Sample Selection
We selected representatives of major Lecanoraceae clades, according to Zhao et al., (2016). The fungal family Lecanoraceae comprises several hundred crustose species with mostly thin thalli and apothecia of ca. 1 mm diameter. A total of eighteen specimens from fourteen different species were analysed. In order to compare DNA amounts and concentrations obtained from standard CTAB extractions with our WGA protocol, we also included axenic thallus cultures of two different species (Table 1). Four specimens belonging to Parmeliaceae and Physciaceae, sister families to the Lecanoraceae, were also included in the analysis. Additionally, fourteen mitogenomes were obtained through the NCBI portal, encompassing taxa belonging to Lecanorales (Table 2) and compared with the newly obtained data.
Table 1
Summary of taxa used in this study, with voucher information, year of collection, DNA amounts, DNA concentration, mitogenome length, final assembly status, extraction method applied, raw read pairs count, GC content and Genbank codes. Specimens of Japewia tornoensis, Lecanora confusa and Miriquidica deusta could not be assembled. Culture samples of Lecanora horiza and Myriolecis hagenii were considered but we failed to obtain enough DNA to reach a minimum threshold required by the sequencing company. Concentration measurements on Physcia caesia, Pseudephebe pubescens, Usnea antarctica and U. aurantiacoatra were obtained through Qbit.
Taxon | Envelope code | Year of Collection | Total Amount (ng) | DNA Concentration Tapestation (ng/ul) | DNA Concentration Novogene (ng/ul) | Lenght (bp) | Assembly status | Method | Raw Read Pairs | GC% | Genbank Accession | BioSample Accession |
Lecanora bermudensis | FR-0264718 | 2017 | 3060 | 375 | 204 | | incomplete | SC-kit | 54272042 | 30,2 | Six scaffolds† | SAMN24582886 |
Lecanora cadubriae | FR-0279001 | 2018 | 1900 | 160 | 100 | 43271 | complete | JBD-Kit | 37099414 | 32,7 | ON101748 | SAMN24582887 |
Lecanora carpinea | FR-0264946 | 2016 | 461 | 38,2 | 57,6 | 35169 | incomplete | SC-Kit | 54808923 | 30,8 | ON101749 | SAMN24582888 |
Lecanora intumescens | FR-0279044 | 2016 | 134 | 4,16 | 8,96 | 35049 | complete | JBD-Kit | 50071587 | 30,6 | ON101750 | SAMN24582889 |
Lecanora polytropa | Hb. McCune 37633 | 2018 | 1796 | 99 | 99,8 | 40863 | incomplete | SC-Kit | 44905435 | 29,5 | ON101751 | SAMN24582890 |
Lecanora pseudargentata | Cultures 1 to 9; 16 & 17 | | 655 | 19,5 | 26,2 | 51996 | complete | CTAB | 32674536 | 30,3 | ON101752 | SAMN24582891 |
Lecanora rupicola | FR-0264951 | 2016 | 192 | 187 | 120 | 36421 | incomplete | SC-Kit | 47235845 | 30,7 | ON101753 | SAMN24582892 |
Lecanora subcarnea | FR-0279045 | 2016 | 194 | 16,6 | 12,9 | 20375 | incomplete | SC-Kit | 41632013 | 32,5 | ON101763 | SAMN24582893 |
Lecanora subintricata | Cultures 13 to 15 | | 629 | 19,3 | 26,2 | 53733 | complete | CTAB | 36072789 | 30,9 | ON101757 | SAMN24582894 |
Lecanora subintricata | Cultures 13 to 15 | | 2560 | 291 | 160 | 53739 | complete | JBD-Kit | 35586234 | 30,9 | ON101758 | SAMN24582895 |
Lecanora subintricata | FR-0261121 | 2017 | 4080 | 225 | 204 | 54304 | complete | JBD-Kit | 40384465 | 30,7 | ON101756 | SAMN24582896 |
Lecanora subintricata | FR-0261122 | 2017 | 1856 | 532 | 116 | 54056 | complete | SC-Kit | 32378642 | 30,8 | ON101754 | SAMN24582898 |
Lecanora subintricata | FR-0279002 | 2017 | 2052 | 511 | 114 | 52389 | incomplete | JBD-Kit | 44922601 | 30,9 | ON101755 | SAMN24582897 |
Lecanora subsaligna | FR-0279046 | 2018 | 1881 | 237 | 99 | 59221 | complete | JBD-Kit | 31415755 | 30,7 | ON101759 | SAMN24582899 |
Lecanora varia | FR-0261120 | 2017 | 937 | 45,1 | 55,1 | 32782 | complete | JBD-Kit | 36725268 | 29,7 | ON101760 | SAMN24582900 |
Lecidella elaeochroma | FR-0261123 | 2017 | 1029 | 64,2 | 68,2 | 32214 | incomplete | SC-Kit | 40483845 | 28,6 | ON101743 | SAMN24582901 |
