K fragment, a PCR-based vector for antibiotic resistance gene hunting

doi:10.21203/rs.3.rs-1723923/v1

Download PDF

Method Article

K fragment, a PCR-based vector for antibiotic resistance gene hunting

https://doi.org/10.21203/rs.3.rs-1723923/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Antimicrobial resistance (AMR) is an important health issue in the world. To evaluate and predict, known and unknown resistance genes that are responsible for AMR should be identified and characterized. Unlike known genes, unknown genes are difficult to detect. In this study, we generated the plasmid of K fragment (pKF) from pUC19 vector by removing multiple cloning site (MCS) and adding Prom-RBS sequence. pKF was used for amplification of K fragment that contains RBS and promoter at both directions and plasmid origin of replication. The functionality of added Prom-RBS sequence and K fragment as a cloning vector was tested by cloning chloramphenicol resistance gene amplicon and erythromycin resistance gene from genomic DNA, respectively. Cloning of them confirmed the usability of this newly developed cloning method with K fragment. K fragment is a PCR based and antibiotic resistance gene-free cloning vector. It allows cloning of resistance genes at all orientations just by changing restriction enzymes for primers and fragmentation. This method enables the microbiological and molecular characterization of cloned genes. We expect the use of K fragment for cloning of resistance genes from different environments without cultivation. It will contribute to fighting AMR by identification of resistance genes before their dissemination.

Antimicrobial resistance

resistance gene

cloning vector

cloning method

K fragment

World Health Organisation (WHO) declared antimicrobial resistance (AMR) is one of the most important health problems in the world and more than 750000 people die because of AMR each year. It is predicted the number can reach 10 million in 2050 if necessary and effective steps are not taken to prevent AMR (Dadgostar, 2019; WHO, 2020). The treatment options for infections with antimicrobial-resistant pathogens are decreasing due to the increase of newly emergent resistance genes and the spreading of resistant strains (Bader et al, 2020; Davies and Oxlade, 2021). One of the reasons for the spreading of AMR can be the usage of antibiotics for the treatment of infections in animals besides humans, even they are used as a food additive to promote the growth of livestock (Spellberg et al., 2016; Patel et al., 2020). They accumulated in the environment because of both prevalent usage and no disappears activity after usage (Czekalski et al, 2015). The antibiotic resistance genes can emerge naturally or in the presence of antibiotic pressure. However, antibiotic pressure in the environment accelerates the dissemination of them even the resistance genes occur naturally (Martinez, 2009; Bengtsson-Palme et al., 2018). Improvement of new and efficient techniques for detection of known/unknown antibiotic resistance genes from various environments is important to foresee the potency of antibiotic resistance problem and overcome this issue.

Investigation of antibiotic resistance genes was begun with the emergence of antibiotic-resistant strains in clinical isolates and insufficient treatment of infectious diseases. Phenotypic methods like antibiogram and microdilution and genotypic methods like PCR have been used for a long time (Fluit et al., 2001; Glahano et al., 2021). Phenotypic methods are not enough to detect antibiotic resistance caused by which gene and dominant resistance gene/mechanism and it need a culture of microorganisms. Some genotypic methods like PCR cannot be used to detect unknown resistance genes and the presence of a part of the gene could not be clear evidence of antibiotic resistance. Cloning of antibiotic resistance genes is a more reliable method and it has been used to clone them from different sources by using cloning vector (Bozdogan et al., 2003; Brown et al., 2010). Functional metagenomics is another molecular option for cloning antibiotic resistance genes from different sources (Mullany, 2014). The disadvantages of the method are the presence of a resistance gene in the vector that prevents cloning of all resistance genes and obtaining of vector need efforts and significant cost. In the study, we construct an extraordinary vector, is PCR based vector named as K vector and developed a cloning method. The constructed vector proved that PCR amplicon containing plasmid origin of replication sequence can enable cloning of antibiotic resistance genes.

