Induced anti-predation defense traits of Daphnia are associated with the gut microbiota composition

doi:10.21203/rs.3.rs-1732132/v1

Download PDF

Research Article

Induced anti-predation defense traits of Daphnia are associated with the gut microbiota composition

https://doi.org/10.21203/rs.3.rs-1732132/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

A growing number of studies on gnotobiotic animals have shown that the gut microbiota can promote host health by influencing life history traits. However, it is not clear whether the performance of host defense traits is related to the gut microbiota. In this study, we used Daphnia magna as a model organism to investigate the relationship between D. magna life history anti-predation defense traits and gut microbiota alterations under fish kairomone. Results showed that the Shannon diversity of D. magna gut microbiota under fish kairomone reduced significantly with the developmental stages. By analyzing the correlation between the induced anti-predation defense traits of D. magna and the relative abundance of bacteria, we found that the abundances of Comamonadaceae, Moraxellaceae, and Flavobacteriaceae were linearly correlated with the partial anti-predation defense traits of D. magna. Furthermore, the functional categories analysis showed that fish kairomone influenced the metabolic repertoire of D. magna gut microbiota. Our results highlighted that predation risk can simultaneously induce anti-predation defense and reshape gut microbiota composition of D. magna, and there was a complex correlation between the induced defensive traits and altered-microbiota. Such results revealed an important role of gut microbiota in the development of defensive traits of Daphnia.

Daphnia magna

gut microbiota

host-microbiota interaction

inducible defense

life-history traits

predation risk

Gut microbiota is a diverse community of symbiotic microorganisms living in the digestive tract of animals, and it plays a vital role in the physiology and behavior of host [1–3]. Some studies have shown that gut microbiota also contribute to host health by influencing life-history traits of the host. For example, the gut bacteria of arthropods have a preponderant impact on the growth, development, reproduction, and survival of the host. In the water flea Daphnia magna [4, 5] and the fruit fly Drosophila melanogaster [6], the growth rate and body size of axenic individuals are slower and smaller than those of conventional animals, while in mosquitoes, germ-free larvae fail to develop beyond the first instar [7]. A normal development rate in all these species can be restored by inoculating axenic larvae with gut bacteria [5–7]. As a result, the gut microbiota is increasingly regarded as a critical driver of health.

The microbiome is highly plastic and can rapidly respond to changes in host diet or environmental conditions through altering community composition, mutating, exchanging genetic material with bacteria from the environment, or regulating gene expression [8–11], thereby in turn influencing the host physiology and life history [12–14]. The quality and quantity of diet in the host environment are important aspects to affect gut microbiota [5, 15]. Akbar et al. [16] discovered that gut microbiota composition of D. magna is significantly different under different food conditions, and the abundance of Pseudomonadaceae in the gut microbiota of D. magna decreases significantly under lower food quality. Callens et al. [5] found that when food is sufficient, the microbiota has a strong positive effect on the growth and reproduction of Daphnia, while in the case of limited food, the microbiota has a weak effect on the growth and reproduction of host. In addition to changes in food quality and quantity, in nature, predation is also an important factor in the food chain. The increase or decrease of predator will change the density of prey and indirectly affect the availability of food resources for the prey [17–20]. Besides, kairomone released by predators enter organisms via contact or ingestion, affecting activities of prey and inducing prey morphological changes that could reduce the risk of being predated subsequently [21–23]. Recently, Sadeq et al. [24] exposed Daphnia pulex to two stressors, copper and predation risk, in a factorial experiment, and found D. pulex under each stressor or their combination have clear and unique patterns of microbiome community composition. Zha et al. [15] studied the response of the overall gut microbiota composition of Perca fluviatilis to food ration and the presence of predator, and suggested that Fusobacteria is beneficial to the host under stressful situations. Moreover, the physiological status of prey can also be influenced by predation stress. For example, the immunological and behavioral responses of vertebrates can be regulated by hormones released by stress [25]. The nerve and immune systems have been shown to play essential roles in regulating gut microbiota communities [26, 27]. Predation risk may thus affect the diversity and composition of the host gut microbiome, which is critical for the fitness of individuals.

In addition, gut microbiota is also affected by developmental stages [28, 29]. For example, few or no bacteria were found in the guts of newly emerged adult mosquitoes [30]. The microbial community shifts between early- and late-instar larvae of Bombyx mori are apparent, which is consistent with host developmental changes [31]. The diversity and composition of microbial community in amphibian gut differ between tadpoles and adults [32]. Further, studies have shown that the gut microbiota are initially assembled through neutral or stochastic processes, and become more fixed and stable in the later stage of host development, indicating that the importance of selective forces shaping the gut microbiome increases with the progress of animal development [33–35]. Microbes will be selectively recruited through interactions with the host and the already established microbiota [36], and then gradually create a stable microbiome that is adapted to the environment.