Myriolecis dispersa | FR-0264963 | 2016 | 1908 | 75 | 106 | 36909 | incomplete | JBD-Kit | 41974611 | 29,7 | ON101744 | SAMN24582902 |
Physcia caesia | FR-0279004 | 2015 | 3650 | 36,7 | | 37905 | complete | CTAB | 6606423 | 28,3 | ON101745 | SAMN24582903 |
Protoparmeliopsis muralis | FR-0264962 | 2016 | 1734 | 109 | 102 | 62641 | complete | JBD-Kit | 37342254 | 29,5 | ON101746 | SAMN24582904 |
Pseudephebe pubescens | FR-0279003 | 2015 | 940 | 9,4 | | 83143 | complete | CTAB | 4116013 | 30,7 | ON101747 | SAMN24582905 |
Usnea antarctica | FR-0264581 | 2015 | 2940 | 29,4 | | 87363 | incomplete | CTAB | 1549379 | 40,2 | ON101761 | SAMN24582906 |
Usnea aurantiacoatra | FR-0264585 | 2015 | 1750 | 17,5 | | 80823 | complete | CTAB | 877941 | 40,3 | ON101762 | SAMN24582907 |
†.- L. bermudensis assembly resulted in disjointed 6 scaffolds. Each scaffold was submitted individually to GenBank, their accession codes being: scaffold 1 = ON118977; scaffold 2 = ON118978; scaffold 3 = ON118979; scaffold 4 = ON118980; scaffold 5 = ON118981; scaffold 6 = ON118982. |
Table 2
Summary of mitogenomes obtained through GenBank and compared with the mitogenomes obtained in this study.
Taxa | Genbank Accession | Size (nt) | GC% |
Alectoria fallacina | MG711470 | 75417 | 31,9 |
Bacidia sorediata | MK294991 | 35525 | 27,5 |
Cladonia macilenta | MK318967 | 46553 | 29 |
Cladonia petrophila | MG941021 | 53100 | 29,3 |
Cladonia rangiferina | KY460674 | 59116 | 29,6 |
Imshaugia aleurites | KY360311 | 32029 | 30,5 |
Lecanora cinereofusca | MH359410 | 32657 | 31,2 |
Lecanora saxigena | MH359409 | 56579 | 28,9 |
Lecanora strobilina | KU308740 | 39842 | 29,2 |
Parmotrema stuppeum | KY362439 | 108024 | 30,3 |
Parmotrema ultraluscens | MG807882 | 79456 | 30,5 |
Pseudevernia consocians | MG696867 | 76322 | 30,9 |
Ramalina intermedia | MK321681 | 30678 | 30,3 |
Usnea subgracilis | MG720066 | 94464 | 43,6 |
Culture isolation of Lecanora mycobionts
The isolation of the lichen mycobiont followed the protocol of Yamamoto et al., (2002) and it was carried out on single collections of Lecanora pseudargentata Lumbsch and L. subintricata (Nyl.) Th. Fr. Approximately 2 mm2 fragments of lichen thalli were dissected with a sterile razor blade and a few areoles and one apothecium were taken by slightly scratching the thalli from the substrate without including the latter. The fragments were washed three times for 15 minutes with sterile water, followed by a wash with 500 µl of Tween 80 diluted 1:10 for 30 minutes. A final washing step was performed by rinsing the thallus fragments three times for 15 minutes with sterile water. The clean fragments were ground in sterile water under laminar flow bench and tiny pieces of the fragmented thallus were picked individually with a sterile bamboo stick and transferred into agar tubes. Five different media were used to promote the growth of the mycobiont: Trebouxia medium (TM, Ahmadjian 1987), Lilly & Barnett (LB, Lilly & Barnett 1951), Sabouraud (SAB, Pagano et al., 1957–58), Potato Dextrose agar (PDA, ApplChem A5828), and Malt Yeast-extract (MY, Lilly and Barnett 1951). We inoculated two slant agar tubes of the same medium for each sample for a total of 10 inocula from each lichen individual. The tubes were incubated in a growing chamber under the following conditions: 17°C, 20 µmol fot*m − 2*s − 1, with a light/dark cycle of 14/10 h. After six to eight months, the inocula had reached a diameter of about 1–3 mm, and were taken for DNA extraction to check their identity by sequencing the ITS locus and for subcultures. Subcultures were then set on Petri plates using the same growth media in which the inocula were isolated successfully. Three subcultures were prepared for each strain and maintained alive.