Bacterial strains, culture conditions and antibiotics

Escherichia coli DH10B strain was used for cloning experiments as a host organism. Staphylococcus aureus ADU1 strain that has chloramphenicol resistance and Staphylococcus aureus ADU2 strain that has erythromycin resistance were from our clinical isolate collection. The bacteria were cultured at 37°C in aerobic conditions. Tryptic soy broth and tryptic soy agar were used for the cultivation of bacteria.

The antibiotics that are used in the experiment are ampicillin, chloramphenicol and erythromycin. Their final concentrations were 100 µg/ml, 10 µg/ml and 10 µg/ml, respectively. Also, in addition to ampicillin, X-gal (5-Bromo-4-Chloro-3-Indolyl β-D-Galactopyranoside) and IPTG (Isopropyl β-D-1-thiogalactopyranoside) were used preparation of AXI selective medium and their final concentrations were 50 µg/ml and 1 mM, respectively.

Plasmid Isolation

Plasmids used in this study were isolated by using Presto™ Mini Plasmid Kit (Geneaid, China) according to the manufacturer's instructions.

DNA isolation

DNA extraction for PCR was carried out with DNA4PCR (RTech, Turkey) from S. aureus ADU1. Briefly, a few colonies were taken and suspended in 1 ml of distilled water. Then, it was centrifuged. The pellet was suspended in 100 µl of DNA4PCR solution. The cell suspension was incubated at 56°C for 20 minutes. After vortexing samples were incubated at 100°C for 8 minutes. Following centrifugation, the supernatant was used as a DNA source.

Total DNA of S. aureus ADU2 was isolated with Bacteria Genomic DNA Purification Kit (Genemarkbio, Taiwan). However, a little modification was done at the lysozyme treatment step. Lysostaphin solution was added with 5 µg/ml final concentration. The remaining steps were processed according to the manufacturer's recommendations.

DNA manipulations

Restriction reactions were set up by using FastDigest enzymes (Thermo Scientific™, USA). For digestion with one enzyme, 10 µl of DNA, 2 µl of 10X FastDigest buffer, 1 µl of restriction enzyme and 6 µl of molecular water were mixed. If double digestion were processed, 1 µl was added to mix from each enzyme and 6 µl of water was added to the reaction mixture. The reaction mixtures were incubated at 37°C for 15 minutes. For the ligation of DNA with both sticky and blunt ends, T4 DNA Ligase (Thermo Scientific™, USA) was used. Briefly, 10 µl of DNA, 2 µl of 10X T4 DNA Ligase buffer, 1 µl of T4 DNA Ligase (5 Weiss U/μl) and 7 µl of molecular water were mixed. It was incubated at 22°C for overnight. S1 Nuclease enzyme (Thermo Scientific™, USA) was used for blunting of DNA with sticky ends. Briefly, 10 µl of DNA, 6 µl of 5X Reaction Buffer for S1 Nuclease, 1 µl of S1 Nuclease (1 U/µl), and 13 µl of molecular water were mixed and incubated at room temperature for 30 minutes. For the phosphorylation of DNA, T4 Polynucleotide Kinase (T4 PNK) was used. Briefly, 10 µl of DNA, 2 µl of 10X Reaction Buffer for T4 Polynucleotide Kinase, 2 µl of 10 mM ATP, 1 µl of T4 PNK (10 unite/ul) and 5 µl of molecular water were mixed and incubated at 37°C for 20 minutes.

DNA purification

During all experiments, DNA purifications were processed with a PCR clean-up kit.

PCR

PCR reactions were carried out based on an initial denaturation at 95 ◦C (4 min), followed by 35 cycles of denaturation at 95 ◦ C for 1 min, annealing at 55C for 1 min, extension at 72 ◦ C for 30 sn-2 min (depends on the length of amplicon), and final elongation at 72 ◦ C for 5 min in a reaction volume of 50 µl using a T100 thermal cycler (Bio-rad laboratories, Inc, USA). The used primers in the study were given in Table 1 and their abbreviations represent H: HindIII, E: EcoRI, P: PstI, B: BamHI, and Sau3aI restriction enzyme recognition site.

