRNA expression of these ARs and ATRs in renal tissue. There was no difference in β₂-AR mRNA between group B, C, D, E and F (P>0.05). No difference in β₃-AR mRNA existed between group B and group C (P>0.05), but it was significantly increased in group D and E (P<0.05), with no difference between the two groups (P>0.05). Compared with group B, there was no significant change in mRNA expression of renal ARs and ATRs in group F (P>0.05).

Effects of β₃-AR on protein expression of renal ARs and ATRs

As shown in Fig. 2, compared with group A, protein expression of α_1A-AR and AT₁R in group B were significantly increased (P<0.01), with protein expression of α_1B-AR, α_2A-AR, β₁-AR, β₂-AR and β₃-AR significantly decreased (P<0.01). Compared with group B, atorvastatin (group C) and β₃-AR agonist (group D and E) both decreased α_1A-AR and AT₁R protein expression (P<0.05), with α_1B-AR, α_2A-AR and β₁-AR protein expression increased (P<0.05) and group E had the most significant effect on protein expression of these ARs and ATRs in renal tissue. There was no difference in β₂-AR protein between B, C, D, E and F groups (P>0.05). No difference in β₃-AR protein existed between group B and group C (P>0.05), but it was significantly increased in group D and E (P<0.05), with significant difference between the two groups (P<0.05). Compared with group B, there was no significant change in protein expression of renal ARs and ATRs in group F (P>0.05). So high-dose β₃-AR agonist was more effective than atorvastatin.

Values were means ± S.E.M. Results shown were representative of four independent experiments (n=10). A: normal control group, B: hyperlipidaemia model, C: positive control, D: low-dose β₃-AR agonist, E: high-dose β₃-AR agonist, F: β₃-AR antagonist. The y-axis represented the relative expression level of target gene mRNA in each group based on group A. ^aP <0.01 versus group A. ^bP <0.05 versus group B. ^cP <0.05 versus group C.

Values were means ± S.E.M. Results shown were representative of four independent experiments (n = 10). The y axis represents the ratio of relative protein expression level of the target gene to the internal reference protein (β-actin) in each group. ^aP <0.01 versus group A. ^bP <0.05 versus group B. ^cP <0.05 versus group C.

SNS and RAS play a key role in the regulation of renal function via their major neurotransmitters, and ARs and ATRs are widely distributed in the renal tissue. Studies have confirmed that β₃-AR can improve the metabolic disorders of glucose and lipid, and regulate the hemodynamic state [8]. Immunohistochemical staining results show that β₃-AR is mainly located in endothelial cells of renal arterioles and glomerular capillaries [11]. Excitatory β₃-AR can induce the glomerular afferent arteriolar vasodilation mediated by nitric oxide synthase (NOS) activation and nitric oxide (NO) release.[12]. This study mainly explored the effect of β₃-AR activation on interaction of renal ARs and ATRs in aging ApoE^−/− mice. The results confirmed that β₃-AR agonist treatment could down-regulate the expression of α_1A-AR and AT₁R (P < 0.05), and increased α_1B-AR, α_2A-AR, β₁-AR, β₃-AR and AT₂R expression in group D and E (P < 0.05), and thus resulted in improved lipid and glucose metabolism in aging hyperlipidaemia ApoE^−/− mice, indicating that there were interaction between β₃- AR and different subtypes of AR, and between β₃-AR and ATRs, which might play a protective role in renal function injury caused by hyperlipidemia.

Results showed that long-term high-fat diet in apoE-/- mice resulted in significantly increased serum nHDL-C, glucose and insulin levels. β₃-AR agonist intervention significantly decreased the serum nHDL-C, glucose and insulin levels, indicating that β₃-AR agonist improved glucose and lipid metabolism disorders under high fat condition. In atorvastatin group, the level of serum nHDL-C significantly reduced, while glucose and insulin levels were not changed obviously, demonstrating that atorvastatin had obvious lipid-regulating effect, but had little effect on glucose metabolism.