DNA Extraction
Two methods were employed for obtaining DNA: CTAB extraction and WGA.
CTAB extraction was performed on thallus cultures of Lecanora pseudargentata and Lecanora subintricata. Cultured mycelia were collected for each plate in standard Eppendorf tubes. The CTAB protocol was modified after Doyle and Doyle 1987; Cullings 1992; and Fernández-Mazuecos et al., 2018 (complete protocol in Supplement 1). To obtain enough DNA for library preparation, multiple replicates of the CTAB extractions were carried out. Eleven replicates were made from cultures of Lecanora pseudargentata, and eight replicates from L. subintricata. The resulting eluates for each species were pooled into two tubes, one per species, and reduced by vacuum centrifugation to 50 µl of volume per tube (Table 1, DNA Concentrations).
Genomic DNA from Pseudephebe pubescens (L.) M. Choisy, Physcia caesia (Hoffm.) Fürnr., Usnea antarctica Du Rietz and U. aurantiacoatra (Jacq.) Bory was extracted from 20 mg of thalli, pre-treated in acetone for 30 seconds, deep frozen in liquid nitrogen and homogenized with sterile mortar and pestle. A modified CTAB extraction (Cubero et al, 1999, Cubero & Crespo, 2002, Lagostina et al., 2017) was applied.
Whole Genome Amplification
For the WGA, horizontal cross sections of apothecia of selected specimens (Table 1) were prepared using a HYRAX KS 34 cryotome (Zeiss, Jena, Germany). The first 20 µm of the upper portion of the hymenium were discarded as a measure to discard potential hyphae of non-target parasitic fungi present. The three subsequent slices of 20 µm were stored in PCR tubes in sterile distilled water. Two different WGA kits were used: the Qiagen Repli-G Single-Cell Kit (Qiagen GmbH, Düsseldorf) (“SC-kit”), and Jena Bioscience Direct (Jena Bioscience GmbH, Jena) WGA kit (“JBD-kit”). Both kits perform PCR using random oligosequences as primers and using Phi–29 polymerase. Amplification procedure followed manufacturers protocols, with the following modification: Amplification lasted for a minimum of 16 hours at 30°C in the heating block.
DNA concentrations and quality were assessed using a TapeStation 2200 System (Agilent, Santa Cruz, USA) at the “Zentrum für translationale Biodiversitätsgenomik” (LOEWE-TBG) and by Novogene (HK) Co., Ltd.
Sequencing
Illumina paired-end libraries were generated using the NEBNext® DNA Library Prep Kit following the manufacturer's recommendations and indices were added to each sample. The genomic DNA was randomly fragmented to a size of 350 bp. Whole-genome sequencing was performed with Illumina HiSeq, and 10 GB of raw data was obtained per sample; paired-end reads were 150 bp long. Library preparation and sequencing were carried out by Novogene (HK) Co., Ltd.
For Physcia caesia, Pseudephebe pubescens, Usnea antarctica and U. aurantiacoatra, whole genome sequencing was carried out as previously described (Lagostina et al., 2017), on Illumina MiSeq v3 by LGC Genomics GmbH (Berlin, Germany) resulting in 300 bp paired-end reads.