Sequencing

The cloned DNA fragments were sequenced using primers used for amplification with Sanger sequencing (Medsantek, Turkey).

Preparation of competent cells and transformation experiments

The competent cells were prepared from E. coli DH10B strain and the ligand was transferred into the competent cells by using the "Preparation and Transformation of Competent E. coli Using Calcium Chloride” method (Sambrook, 2006). For transformation, the ligand was incubated at 42 ˚C for 2 minutes and immediately transferred onto the ice for 2 minutes. Then, 900 µl of Tryptic Soy Broth (TSB) was added into the tube and incubated at 37 ˚C for one hour. Finally, the cells were inoculated onto TSA containing antibiotics. Concentrations of antibiotics were given.

The competent cells were prepared from S. aureus RN4220 strain and the ligand was transferred into the competent cells by using the "Transformation of E. coli by Electroporation" method for this strain. 100 µl competent cells and 10 µl of ligand DNA were mixed and incubated on ice for 30 minutes. The mixture was transferred to a 0.2 cm electroporation cuvette and electroporation was processed with Ec2 programme (2.49 kV-1 pulse) by using MicroPulser Electroporator device (Bio-rad laboratories, Inc, USA). 900 µl of TSB was added to cells and it was incubated at 37 ˚C. After that, 200 µl of cells were inoculated onto TSA containing antibiotics.

Design of Promoter-RBS (PromRBS) sequence

E. coli-specific promoter was chosen from http://parts.igem.org website and the selected 17 base sequence contains constitutive and repetitive TA sequence. As Shine-Dalgarno sequence, “TAAGGAGGT” was used (Saito et al, 2020) and as a spacer, 6 bases, “ACAGCT”, were used. The PromRBS sequence and used primers were given in Table 1.

Data availability

The sequence of pKF was submitted to the GenBank database. The accession number is OM304286.

1. K fragment

The Prom-RBS sequence and its structure were given in Figure 1a and the schematic representation of "K fragment" was given in Figure 1b. It has a promoter and ribosomal binding site (RBS) at both terminals without any antibiotic resistance gene as a selectable marker it was necessary to introduce an additional RBS and promoter sequence. A template vector is a plasmid of K fragment (pKF) for “K fragment” was constructed. The creation of K fragment was processed in two steps. They were a derivation of MCS-free pUC19 (pUC19^-MCS) and construction of pKF vector.

i) Generation of pUC19^-MCS

The multiple cloning site (MCS) was excised from pUC19 vector to use various restriction enzymes for cloning into K fragment. MCS was removed with restriction of pUC19 with EcoRI and HindIII because these enzymes are found at the ends of multiple cloning sites and are suitable for the subtraction of all of MCS. The restricted DNA that had 5’ overhangs was blunted with S1 nuclease enzyme. The blunt-ended DNA fragments were self-ligated and transferred into E. coli DH10B. The selection of transformants was done on AXI plate. Contrary to pUC19, pUC19^-MCS formed white colonies on AXI plate. This was related to the disruption of lacZalfa gene because of the removal of MCS. To confirm the removal of MCS using a molecular method, the plasmids isolated from transformants were restricted by RsaI enzyme and pUC19 vector was used as a control because one of the 3 restriction sites of RsaI was found in MCS. Digestion of pUC19 with RsaI formed 3 DNA fragments on the agarose gel. Their sizes were 241 bp, 676 bp ve 1769 bp. However, the digestion of pUC19^-MCSwith RsaI formed only 2 DNA fragments on an agarose gel. Their sizes were 2010 bp and 676 bp (Figure 2a). So, the removal of MCS was confirmed. The removal of MCS from pUC19 was summarized in Figure 2b.