Predator plays a crucial ecological role in ecosystem, and the relationship between predator and prey has been extensively studied [37, 38]. Diversity and composition of the gut microbiome have also been widely shown to contribute to host ecological adaptation [8, 39]. Although the latest study has shown that the host-microbial composition varies under different stressors, including predation stress [24]. However, under predation risk, does and how does the gut microbiota of host change with developmental stage during the defense process? Is this change related to the formation of host defensive traits? No study has reported on these interesting scientific issues until now. The freshwater crustacean D. magna provide an opportunity for such studies, as they have high experimental traceability, short life cycle, strong clone reproduction, rapid response ability to environmental stress, and typical induced defense responses to predation risk. Previous studies have shown that D. magna can respond to infochemicals released by their predators and exhibit different types of defense, e.g., alterations in morphologies [40, 41], adjustment in life-history strategy [42]. Thus, in this study, we used D. magna as the model organism to investigate the effects of the presence of fish predation risk on the gut microbiota composition of D. magna at different instars. We hypothesized that: (1) Kairomone released by fish predator alters the relative abundance of the D. magna gut microbiota; (2) The development stage of D. magna can interact with fish kairomone to affect the diversity of the gut microbiota; (3) Changes in D. magna defense traits are related to the composition of D. magna gut microbiota community under the influence of fish kairomone. To test these hypotheses, we placed D. magna in the medium with or without fish kairomone, and recorded key life history traits as well as the composition of the gut microbiota community of D. magna at different instars.

Experimental organisms and cultivation

Laboratory-cultured clone of D. magna that have been maintaining in laboratory under standard conditions for more than ten years were used in our experiments (Fig. S1). Stock Daphnia clonal lineage was cultured in COMBO medium (the medium refreshed four times a week) at a temperature of 25 ℃ under fluorescent light at 50 μmol photons m^-2 s^-1 with a 14 : 10 h light : dark cycle. They were fed daily with high-quality food green alga Scenedesmus obliquus (1.5 mg C L⁻¹), which was harvested from that cultured in 1 L of BG-11 medium in Erlenmeyer ﬂasks under the same conditions.

Kairomone production

To obtain fish kairomone, 14 small-sized Rhodeus ocellatus (3-5 cm in body length) were cultured in COMBO medium and fed with about 5000 D. magna. After 6 h, the fishes were transferred into 7 L medium to release kairomone for 18 h without any other food supply [43]. In order to prevent bacterial degradation, the kairomone medium was filtered through a 0.22 μm glass ﬁber ﬁlter (Millipore, USA), and then stored at -20 °C until further usage.

Experimental design

Before the experiment, animal reproduction was synchronized by maintaining individuals of the same age for at least two generations under identical conditions. To exclude the maternal effects and minimize the differences between experimental animals [44], we used the third brood neonates born within 24 h for the formal experiments.

We set up the experiments in the absence (control) and presence (treatment) of fish kairomone. The stocked fish kairomone was diluted 20 times in the COMBO medium to produce the target concentration (one fish per 10 L), as detailedly described in Huang et al. [45]. Each treatment or control contained 250 replicates, and each replicate containing one individual was cultured in 50 mL of the COMBO medium with the green alga S. obliquus as food (1.5 mg C L⁻¹). The experiment was run for 21 days, and the instar of D. magna was recorded for 21 days. The neonates released by maternal D. magna were removed after counted, and only the mothers were retained for subsequent microbial analysis.

Some of the first instar D. magna (the newborn ones) and the fourth instar D. magna were respectively divided into three samples (each with 15 individuals) for the analysis of microbiota in the whole Daphnia, while some of the sixth, ninth, and twelfth instar D. magna were respectively divided into three samples each containing 5 individuals for this analysis. After removing the Daphnia individuals, the remaining culture medium was filtered by 0.22 μm glass ﬁber ﬁlter (Millipore, USA) for the analysis of microbiota in the culture medium [46]. The microbiota was also analyzed in triplicate. Furthermore, at the sixth, ninth and twelfth instar, 20-25 individuals of D. magna were collected and dissected, and their guts were pooled for one replicate for gut microbial analysis, according to the method of Akbar et al. [47]. It is worth noting that the gut microbiota analysis was conducted in duplicate, as it was quite difficult to dissect the gut of D. magna, and thus there was not enough guts for microbiota analysis if we analyzed them in triplicate. In addition, ten D. magna which were cultured at the same time as the D. magna for microbial analysis under exactly the same culture conditions were used for recording the life history traits (i.e., body size, spine length, time to maturation, number of broods, and total offspring number per female) every instar in absence and presence of fish kairomone, and the released neonates were removed after counted.