Data treatment
Mitogenomes of 22 samples were assembled de novo using the pipeline GetOrganelle v1.7.1 (Jin et al., 2020) using 30 cycles, 21, 45, 65, 85, and 105 kmer values and “fungus_mt” as a reference genome database. The pipeline filters organelle-associated reads using a baiting and iterative mapping approach, conducts de novo assembly, disentangles the assembly graph, and finally produces all possible configurations of circular organelle genomes (Jin et al., 2020). It starts with the recruitment of initial target-associated reads by using Bowtie2 (Langmead & Salzberg 2012) and, taking target genome as the seed, the initial target-associated reads (seed-mapped reads) are treated as “baits” to get more target-associated reads through multiple extension iterations. Then, the total target-associated reads are de novo assembled into a FASTA assembly Graph (FASTG) file using SPAdes (Bankevich et al., 2012). The FASTG file is subsequently used to calculate all possible paths of the complete target organelle genome based on the graph characteristics and the coverages of the contigs. The results of the assemblies were visualized with Bandage v0.8.1 (Wick et al., 2015). Successfully de novo assembled mitogenomes were annotated with GeSeq (Tillich et al., 2017) and tRNAscan-SE v2.0.7 (Lowe & Eddy, 1997) using published Lecanora (GenBank NC_042184.1, NC_042183.1, NC_030051.1) and Usnea (NC_035940.1, NC_039633.1) mitogenomes as a reference. The mitogenomes were visualized using OGDRAW (Greiner et al., 2019) and manually curated in Geneious Prime 2019.2.1 (https://www.geneious.com).
Primer development
Coding regions of the annotated and assembled mitogenomes were extracted and aligned to each other. Eight pairs of primers, two per region were developed from atp6, cob, cox3, and nad1. These primers were tested on DNA extractions of 23 specimens from 20 different species of Lecanora sensu lato. PCR conditions were explored and optimized for each primer pair. After tests, the four optimal pairs of mitochondrial primers were used for amplifying parts of the regions atp6, cob, cox3 and nad1 for various Lecanoraceae (Table 3). Sanger sequencing was performed by Macrogen Europe B.V. (Amsterdam, the Netherlands). Alignment and primer development was performed in Geneious Prime.
Table 3
Mitochondrial primers pairs developed for Lecanoraceae after our resulting mitogenomes.
Name | Length | Direction | Sequence (5´ -> 3´) | GC% | Hairpin Tm | Self Dimer Tm | Tm |
atp6F2 | 23 | forward | ACTAACATAGGACTTTACTTAAC | 30.4 | None | None | 51.4 |
atp6R2 | 24 | reverse | ACCTGAAAATGCTATAATAAAAGC | 29.2 | 39.3 | None | 54.0 |
cobF2 | 22 | forward | AGTCATCCTTTGCTAAAATTGG | 36.4 | None | None | 55.0 |
cobR2 | 20 | reverse | TGTTCTAGGAGCTTTATATG | 35.0 | None | None | 49.3 |
cox3F2 | 18 | forward | CAGGTGTTTTAACAATGC | 38.9 | 41.2 | None | 49.6 |
cox3R2 | 22 | reverse | TAAAAACAAGAACCATATGTAC | 27.3 | None | 1.2 | 50.2 |
nad1F1 | 19 | forward | TGCAAAGAAGATTAGGTCC | 42.1 | None | None | 52.2 |
nad1R1 | 20 | reverse | CAAATAAGAACAATGCTAGC | 35.0 | None | 8.1 | 50.5 |
Results comparison
For the mitogenomes obtained from CTAB extractions and WGA products, DNA amounts and concentrations of the respective eluates/amplification products, were related to assembly completeness, GC% content, assembly sizes and coding region position.
We assessed the amplification accuracy of the kits by analysing genetic distances between samples of the same species (using different extraction/amplification protocols). Pairwise distances were measured among mitogenomes of Lecanora subintricata extracted and amplified with the different protocols to assess possible amplification errors by the kits. Pairwise distance together with GC% content, assembly and coding region lengths and position for all the mitogenomes were calculated and visualized in Geneious Prime.
Also, comparison of the consistency of a phylogenetic reconstruction based on loci recovered from the resulting mitogenomes versus already published data was performed.
Phylogenetic reconstruction
A maximum likelihood (ML) phylogenetic tree based on four mitochondrial loci from the mitogenomes was constructed to compare the placement of the analyzed taxa with published phylogenies of Lecanorales, and assess statistical branch support values for a combined analyses based on these four loci.
Consensus sequences of the coding regions of the loci atp6, cob, cox3 and nad1 were first aligned through GUIDANCE2 (Landan & Graur 2008; Penn et al., 2010; Sela et al., 2015), removing unreliably aligned positions with a score below 0.999.