ii) The construction of pKF

Promoter-RBS sequence was designed in this study. It was introduced to the complementary strand and opposite direction of bla_TEM gene in pUC19^-MCSto facilitate gene expression at both orientations with site-directed mutagenesis. It was added with 3 steps because of the length of this sequence. The workflow of this step was shown in Figure 3a. The PCR products that were produced during the site-directed mutagenesis process were seen in Figure 3b. Briefly, PCR was set up using P1 and pUCPR as primers and the pUC19^-MCSvector as a DNA source. Then, the amplicon was used as a DNA source for the second PCR reaction using P2 and pUCPR primers. The P2 primers contained a part of the promoter and the RBS sequence that we wanted to insert. This second amplicon was used as a DNA source for 3^rd PCR reaction which was done using P3 primers that contain the remaining part of the promotor and RBS sequence (Figure 3b). The final PCR product was phosphorylated and self-ligated. The ligand was then transferred to E. coli DH10B and the colonies were grown at the selective plate that contained ampicillin were chosen for further investigations. Colony PCR was done with these colonies by using prmtrSeq and KsekF primers, and pUC19^-MCS was used as control. The used primers amplify regions that contain promoter-RBS. So, if pKF was DNA source, the amplicon was 1079 bp but if the promoter-RBS sequence would not be added into pUC19^-MCS, the amplicon was 1031 bp. The size of the amplicon obtained from the transformant was 1079 bp and the amplicon obtained from pUC19^-MCS DNA source was 1031 bp (Figure 3c). In addition to PCR confirmation, integration of promoter-RBS was validated by sequencing the amplicon with prmtrSeq primer. The linear and circular forms of pKF were given in Figure 4.

iii) Confirmation of functionality of Prom-RBS on K fragment

The cloning of cat gene that was responsible for chloramphenicol resistance was carried out to improve positioned Prom-RBS sequence on K fragment facilitates the expression of antibiotic resistance genes. The suitable restriction enzyme sequences were added to both cat gene primers and K fragment primers to specify cloning orientation. The representation of cloning was demonstrated in Figure 5a. K fragment from pKF with K-HF and K-ER primers and cat from S. aureus ADU1 strain with cat-HF and cat-ER primers were amplified with designed primers and the amplicons were restricted (Figure 5b). They were ligated and transferred into competent E. coli DH10B cells. The cells were selected on agar plates with 10 µg/ml chloramphenicol. The grown colonies were investigated with colony PCR and plasmid extraction. The presence of K fragment and cat gene was confirmed with PCR by using primers that were used for their amplification. Also, the plasmid was extracted from grown cells on selective media. The plasmid was restricted with EcoRI and HindIII enzymes because these enzymes were used for cloning. Both PCR and plasmid extraction demonstrated K fragment and cat at their sizes, 1861 bp and 626 bp, respectively (Figure 5c). The experiment showed that K fragment that carried sequence was needed for plasmid replication can be used as a vector for cloning and Prom-RBS sequence can facilitate transcription and translation of a resistance gene.