Renal α₁-AR plays an important role in the regulation of renal hemodynamic and tubular function. Among the subtypes of α₁-AR, α_1A-AR and α_1B-AR are the functional ones which mediate renal cortical vasoconstriction and renal tubular sodium and water reabsorption. Noradrenalin acts on α₂-AR mediated renal vasodilation and reduced sodium and water reabsorption by increasing NO production, which plays a protective effect on the kidney [13–15]. Our results showed that the expression of α_1A-AR was significantly increased while α_1B-AR and α_2A-AR were significantly decreased in the model mice kidney, which aggravated the renal injury. It might be related to the fact that dyslipidemia, hyperglycemia and hyperinsulinemia activated the SNS, resulting in receptor compensatory desensitization or down regulation. [16, 17]. Studies have also found that adrenergic nerves could down-regulate α₁B-AR in the presence of elevated blood glucose and insulin resistance, while in order to maintain the effective regulation of α₁-AR, the function of postsynaptic α₁A-AR was enhanced [[18]. In this study, long-term use of atorvastatin and β₃-AR agonist both decreased the expression of α_1A-AR, and increased the expression of α_1B-AR and α_2A-AR in aging ApoE^−/− mice. Atorvastatin and β₃-AR agonist promoted the recovery of the α_1A-AR, α_1B-AR and α_2A-AR expression, which alleviated renal injury. In addition, high-dose β₃-AR agonist was more effective on the regulation of receptor expression, possibly because both of β₃-AR and α-ARs were G protein-coupled receptors. β₃-AR activation interacted with α-ARs to induce or inhibit the formation of receptor dimer or cellular internalization, thus α_1A-AR, α_1B-AR and α_2A-AR expression tended to normal, which further improved renal function [19].

It has been established that β₁-AR and β₂-AR play a leading role in regulating renal blood flow and promoting sodium and chlorine reabsorption, as well as increasing renin secretion [20–22]. In the current study, the expression of β₁-AR, β₂-AR and β₃-AR in the renal tissues of the high-fat model group were significantly down-regulated, which might be related to the fact that chronic high fat treatment could activate the local renal RAS, AT₁R activation induced β₁-AR phosphorylation and desensitization via a PLC/PKC/c-src/PI3K pathway, and hyperinsulinemia inhibited β₃-AR gene transcription [23–25]. However, the expression of β₁-AR and β₃-AR in aging hyperlipidaemia ApoE^−/− mice were up-regulated by β₃-AR agonist, which suggested that there were interactions between β₁-AR and β₃-AR. β₃-AR agonist improved glucose and lipid metabolism disorders in ApoE^−/− mice, inhibited AT₁R-Gq signaling pathway, thus enhanced the role of β₁-AR, while β₃-AR could resist the receptor down regulation induced by log-term agonist stimulation [26, 27]. In contrast with this study, Seifert et al [28] reported that, β₃-AR agonist could induce β₃-AR desensitization of HEK293 cells from human embryonic kidney, probably because of the agonist concentration and exposure time. Compared with the high-fat model group, β₂-AR expression showed a trend of up-regulation after atorvastatin and β₃-AR agonist intervention, but the difference was not statistically significant, probably because β₁-AR in the renal tissue played a leading role, while β₂-AR had lower baseline expression level.

With local renal RAS activation, angiotensin II stimulates AT₁R, which can contract renal vessels, reduce vascular compliance, increase sodium reabsorption in renal tubules, activate SNS, induce inflammation and regulate the expression of bioactive substances [29–31]. On the other hand, activation of AT₂R can antagonize AT₁R via activating phosphotyrosine phosphatase and inactivating mitogen-activated protein kinase, which results in vasodilation, increased urine sodium excretion, inhibition of renin secretion and cell hypertrophy [32]. In our research, the expression of AT₁R and AT₂R in the high-fat model group was up-regulated, which was consistent with the results of Ma et al [33], namely, lipid load could up-regulate the expression of AT₁R and AT₂R in glomerulus and proximal tubule epithelial cells. After the intervention of atorvastatin and β₃-AR agonist, the expression of AT₁R was down-regulated, with the expression of AT₂R further up-regulated, meanwhile the regulation of ATR was most significant in the high-dose β₃-AR agonist group. The reason might be related to the fact that the effect of β₃-AR agonist and atorvastatin on lipid metabolism attenuated renal RAS activity and down-regulated AT₁R expression. In addition, β₃-AR agonists could further down-regulate AT₁R and up-regulate AT₂R expression via β₃-AR dependent nitric oxide synthase activation and nitric oxide release [34–37]. AT₂R could antagonize AT₁R via NO-cyclic guanosine monophosphate (cGMP) pathway, and further reduce the expression of AT₁R by reducing AT₁R transcription and forming heterodimer with AT₁R, so that the ratio of AT₁R to AT₂R tended to normal [38–40].