The ML tree was constructed with W-IQ-Tree (Trifinopoulos et al., 2016) by using the default settings of an ultrafast bootstrap analysis, 1000 bootstrap repetitions, and automatic substitution model selection. A custom partition was elaborated considering third-codon positions. We eliminated ambiguously aligned columns, and an intron of 275 bp at the cox3 locus in Usnea aurantiacoatra as well as 5 intronic regions within nad1 present in only 1 to 9 species from total the alignment. Selected substitution models are summarized on Table 4. Physcia caesia (Physciaceae), Ramalina intermedia (Delise ex Nyl.) Nyl. and Bacidia sorediata Lendemer & R.C. Harris (Ramalinaceae) were chosen as outgroup.
Table 4
IQTree substitution models selected for each third-position codon per locus.
| atp6 | cob | cox3 | nad1 |
Codon pos. 1 | TPM3 + F + G4 | TIM2 + F + I + G4 | K3P + I + G4 | GTR + F + I + G4 |
Codon pos. 2 | TVM + F + R2 | K3Pu + F + I + G4 | TVM + F + R3 | HKY + F + I + G4 |
Codon pos. 3 | TIM3 + F + I + G4 | TIM2 + F + I + G4 | TIM2 + F + I + G4 | TPM3u + F + R3 |
The resulting tree was visualized in TreeGraph 2.0 (Stöver & Müller 2010) and graphically enhanced in Biorender (BioRender.com). All other figures were created with BioRender.com.
WGA yields
Both WGA commercial kits yielded high DNA concentrations, enough for whole genome sequencing purposes (Table 1). DNA amount ranged between 134 and 4080 ng, with a mean value of 1568 ng. DNA concentrations varied between 9 ng/µl to 204 ng/µl, with a mean value of 102 ng/µl.
The mean DNA amounts obtained with the SC-kit were slightly lower than those obtained with the JBD-kit (1227 vs. 1910 ng, respectively, corresponding to DNA concentrations of 97 and 105 ng/µl). The CTAB extractions from cultures yielded on average 642 ng DNA (26 ng/µl) each (Table 5).
Table 5
Average values of DNA amounts, concentration, read pairs, and GC content resulting from the genomes obtained from the different methods analyzed.
Method | DNA Amounts (ng) | DNA Concentration Tapestation (ng/ul) | DNA Concentration Novogene (ng/ul) | Raw Read Pairs | GC% |
CTAB | 642 | 21,97 | 26,20 | 13649513,50 | 33,45 |
JBD-Kit | 1909,56 | 184,14 | 105,45 | 39502465,44 | 30,58 |
SC-Kit | 1226,86 | 187,43 | 96,93 | 45102392,14 | 30,56 |
Sequencing
Sequencing and high-quality data selection of the specimens sequenced on Illumina MiSeq yielded between 877,841 (Usnea aurantiacoatra) to 6,606,423 reads (Physcia caesia).
The specimens sequenced on Illumina HiSeq yielded between 31,415,755 (Lecanora subsaligna M. Brand & van den Boom) and 54,808,923 (L. carpinea (L.) Vain.) reads. On average, the number of reads generated after amplification with the JBD-kit was slightly lower than that generated with the SC-kit (39,502,462 vs. 45,102,392 reads, Table 5). The mean number of reads generated from CTAB extractions was 13,649,514.
Mitochondrial genomes
A total of 18 mitochondrial genomes were assembled for Lecanoraceae, ten of which were fully assembled and eight only partially assembled. The fully assembled mitochondrial genomes ranged between 32,782 bp in Lecanora varia (Hoffm.) Ach. and 62,647 bp in Protoparmeliopsis muralis (Schreb.) M. Choisy. GC content ranged between 28.6% in Lecidella elaeochroma (Ach.) M. Choisy and 32.7% in Lecanora cadubriae (A. Massal.) Hedl. In comparison, the mitogenome sizes of the specimens belonging to the sister families Cladoniaceae, Parmeliaceae and Ramalinaceae ranged between 30,678 bp in Ramalina intermedia and 108,024 bp in Parmotrema stuppeum (Taylor) Hal). GC content within these families ranged between 27,5% in Bacidia sorediata and 43.6% in Usnea subgracilis Vain.