Usage of K fragment as a vector for antibiotic resistance gene cloning

To test the employability of K fragment for antibiotic resistance gene cloning from genomic DNA, genomic DNA was isolated and run on agarose gel (Figure 6a). In addition to chromosome, a band was observed near 2500 bp. Also, K fragment was amplified from pKF vector with designed primers that have HindIII, EcoRI, PstI and Sau3aI restriction sequences at their 5’ ends. The used primers are K-HF and K-HR, K-EF and K-ER, K-PF and K-PR, and K-BF and K-BR primer pairs (Table). The genomic DNA was digested by HindIII, EcoRI, PstI and Sau3aI enzymes and K fragment was digested same enzymes for compatible cohesive ends except for Sau3aI (Figure 6b). K fragment was digested by BamHI to obtain overhangs at 5’ ends of K fragment that are compatible with Sau3aI. The DNA fragments that have the same cohesive ends were ligated and transferred to E. coli DH10B. The colonies that grew on erythromycin containing plate (Figure 7a) were examined in both PCR and plasmid isolation. To confirm the existence of K fragment in transformants, PCR was set up with K-F and K-R primers (Table 1) and the inserts were amplified and sequenced with KseqF and KseqR primers. The sizes of inserts were obtained with the digestion of genomic DNA by using HindIII enzyme were equal to each other and about 2400 bp (Figure 7b). The sizes of inserts were obtained with partial digestion of genomic DNA with Sau3aI enzyme were varied and they were 2000 bp, 2300 bp, and 2700 bp (Figure 7b). The sequence results showed that ermC, erythromycin resistance gene, was cloned in K fragments in different orientations. Besides ermC gene, repL gene, is a replication protein belonging to Staphylococcus plasmid, was cloned to K fragment together with ermC. So, it was revealed that ermC gene was carried by a plasmid in S. aureus ADU2 strain. Also, the construction was transferred to S. aureus RN4220 strain and selected on agar plates containing erythromycin. The plasmid was isolated from colonies grown on the plates and it was confirmed.

Characterization of antibiotic resistance genes from different sources is important. Methods for resistance characterization are based on molecular or phenotypic methods. The phenotypic methods are helpful for the characterization of resistance genes, however, the bacteria that carry resistance gene should be cultivable in laboratory conditions, but many microorganisms could not be cultured or needs more labour and cost. Although molecular methods are advantageous for the detection of known genes these methods are not useful for the characterization of unknown genes. So the best option for characterization of unknown resistance genes is cloning and determining the resistance effect of these genes. The method that we developed in the present study allows phenotypic and molecular characterization of resistance genes.

We tested the useableness of a PCR amplicon (K fragment) containing a plasmid origin sequence that can be used as a vector for cloning of all antibiotic resistance genes by using restriction enzymes. To create a backbone for K fragment, MCS was extracted from pUC19 to use restriction enzymes for cloning and also designed promoter-RBS sequence was placed to have promoter-RBS in both directions. K fragment was amplified from pKF vector with primers containing restriction enzyme sequences. The results of the present study showed that i) K fragment can be used for cloning of amplicon of antibiotic resistance gene and Prom-RBS sequence is an adequate sequence for expression, ii) K fragment is functional for cloning from genomic DNA and cloning in either direction allow expression of resistance genes, iii) this cloning method permits detection of carrier genetic element of the resistance genes (Fig. 8).

One of the earliest and most common molecular methods for resistance gene cloning is shotgun cloning (Thompson et al, 1982; Zhou et al, 2012). Functional metagenomics is a modified shotgun method and aims to clone of antibiotic resistance genes from different environmental sources (Martiny et al., 2011; Flórez et al., 2017). The shotgun method is a useful method, but it has some limitations and requires a cloning vector carrying at least one antibiotic resistance gene. As the vector already carry a resistance gene as a marker, the shotgun method cannot be used for cloning all antibiotic resistance genes. K fragment does not carry any antibiotic resistance gene, and it allows cloning and expression of all resistance genes. The limitation of this method is the expression of resistance in transformed bacteria. As we use only E. coli as competent bacteria, for example intrinsically vancomycin resistance cannot be expressed in E. coli even it is transformed with resistance genes (Vestö et al 2018). The shotgun method also has this limitation. We believe that K fragment has a great potential to be used in functional metagenomics for antibiotic resistance gene cloning from various environments. Another popular method for the detection of resistance genes is the total DNA sequencing of a given sample. The metagenomic method is used for the detection of resistance genes in total DNA obtained from different sources (Fresia et al., 2019; Li et al., 2020). Limitation of metagenomic analysis may be the inconsistency of detection of resistance gene and phenotypic and microbiological results (Sanabria et al, 2021). Since the detected DNA sequence as a resistance gene may not be whole or functional. Metagenomic methods allow the detection of resistance genes from various environments, however, these methods can be used only for known resistance genes. Probably many unknown resistance genes exist now and new resistance genes will emerge in the course of time. Bioinformaticians working on the detection of unknown resistance genes by using conserved regions of known resistance genes showed the presence of unknown resistance genes (Berglund et al, 2019; Van Camp et al., 2020). A different perspective aimed to detect antibiotic resistance by amplifying and cloning different parts of the integron (Razavi et al., 2017). The method is insufficient to detect a large number of resistance genes because there are many resistance genes that exist do not carried by integrons. Conventional PCR, quantitative PCR (qPCR), Reverse Transcriptase Polymerase Chain Reaction (RT-PCR), and microarray hybridization methods are widely used for the detection of resistance genes in distinct microorganisms or various samples (Galhano et al., 2021). The molecular methods and metagenomics-based methods are not capable to show whether detected genes are functional or not and do not contribute to the characterization of new resistance genes, they facilitate only detection of known resistance genes. The method developed in this study enables the detection of both known and unknown resistance genes, and it facilitates the characterization of all resistance genes.