In summary, long-term excited β₃-AR can adjust expression of receptors associated with the renal function in aging hyperlipidaemia ApoE^−/− mice, suggesting that there were interactions between β₃- AR and different subtypes of AR, and between β₃-AR and ATR, which might play a protective role in renal function injury caused by hyperlipidemia.

apoE^-/-_:Apolipoprotein E knockout; nHDL-C: non-high density lipoprotein cholesterol; Glu: Glucose; Ins: Insulin; bp: base-pairs; SDS-PAGE: sodium dodecylsulfate polyacrylamide gel; TBST: Tris-buffered saline-Tween; ECL: enhanced chemiluminescence; AR: adrenoceptors; ATR: agitensin II receptors; NOS :nitric oxide synthase; NO: nitric oxide; cGMP: cyclic guanosine monophosphate.

Ethics approval and consent to participate

The experiments in this study have been approved by the Committee on the Ethics of Animal Experiments of Capital Medical University (Permit Number: SCXK-2012-0001).All animals were barrier-housed according to the standards for laboratory animals established by the People's Republic of China (GB14925-2001), and all procedures were carried in accordance with the ARRIVE guidelines. (https://arriveguidelines.org).

Consent for publication

Not applicable.

Availability of data and materials

The datasets used and/or analyzed during the current study are not publicly available yet, due to privacy concerns. Data are available from the corresponding author on reasonable request.

Competing interests

The authors declare no competing interests.

Funding

This study was funded by the Medical Science Research Project of Hebei Province (NO.20220455). The funding bodies did not play any role in the design of the study and collection, analysis, and interpretation of data and in writing the manuscript.

Authors’ contributions

Yanfang Li and Junying Song conceived and designed the experiments. Wei Wang successfully completed the whole project and was a major contributor in writing the manuscript. Fengde Li assisted the first author in completing all experiments on this subject. Fengde Li, Zhili Jiang and Junying Song helped to analyze the data and provided technical support during the trial. All authors agree to be personally responsible for their contributions and to ensure the accuracy or completeness of any part of the relevant issues. All authors read and approved the manuscript.

Acknowledgements

Thanks to all of the authors, such as Fengde Li, Yanfang Li_,Zhili Jiang, Junying Song. All authors are grateful to Fang Dong, Changjiang Xue, and Yu Wang not listed in the authorship, for guiding technical.