Fifteen coding regions were detected atp6, atp8, atp9, cob, cox1, cox2, cox3, nad1, nad2, nad3, nad4, nad4L, nad5, nad6 and rps3, plus two mitochondrial ribosome regions (LSU and SSU). However, atp9 was only present in species of Cladoniaceae, Parmeliaceae and Ramalinaceae, but not in the mitogenomes of Lecanoraceae. Several of the aforementioned regions were missing in the incompletely assembled mitogenomes. With regards to tRNA genes, between 26 and 31 genes were detected in the completely assembled mitogenomes of Lecanoraceae, with sizes ranging between 31 to 86 bp (Table 6).
Table 6
Summary of mitochondrial coding regions, mitochondrial ribosomal DNA, tRNAs and their sizes per taxon. abs = absent; fr-=fragmented.
Taxa/Locus | atp6 | atp8 | atp9 | cob | cox1 | cox2 | cox3 | nad1 | nad2 | nad3 | nad4 | nad4L | nad5 | nad6 | rps3 | LSU | SSU | Nª of tRNAs | Size |
Alectoria fallacina | 579 | 147 | 285 | 1158 | 1464 | 750 | 714 | 1095 | abs | abs | 1482 | 270 | 2082 | abs | 1374 | 1826 | 1565 | 29 | 71–86 |
Bacidia sorediata | 666 | 153 | 225 | 1158 | 1527 | 753 | 810 | 969 | 1704 | 426 | 1473 | 261 | 1968 | 690 | 1287 | 2386 | 1501 | 26 | 70–85 |
Cladonia macilenta | 789 | 147 | 225 | 1152 | 1665 | 831 | 810 | 1089 | 1812 | 390 | 1419 | 273 | 1971 | 693 | 1320 | 3580 | 1577 | 19 | 71–86 |
Cladonia petrophila | 792 | 147 | 225 | 1128 | 1644 | 726 | 810 | 1086 | 1797 | 390 | 1464 | 270 | 2019 | 693 | 1893 | 3215 | 1565 | 25 | 71–86 |
Cladonia rangiferina | 789 | 147 | 225 | 1155 | 5421 (fr) | 843 | 810 | 1155 | 1557 | 390 | 1686 | 270 | 2031 | 768 | 1902 | 1847 | 1581 | 23 | 70–86 |
Imshaugia aleurites | 441 | 147 | abs | 2172 | 1716 | 747 | 810 | 1089 | 1707 | 384 | 1524 | 270 | 1995 | 648 | 1194 | 2512 | 1595 | 22 | 67–86 |
Lecanora bermudensis | abs | 147 | abs | 1714 | 1026 | 1441 | abs | abs | 1691 | 468 | 1621 | 270 | 1946 | abs | 930 | 799 | 1602 | 6 | 66–103 |
Lecanora cadubriae | 780 | 147 | abs | 1149 | 1575 | 936 | 810 | 1104 | 1713 | 366 | 1194 | 270 | 2013 | 666 | 1353 | 1923 | 1318 | 27 | 71–86 |
Lecanora carpinea | 441 | 147 | abs | 1152 | 1752 | 723 | 810 | 1146 | 1701 | 528 | 1407 | 270 | 1959 | 636 | 1314 | 1827 | 834 | 29 | 65–103 |
Lecanora cinereofusca | 792 | 147 | abs | 1224 | 1647 | 726 | 810 | 1113 | 1707 | 363 | 1482 | 270 | 1959 | 636 | 1221 | 2835 | 1662 | 25 | 70–86 |
Lecanora intumescens | 780 | 147 | abs | 1149 | 1620 | 696 | 810 | 1089 | 1713 | 420 | 1353 | 270 | 1956 | 636 | 1416 | 851 | 1450 | 28 | 68–86 |
Lecanora polytropa | 780 | 147 | abs | 1152 | 1602 | 729 | 810 | 1089 | 1845 | 417 | 1419 | 270 | 2127 | 636 | 1401 | 550 | 1484 | 27 | 70–86 |
Lecanora pseudargentata | 780 | 147 | abs | 1233 | 1731 | 684 | 810 | 1182 | 171 | 372 | 1533 | 270 | 2043 | 636 | 1419 | 1782 | 643 | 28 | 70–86 |
Lecanora rupicola | 441 | 147 | abs | 1335 | 1602 | 693 | 810 | 1146 | 1701 | 369 | 1389 | 270 | 1959 | 636 | 1188 | 383 | 817 | 15 | 41–103 |
Lecanora saxigena | 774 | 147 | abs | 1155 | 1590 | 726 | 810 | 1110 | 1710 | 426 | 1476 | 270 | 1968 | 612 | 1317 | 3121 (fr) | 1532 | 25 | 71–86 |
Lecanora strobilina | 441 | 147 | abs | 2262 | 1737 | 726 | 810 | 1272 | 1713 | 1104 | 1116 | abs | 1959 | 600 | 1089 | 2840 | 1511 | 18 | 71–95 |