In this study, we developed K fragment: a PCR based, antibiotic marker-free vector that allow transcription and translation of resistance genes in all orientations which may be used for cloning of antibiotic resistance genes. The ability of K fragment for resistance gene cloning from genomic DNA was tested and it was successful. The utility of K fragment for resistance gene cloning and functional metagenomics from different sources like wastewater, faeces, the soil may be tested. The vector and method can contribute to the fight against antibiotic resistance problem by detecting, describing and characterizing them.

Funding

This work was supported by The Scientific and Technological Research Council of Turkey (TUBITAK) with the project number is 119Z640. Author Hanife Salih has been supported by (Council of Higher Education) YÖK 100/2000 PhD Scholarship and TUBITAK 2211/A National PhD Scholarship Program.

Author contribution statement

Hanife Salih: Investigation, Methodology, Writing – original draft; Erman Oryaşin: Conceptualization, Resources, Writing – review & editing; Bülent Bozdoğan: Conceptualization, Writing – review & editing, Supervision, Project administration.

Competing interests statement

Competing interests: The authors declare there are no competing interests.

Data availability statement

The sequence of pKF was submitted to the GenBank database. The accession number is OM304286.

Acknowledgements

There is no acknowledgement information.

Bader, M. S., Loeb, M., Leto, D., & Brooks, A. A. (2020). Treatment of urinary tract infections in the era of antimicrobial resistance and new antimicrobial agents. Postgraduate medicine, 132(3), 234–250. https://doi.org/ 10.1080/00325481.2019.1680052.
Bengtsson-Palme, J., Kristiansson, E., & Larsson, D. J. (2018). Environmental factors influencing the development and spread of antibiotic resistance. FEMS microbiology reviews, 42(1), fux053. https://doi.org/10.1093/femsre/fux053.
Bozdogan, B., Galopin, S., Gerbaud, G., Courvalin, P., & Leclercq, R. (2003). Chromosomal aadD2 encodes an aminoglycoside nucleotidyltransferase in Bacillus clausii. Antimicrobial agents and chemotherapy, 47(4), 1343–1346. https://doi.org/10.1128/AAC.47.4.1343-1346.2003.
Brown, M. G., Mitchell, E. H., & Balkwill, D. L. (2010). Screening for Novel Antibiotic Resistance Genes. In Metagenomics (pp. 265–271). Humana Press, Totowa, NJ. https://doi.org/10.1007/978-1-60761-823-2_18.
Czekalski, N., Sigdel, R., Birtel, J., Matthews, B., & Bürgmann, H. (2015). Does human activity impact the natural antibiotic resistance background? Abundance of antibiotic resistance genes in 21 Swiss lakes. Environment international, 81, 45–55. https://doi.org/10.1016/j.envint.2015.04.005
Dadgostar, P. (2019). “Antimicrobial resistance: implications and costs”, Infection and drµg resistance, 12, 3903. https://doi.org/10.2147/IDR.S234610.
Davies, S. C., & Oxlade, C. (2021). Innovate to secure the future: the future of modern medicine. Future Healthcare Journal, 8(2), e251. https://doi.org/10.7861/fhj.2021-0087
Flórez, A. B., Vázquez, L., & Mayo, B. (2017). A functional metagenomic analysis of tetracycline resistance in cheese bacteria. Frontiers in microbiology, 8, 907. https://doi.org/10.3389/fmicb.2017.00907
Fluit, A. C., Visser, M. R., & Schmitz, F. J. (2001). Molecular detection of antimicrobial resistance. Clinical microbiology reviews, 14(4), 836–871. https://doi.org/10.1128/CMR.14.4.836-871.2001
Fresia, P., Antelo, V., Salazar, C., Giménez, M., D’Alessandro, B., et al. (2019). Urban metagenomics uncover antibiotic resistance reservoirs in coastal beach and sewage waters. Microbiome, 7(1), 1–9. https://doi.org/10.1186/s40168-019-0648-z.