Michel MC, Brunner HR, Foster C, Huo Y. Angiotensin II type 1 receptor antagonists in animal models of vascular, cardiac, metabolic and renal disease. Pharmacol Ther. 2016;164; 1–81.
Packer M. Role of Deranged Energy Deprivation Signaling in the Pathogenesis of Cardiac and Renal Disease in States of Perceived Nutrient Overabundance. CIRCULATION. 2020;141; 2095–2105.
Li Q, Ge C, Tan J, Sun Y, Kuang Q, Dai X, et al. Juglanin protects against high fat diet-induced renal injury by suppressing inflammation and dyslipidemia via regulating NF-kappaB/HDAC3 signaling. INT IMMUNOPHARMACOL. 2021;95; 107340.
Zhang R, Yu Y, Deng J, Zhang C, Zhang J, Cheng Y, et al. Sesamin Ameliorates High-Fat Diet-Induced Dyslipidemia and Kidney Injury by Reducing Oxidative Stress. NUTRIENTS. 2016;8.
Zhao LS, Bai WW, Xiang GD, Yue L, Sun HL. Clinical evaluation of valsartan and metoprolol tartrate in treatment of diabetic nephropathy with positive beta1-adrenergic and anti-angiotensin II type 1 receptor antibody. Chin Med J (Engl). 2012;125; 3543–3547.
Wang ZH, Li YF, Guo YQ. beta3-Adrenoceptor activation attenuates atherosclerotic plaque formation in ApoE(-/-) mice through lowering blood lipids and glucose. ACTA PHARMACOL SIN. 2013;34; 1156–1163.
Song JY, Li YF, Zhi-Li J, Guo YQ. Effects of beta(3)-adrenoceptor activation on expression of pancreatic adrenoceptors and angiotensin II receptors in ApoE(-/-) mice. EUR J PHARMACOL. 2015;764; 134–139.
Wang ZH, Li YF, Guo YQ. beta3-Adrenoceptor activation attenuates atherosclerotic plaque formation in ApoE(-/-) mice through lowering blood lipids and glucose. ACTA PHARMACOL SIN. 2013;34; 1156–1163.
Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. METHODS. 2001;25; 402–408.
Jiang ZL, Li YF, Song JY, Guo YQ. Effects of beta3-adrenoceptor activation on the interaction between adrenoceptors and angiotensin II receptors in apolipoprotein E knockout mouse lung. EUR J PHARMACOL. 2014;742; 75–80.
Yilmaz-Oral D, Kaya-Sezginer E, Askin D, Hamurtekin Y, Gur S. Mirabegron, A Selective beta3-Adrenoceptor Agonist Causes an Improvement in Erectile Dysfunction in Diabetic Rats. Exp Clin Endocrinol Diabetes. 2021;129; 296–302.
Feng MG, Prieto MC, Navar LG. Nebivolol-induced vasodilation of renal afferent arterioles involves beta3-adrenergic receptor and nitric oxide synthase activation. Am J Physiol Renal Physiol. 2012;303; F775-F782.
Terker AS, Yang CL, McCormick JA, Meermeier NP, Rogers SL, Grossmann S, et al. Sympathetic stimulation of thiazide-sensitive sodium chloride cotransport in the generation of salt-sensitive hypertension. HYPERTENSION. 2014;64; 178–184.
Saiz J, Pazos A, Del OE, Saiz V, Sanchez A. Yohimbine-induced alterations in alpha(2)-adrenoceptors in kidney regions of the spontaneously hypertensive rats: an autoradiographic analysis. PHARMACOL REP. 2008;60; 391–398.
Hering L, Rahman M, Potthoff SA, Rump LC, Stegbauer J. Role of alpha2-Adrenoceptors in Hypertension: Focus on Renal Sympathetic Neurotransmitter Release, Inflammation, and Sodium Homeostasis. FRONT PHYSIOL. 2020;11; 566871.
Proudman R, Baker JG. The selectivity of alpha-adrenoceptor agonists for the human alpha1A, alpha1B, and alpha1D-adrenoceptors. Pharmacol Res Perspect. 2021;9; e799.
Proudman R, Akinaga J, Baker JG. The affinity and selectivity of alpha-adrenoceptor antagonists, antidepressants and antipsychotics for the human alpha2A, alpha2B, and alpha2C-adrenoceptors and comparison with human alpha1 and beta-adrenoceptors. Pharmacol Res Perspect. 2022;10; e936.
Lenart K, Pap A, Porszasz R, V OA, Fesus L, Madi A. Transglutaminase 2 Has Metabolic and Vascular Regulatory Functions Revealed by In Vivo Activation of Alpha1-Adrenergic Receptor. INT J MOL SCI. 2020;21.
Seifert R. A door opener for future research: agonist-induced beta3-adrenoceptor desensitization in HEK cells but not CHO cells. Naunyn Schmiedebergs Arch Pharmacol. 2013;386; 841–842.
Hadri KE, Charon C, Pairault J, Hauguel-De MS, Quignard-Boulange A, Feve B. Down-regulation of beta3-adrenergic receptor expression in rat adipose tissue during the fasted/fed transition: evidence for a role of insulin. BIOCHEM J. 1997;323 (Pt 2); 359–364.
Kamiar A, Yousefi K, Dunkley JC, Webster KA, Shehadeh LA. beta2-Adrenergic receptor agonism as a therapeutic strategy for kidney disease. Am J Physiol Regul Integr Comp Physiol. 2021;320; R575-R587.