Lecanora subcarnea | 420 | 147 | abs | 936 | 1029 | 558 | 690 | 864 | 996 | 480 | 1197 | 288 | 1701 | 408 | 759 | 531 | 285 | 9 | 63–82 |
Lecanora subintricata | 780 | 147 | abs | 1239 | 1608 | 1014 | 1173 (fr) | 1104 | 2124 (fr) | 360 | 1497 | 270 | 1965 | 642 | 1053 | 1783 (fr) | 1524 | 28 | 70–86 |
Lecanora subsaligna | 441 | 147 | abs | 1086 | 1569 | 1110 | 810 | 1095 | 1704 | 360 | 2367 | 414 (fr) | 2019 | 639‡ | 912 | 691 | 2040 (fr)§ | 31 | 70–86 |
Lecanora varia | 780 | 147 | abs | 1149 | 1749 (fr) | 792 | 810 | 1131 | 1719 | 447 | 1353 | 270 | 1995 | 666 | 1497 | 835 | 1369 | 26 | 70–86 |
Lecidella elaeochroma | 780 | 147 | abs | 1359 | 1920 | 1005 (fr) | 810 | 1212 | 1701 | 402 | 1440 | 270 | 1968 | 633 | 1389 | 650 (fr) | 1412 | 30 | 70–214 |
Myriolecis dispersa | 780 | 147 | abs | 1380 | 1683 | 864 | 810 | 1134 | 1758 | 417 | 1419 | 270 | 2127 | 636 | 1389 | 550 | 1497 | 28 | 63–86 |
Parmotrema stuppeum | 444/441† | 147 | abs | 1098 | 1713 | 726 | 816 | 999 | 1695 | 409 | 1579 | 270 | 1994 | 657 | 1374 | 3140 | 1598 | 25 | 71–86 |
Parmotrema ultraluscens | 756 | 147 | abs | 1173 | 1623 | 726 | 807 | 1149 | 1695 | 420 | 1491 | 270 | 2019 | 657 | 1380 | 3241 | 1590 | 26 | 67–86 |
Physcia caesia | 441 | 147 | abs | 1161 | 1641 | 780 | 1113 | 1230 | 1698 | 393 | 1476 | 270 | 1968 | 651 | 1317 | 1735 (fr) | 1633 | 28 | 71–86 |
Protoparmeliopsis muralis | 780 | 147 | abs | 1152 | 1584 | 744 | 810 | 1089 | 1701 | 408 | 1419 | 270 | 2331 | 636 | 897 | 2061 | 1501 | 29 | 58–86 |
Pseudephebe pubescens | 249 | 234 (fr) | abs | 1074 | 183 | 705 | 807 | 1164 | 1695 | 381 | 2121 (fr) | 270 | 1974 | 657 | 1404 | 3216 | 1519 | 28 | 42–89 |
Pseudevernia consocians | 930 | 147 | abs | 1164 | 1590 | 780 | 774 | 1086 | 1770 | 390 | 1539 | 294 | 1914 | 645 | 1080 | 3124 | 1586 | 25 | 71–86 |
Ramalina intermedia | 765 | 150 | 225 | 1149 | 1605 | 741 | 810 | 999 | 1701 | 411 | 1479 | 270 | 1965 | 651 | 1203 | 2563 | 1468 | 25 | 70–86 |
Rhizoplaca shushanii | 764 | 147 | abs | 1128 (fr) | 797 (fr) | 724 | 810 | abs | 1650 | 354 | 1524 | 270 | 1955 | 636 | abs | 1009 (fr) | 647 (fr) | 30 | 31–86 |
Usnea antarctica | 441 | 147 | abs | 1050 | 2871 | 927 | 1077 | 903 | 1761 | 363 | 1485 | 270 | 2277 | 660 | 609 | 766 | 2734 | 27 | 58–86 |
Usnea aurantiacoatra | 441 | 147 | abs | 1422 | 2541 | 960 | 1071 | 990 | 1767 | 363 | 1485 | 270 | 2259 | 660 | 609 | 350 | 917 | 27 | 47–86 |
Usnea subgracilis | 756 | 147 | abs | 1209 | 1608 | 723 | 858 | 1098 | 1764 | 393 | 1533 | 270 | 1905 | 675 | 1185 | 3780 | 1579 | 26 | 71–86 |
†.- Two almost identical copies |
‡.- Two copies |
§.- A 559 nt-long SSU short copy was identified |
CDS position structure among Lecanorales
Lecanoraceae showed a relatively constant coding-region order: cox1-nad4-rps3-cob-cox2-nad1-atp6-atp8-SSU-nad6-cox3-LSU-nad2-nad3-nad4L-nad5. However, exceptions to this order were found, such as the shift of the position of nad4 between atp6 and atp8 in L. pseudargentata, the presence of a fragment of the cox3 gene between cox1 and nad4 in L. subintricata; and the position of atp6 and atp8 between nad6 and cox3 in L. subsaligna. The Genbank sequences of L. saxigena Lendemer & R.C. Harris and L. strobilina (Spreng.) Kieff., showed however, a different order of genes (Fig. 3). The sequence of L. cinereofusca H. Magn. showed loci order consistent with the rest of the Lecanoraceae mitogenomes, with exception of the presence of an SSU fragment between nad5 and cox1. The three specimens of Cladonia showed the same order with no changes among each other, as that of the Lecanoraceae, with two changes: nad1 is placed between cox1 and nad4, and the presence of the gene atp9. The gene atp9 was also detected in Alectoria fallacina Motyka, Ramalina intermedia, and Bacidia sorediata belonging to Parmeliaceae and Ramalinaceae respectively. Species of Parmeliaceae, differed strongly in gene order. The specimens belonging to Ramalinaceae showed a partially conserved order. Only the genes cox3, nad4L and nad5 occupied different positions within the mitogenomes of Bacidia sorediata and Ramalina intermedia.
Lecanora subintricata alignment and distance values
Five mitogenomes of L. subintricata were aligned to each other and pairwise distance values were measured to assess possible amplification errors of the kits, resulting in an alignment of 54635 bp length. The mitogenome obtained from CTAB-extraction and the one amplified from the JBD-kit showed were identical. The mitogenome obtained from the SC-kit showed a distance of 552 bp to the CTAB mitogenome. The mitogenomes obtained from the vouchers FR-0279002 and FR-0261122 have a distance of 518 bp and 552 bp respectively. The mitogenome with the largest distance values of 937 bp to the CTAB mitogenome was that of voucher FR-0261121. Overall, only 45 SNPs were detected between different vouchers, whereas the rest of the dissimilarities are due to tandem-repeats, insertions/inversions or both. Absolute distance values within the mitogenomes of L. subintricata are summarized in Table 7.
Table 7
Genetic distance values of the aligned mitogenomes of Lecanora subintricata. Blue = specimen amplified with the SC-kit; green = specimens amplified with the JBD-kit
L. subintricata Accession Codes | ON101757 | ON101758 | ON101754 | ON101755 | ON101756 |
ON101757 | | 0 | 552 | 518 | 937 |
ON101758 | | | 552 | 518 | 937 |
ON101754 | | | | 500 | 547 |
ON101755 | | | | | 413 |
ON101756 | | | | | |
Phylogenetic analysis
The phylogenetic analysis was performed on a concatenated four-loci alignment of the four gene regions for which we developed primers. It comprises 33 specimens and has a length of 2843 characters (401 for atp6, 936 for cob, 686 for cox3 and 820 for nad1) with 1399 conserved sites, 1194 parsimony informative, and 250 non-informative sites. Figure 3 shows the topology of the ML phylogenetic tree based on the above-mentioned alignment. Most of the nodes receive high bootstrap support, save for three nodes in the backbone, one node in the Lecanoraceae clade and two nodes in the Parmeliaceae clade, The tree showed four distinct clades consistent with published data on Lecanorales (Zhao et al, 2016). The phylogenetic relationships among the families appear unsupported. However, each family clade shows to be monophyletic with high support value. Not so surprisingly, Lecanora cadubriae appeared sister to the Cladoniaceae clade with high support.