Guitor, A. K., Raphenya, A. R., Klunk, J., Kuch, M., Alcock, B.,et al. (2019). Capturing the resistome: a targeted capture method to reveal antibiotic resistance determinants in metagenomes. Antimicrobial agents and chemotherapy, 64(1), e01324-19. https://doi.org/10.1128/AAC.01324-19.
Li, Y., Cao, W., Liang, S., Yamasaki, S., Chen, X., et al. (2020). Metagenomic characterization of bacterial community and antibiotic resistance genes in representative ready-to-eat food in southern China. Scientific reports, 10(1), 1–14. https://doi.org/10.1038/s41598-020-72620-4.
Martinez, J. L. (2009). The role of natural environments in the evolution of resistance traits in pathogenic bacteria. Proceedings of the Royal Society B: Biological Sciences, 276(1667), 2521–2530. https://doi.org/10.1098/rspb.2009.0320.
Martiny, A. C., Martiny, J. B. H., Weihe, C., Field, A., & Ellis, J. (2011). Functional metagenomics reveals previously unrecognized diversity of antibiotic resistance genes in gulls. Frontiers in microbiology, 2, 238. https://doi.org/10.3389/fmicb.2011.00238
Mullany, P. (2014). Functional metagenomics for the investigation of antibiotic resistance. Virulence, 5(3), 443–447. https://doi.org/10.4161/viru.28196.
Patel, S. J., Wellington, M., Shah, R. M., & Ferreira, M. J. (2020). Antibiotic stewardship in food-producing animals: Challenges, progress, and opportunities. Clinical therapeutics. https://doi.org/10.1016/j.clinthera.2020.07.004.
Razavi, M., Marathe, N. P., Gillings, M. R., Flach, C. F., Kristiansson, E., et al. (2017). Discovery of the fourth mobile sulfonamide resistance gene. Microbiome, 5(1), 1–12. https://doi.org/10.1186/s40168-017-0379-y.
Saito, K., Green, R., & Buskirk, A. R. (2020). Translational initiation in E. coli occurs at the correct sites genome-wide in the absence of mRNA-rRNA base-pairing. Elife, 9, e55002. https://doi.org/10.7554/eLife.55002.
Sambrook, J., & Russell, D. W. (2001). 3rd ed. Cold Spring Harbor, N.Y: Cold Spring Harbor Laboratory Press.
Sanabria-Moreno, A. M., James Peter, J. J., Hjerde, E., Simonsen, G. S., & Hanssen, A. M. (2021). Shotgun-metagenomics based prediction of antibiotic resistance and virulence determinants in Staphylococcus aureus from periprosthetic tissue on blood culture bottles. https://doi.org/10.1038/s41598-021-00383-7.
SP Galhano, B., G Ferrari, R., Panzenhagen, P., S de Jesus, A. C., & A Conte-Junior, C. (2021). Antimicrobial Resistance Gene Detection Methods for Bacteria in Animal-Based Foods: A Brief Review of Highlights and Advantages. Microorganisms, 9(5), 923. https://doi.org/10.3390/microorganisms9050923.
Spellberg, B., Hansen, G. R., Kar, A., Cordova, C. D., Price, L. B., et al. (2016). Antibiotic resistance in humans and animals. NAM Perspectives.
Thompson, C. J., Ward, J. M., & Hopwood, D. A. (1982). Cloning of antibiotic resistance and nutritional genes in streptomycetes. Journal of Bacteriology, 151(2), 668–677. https://doi.org/10.1128/jb.151.2.668-677.1982.
Van Camp, P. J., Haslam, D. B., & Porollo, A. (2020). Prediction of antimicrobial resistance in Gram-negative bacteria from whole-genome sequencing data. Frontiers in microbiology, 11, 1013. https://doi.org/10.3389/fmicb.2020.01013.
Vestö, K., Huseby, D. L., Snygg, I., Wang, H., Hughes, D., et al. (2018). Muramyl endopeptidase Spr contributes to intrinsic vancomycin resistance in Salmonella enterica serovar Typhimurium. Frontiers in microbiology, 9, 2941. https://doi.org/10.3389/fmicb.2018.02941
World Health Organization. (2020). Central Asian and European surveillance of antimicrobial resistance: annual report 2020 (No. WHO/EURO: 2020-3469-43228-60585). World Health Organization. Regional Office for Europe.
Zhou, W., Wang, Y., & Lin, J. 2012. “Functional cloning and characterization of antibiotic resistance genes from the chicken gut microbiome”. Applied and environmental microbiology, 78(8), 3028–3032. https://doi.org/10.1128/AEM.06920-11.