Arif E, Nihalani D. Beta2-adrenergic receptor in kidney biology: A current prospective. Nephrology (Carlton). 2019;24; 497–503.
Dominguez-Vias G, Segarra AB, Ramirez-Sanchez M, Prieto I. High-Fat Diets Modify the Proteolytic Activities of Dipeptidyl-Peptidase IV and the Regulatory Enzymes of the Renin-Angiotensin System in Cardiovascular Tissues of Adult Wistar Rats. Biomedicines. 2021;9.
Xu Y, Marck P, Huang M, Xie JX, Wang T, Shapiro JI, et al. Biased Effect of Cardiotonic Steroids on Na/K-ATPase-Mediated Signal Transduction. MOL PHARMACOL. 2021;99; 217–225.
Chen H, Cao N, Wang L, Wu Y, Wei H, Li Y, et al. Biased activation of beta2-AR/Gi/GRK2 signal pathway attenuated beta1-AR sustained activation induced by beta1-adrenergic receptor autoantibody. Cell Death Discov. 2021;7; 340.
Coman OA, Paunescu H, Ghita I, Coman L, Badararu A, Fulga I. Beta 3 adrenergic receptors: molecular, histological, functional and pharmacological approaches. Rom J Morphol Embryol. 2009;50; 169–179.
Elalouf JM, Buhler JM, Tessiot C, Bellanger AC, Dublineau I, de Rouffignac C. Predominant expression of beta 1-adrenergic receptor in the thick ascending limb of rat kidney. Absolute mRNA quantitation by reverse transcription and polymerase chain reaction. J CLIN INVEST. 1993;91; 264–272.
Ma KL, Ni J, Wang CX, Liu J, Zhang Y, Wu Y, et al. Interaction of RAS activation and lipid disorders accelerates the progression of glomerulosclerosis. INT J MED SCI. 2013;10; 1615–1624.
Akaishi T, Abe M, Okuda H, Ishizawa K, Abe T, Ishii T, et al. High glucose level and angiotensin II type 1 receptor stimulation synergistically amplify oxidative stress in renal mesangial cells. Sci Rep. 2019;9; 5214.
Koba S. Angiotensin II, Oxidative Stress, and Sympathetic Nervous System Hyperactivity in Heart Failure. YONAGO ACTA MED. 2018;61; 103–109.
van der Lubbe N, Zietse R, Hoorn EJ. Effects of angiotensin II on kinase-mediated sodium and potassium transport in the distal nephron. Curr Opin Nephrol Hypertens. 2013;22; 120–126.
Carey RM, Padia SH. Role of angiotensin AT(2) receptors in natriuresis: Intrarenal mechanisms and therapeutic potential. Clin Exp Pharmacol Physiol. 2013;40; 527–534.
Abdulla MH, Sattar MA, Abdullah NA, Hye KM, Anand SK, Johns EJ. The contribution of alpha1B-adrenoceptor subtype in the renal vasculature of fructose-fed Sprague-Dawley rats. EUR J NUTR. 2011;50; 251–260.
Kiaie N, Gorabi AM, Reiner Z, Jamialahmadi T, Ruscica M, Sahebkar A. Effects of Statins on Renin-Angiotensin System. J Cardiovasc Dev Dis. 2021;8.
Kovacs Z, Szucs G, Freiwan M, Kovacs MG, Marvanykovi FM, Dinh H, et al. Comparison of the antiremodeling effects of losartan and mirabegron in a rat model of uremic cardiomyopathy. Sci Rep. 2021;11; 17495.
Lu H, Balakrishnan A, Howatt DA, Wu C, Charnigo R, Liau G, et al. Comparative effects of different modes of renin angiotensin system inhibition on hypercholesterolaemia-induced atherosclerosis. Br J Pharmacol. 2012;165; 2000–2008.
Kamiya M, Asai K, Maejima Y, Shirakabe A, Murai K, Noma S, et al. beta 3-Adrenergic Receptor Agonist Prevents Diastolic Dysfunction in an Angiotensin II-Induced Cardiomyopathy Mouse Model. J PHARMACOL EXP THER. 2021;376; 473–481.
Rianto F, Hoang T, Revoori R, Sparks MA. Angiotensin receptors in the kidney and vasculature in hypertension and kidney disease. MOL CELL ENDOCRINOL. 2021;529; 111259.
Peluso AA, Santos RA, Unger T, Steckelings UM. The angiotensin type 2 receptor and the kidney. Curr Opin Nephrol Hypertens. 2017;26; 36–42.
Li XC, Zhou X, Zhuo JL. Evidence for a Physiological Mitochondrial Angiotensin II System in the Kidney Proximal Tubules: Novel Roles of Mitochondrial Ang II/AT1a/O2(-) and Ang II/AT2/NO Signaling. HYPERTENSION. 2020;76; 121–132.

No competing interests reported.

PDF

Editorial decision: Major revision
19 Jul, 2022
Reviews received at journal
08 Jul, 2022
Reviewers agreed at journal
04 Jul, 2022
Reviewers invited by journal
01 Jul, 2022
Editor assigned by journal
01 Jul, 2022
Editor invited by journal
10 Jun, 2022
Submission checks completed at journal
10 Jun, 2022
First submitted to journal
02 Jun, 2022

You are reading this latest preprint version

Effect of β₃ -adrenoceptor Activation on interaction of Renal Adrenoceptors and Angiotensin II Receptors in Aging ApoE^-/- mice

Status:

Version 1

Abstract

Figures

Background

Methods

Results

Discussion

Abbreviations

Declarations

References

Competing Interests

Status:

Version 1