DNA extraction and PCR amplification

Microbial DNA was extracted using the HiPure Soil DNA Kits (Magen, Guangzhou, China) according to the manufacturer’s protocols. The full-length 16S rRNA gene was amplified by PCR using primers 27F: AGAGTTTGATCCTGGCTCAG, 1492R: GNTACCTTGTTACGACTT. More details were archived in the Supplementary Information. The raw reads were deposited into the NCBI Sequence Read Archive database.

Statistical analysis

The impact of different treatments (presence or absence of fish kairomone) on D. magna body size and spine length / body size changing with days were assessed using the parameters of the response-functions. Specifically, we used two predictive functions to fit the data. An exponential rise to an asymptote function, y = J_max (1-e^-pt), was used to fit the relationships between D. magna body size and growth days at presence or absence of fish kairomone, where y is body size of D. magna at time t, J_max is the predicted asymptotes of the exponential rise functions (maximum value) when t approaches infinity, and p describes the initial rate of change in the response [45]. An exponential decline to an asymptote function, y = L_{min +}αe^-rt, was used to fit the relationships between spine length / body size of D. magna and growth days at presence or absence of fish kairomone, where y is spine length / body size of D. magna at time t, L_min is the predicted asymptotes of the exponential decline functions (minimum value) when t approaches infinity, and r describes the initial rate of change in the response [48]. The spine length of D. magna showed a trend of increasing first and then declining, a three-parameter Gaussian model: was used to fit the spine length of D. magna, where y represents the spine length of D. magna at time t, K represents the theoretical maximum spine length, t_k represents the time needed to reach the theoretical maximum spine length, and q represents the shape of the curve [49, 50].

The interactive effect of growth days and fish kairomone on the body size, spine length, and spine length / body size of D. magna were assessed using two-way ANOVA (α = 0.05). The effect of presence or absence of fish kairomone on time to maturation, body size at maturation, total offspring number, brood number, and average offspring per brood of D. magna were assessed using one-way ANOVA (α = 0.05). Tukey's HSD was used to determine the post hoc analysis between various treatments and multiple comparisons (α = 0.05). All statistical analyses were performed using Sigmaplot 14.0, while all data were expressed as the mean values ± SE.

In order to assess the differences in the abundances of dominant bacterial between different growth days at presence or absence of fish kairomone, we used the analysis of variance (ANOVA) with post-hoc Tukey’s test, which is a common method used to test a hypothesis concerning more than two groups. To observe the overall diversity of microbiota, we used Phyloseq to calculate nonmetric multidimensional scaling (NMDS) with Bray-Curtis (Vegan 2.3-5) and weighted and unweighted UniFrac distances, which is a commonly used dimensionality reduction analysis based on distance sorting. The phylogenetic tree was constructed using MEGA 7.0’s UPGMA method and checked with the neighbour-joining method. We also analyzed the Spearman’s correlation between bacterial abundance in treatment and life history traits by using the bivariate analysis in Sigmaplot 14.0. The significant effect of bacterial abundance on a given life-history trait depends on whether the slope is significantly different from zero (α = 0.05), according to the methods outlined in Akbar et al. [16]. Other bioinformatic analysis was performed using Omicsmart, a real-time interactive online platform for data analysis ( http://www.omicsmart.com).

Body size, spine length, and reproduction traits

The time to maturation, body size at maturation, total offspring number, and brood number of D. magna were significantly affected by fish kairomone (Fig. 1, Table S1). The body size, spine length, and spine length / body size of D. magna were also significantly affected by fish kairomone, and there was significant interaction between kairomone and growth days on these morphological parameters (Table S2). Compared with those not exposed to fish kairomone, the maturation time of D. magna exposed to kairomone was significantly earlier, and the body size at maturity was significantly reduced (Fig. 1, Table S1). Total offspring number and brood number of D. magna exposed to fish kairomone were significantly increased, however, there was no significant difference in the average offspring per brood in D. magna with or without fish kairomone (Fig. 1, Table S1). D. magna exposed to fish kairomone signiﬁcantly decreased body size and increased spine length and spine length / body size compared to those not exposed to fish kairomone (Fig. 2, Table S2). Among them, both the body size and the spine length of D. magna were affected by fish kairomone after three days (3rd instar, Table S3, Fig. 2). With the extension of growth days, the body size of D. magna exposed to fish kairomone was significantly smaller than those not exposed to fish kairomone after five days (5th instar, Table S3, Fig. 2a). The body sizes of D. magna exposed or not exposed to fish kairomone were close to the maximum after 12 days (9th instar, Table S3, Fig. 2a). Furthermore, With the extension of growth days, the spine length of D. magna exposed to fish kairomone was significantly increased than those not exposed to kairomone (Fig. 2d). After 11 days (9th instar, Table S3), the spine length of D. magna reached the maximum value regardless of exposure to kairomone, and then decreased (Fig. 2d). The spine length / body size of D. magna exposed to fish kairomone was significantly higher than that not exposed to kairomone (Fig. 2g). With the extension of developmental stages, the spine length / body size of D. magna was close to the minimum after 12 days (9th instar, Table S3, Fig. 2g).