Table 1. The sequences of primers and used and their intended purpose in the study, and Prom-RBS sequence

Primers	Sequence (5’ → 3’)	Aim in the study
P1	TATATATATATTGTCAACAGACCAAGTTTACTCATATATAC	Insertion of Prom-RBS
P2	CGGCTAGCATTATATATATATATATATTGTCAACAGACC
P3	AGCTGTACCTCCTTACGGCTAGCATTATATATATATA
pUCPR	GACAGTTACCAATGCTTAAT
prmtrSeq	GATCTCAAGAAGATCCTTTG
promHF	ATGCAAGCTTAGCTGTACCTCCTTACGGC	Functionality testing of inserted Prom-RBS
promER	ATGCGAATTCAGGGCGACACGGAAATGTTG
cat-HF	ATGCAAGCTTATGACTTTTAATATTATTG
cat-ER	ATGCGAATTCCTAAATCCAATCATCTAC
K-F	AGCTGTACCTCCTTACGGC	Test of K fragment as a vector for antibiotic resistance gene cloning
K-R	AGGGCGACACGGAAATGTTG
K-HF	ATGCAAGCTTAGCTGTACCTCCTTACGGC
K-HR	ATGCAAGCTTAGGGCGACACGGAAATGTTG
K-EF	ATGCGAATTCAGCTGTACCTCCTTACGGC
K-ER	ATGCGAATTCAGGGCGACACGGAAATGTTG
K-PF	ATGCCTGCAGAGCTGTACCTCCTTACGGC
K-PR	ATGCCTGCAGAGGGCGACACGGAAATGTTG
K-BF	ATGCGGATCCAGCTGTACCTCCTTACGGC
K-BR	ATGCGGATCCAGGGCGACACGGAAATGTTG
KseqF	CAACATTTCCGTGTCGCCCT	Sequencing of insert in K fragment
KseqR	GCCGTAAGGAGGTACAGCT	Sequencing of insert in K fragment
Prom-RBS	TTGACAATATATATATATATATATATAATGCTAGCTAAGGAGGTACAGCT

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

K fragment, a PCR-based vector for antibiotic resistance gene hunting

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Declarations

References

Tables

Additional Declarations

Status:

Version 1