Composition of the microbial communities in Daphnia individuals

The family Comamonadaceae (mainly Limnohabitans sp.) showed the highest relative abundance followed by Moraxellaceae (mainly Acinetobacter sp.) and Flavobacteriaceae (mainly Flavobacterium sp.) among all bacterial family (Fig. 3 and S1, Table S4). In the whole Daphnia, there was a significant interaction between fish kairomone and instar on the relative abundance of Moraxellaceae and Flavobacteriaceae (Table S5), and the relative abundance of Comamonadaceae were significantly decreased by fish kairomone (Fig. 3, Table S5). In the guts of Daphnia, there was no signiﬁcant interaction between fish kairomone and Daphnia instar on the three bacterial family (Table S5). However, as the Daphnia instar increased, the relative abundance of Comamonadaceae and Flavobacteriaceae in the guts were significantly decreased (Fig. 3, Table S5). In the culture medium, there was a significant interaction between fish kairomone and instar on the relative abundance of the three bacterial family (Table S5); furthermore, the relative abundance of Comamonadaceae was significantly reduced under fish kairomone influence (Fig. 3, Table S5).

Diversity analysis in the microbiome

Shannon diversity of the microbiota in both dissected guts and whole Daphnia did not change significantly with the developmental stage of Daphnia (Fig. 4a). However, in the presence of fish kairomone, the interaction with Daphnia instar significantly reduced the Shannon diversity of microbiota in dissected guts (p = 0.008, Fig. 4a). The interaction between fish kairomone and Daphnia instar was not observed in Shannon diversity of whole Daphnia microbiota. We also detected the Shannon diversity of microbiota in the culture medium, and found that the increase of Daphnia instar did not change the Shannon diversity of microbiota in the culture medium, but the interaction between fish kairomone and Daphnia instar had a significantly effect on the Shannon diversity of microbiota in the culture medium (p = 0.005, Fig. 4a).

NMDS plots based beta diversity showed that Daphnia gut microbial community was distinctively separated from the microbiota in whole Daphnia and culture medium (Fig. 4b). Unweighted pair group method with arithmetic mean (UPGMA) tree of bacterial communities based on Bray-Curtis distance matrix showed that the samples in clade3 without fish kairomone and those treated with fish kairomone were in different branches (Fig. 4c), which indicated that predation risk was the main factor to determine the microbial composition variations.

Representative OTUs

There were small overlaps in OTUs of microbiota within whole Daphnia, dissected guts, and culture medium, while most OTUs in each part were unique (Fig. 5a). In the gut microbiota, OTUs between absence and presence of fish kairomone also overlapped small, the unique OTUs number was greater among the control and fish kairomone treatments (Fig. 5b). Through analyzing the OTU dynamics in the control and fish kairomone treatments, we found 9 OTUs which belonged to Epsilonbacteraeota (e.g., Arcobacter and Helicobacter) only occurring in the gut microbiota of Daphnia exposed to fish kairomone. In addition, 295 OTUs belonging to phylum Firmicutes were found in the gut microbiota of Daphnia exposed to fish kairomone. However, there were only 217 OTUs belonging to phylum Firmicutes found in the gut microbiota of Daphnia not exposed to fish kairomone. It was worth noting that the sum of these OTUs only accounted for a small proportion of the total relative abundance of all phyla (the dataset were deposited into the NCBI Sequence Read Archive database).

Correlation between life history traits and bacterial abundance

The body size and the spine length of D. magna were significantly correlated with the relative abundance of Comamonadaceae in both whole Daphnia and culture medium microbiota (Fig. 6, Table S6). The body size and the spine length of D. magna increased and decreased by the high relative abundance of Comamonadaceae, respectively. In the whole Daphnia, the relative abundance of other bacteria (Moraxellaceae and Flavobacteriaceae) were not correlated with both body size and spine length of D. magna. In the culture medium, the spines length of D. magna was also reduced by the high relative abundance of Flavobacteriaceae. In dissected guts of Daphnia, except that the spine length of D. magna was reduced by the high relative abundance of Flavobacteriaceae, the relative abundance of the three types of bacteria showed no correlation with the body size and spine length D. magna (Fig. 6, Table S6).

D. magna key life-history traits, such as the total offspring per female and the number of brood, were directly linked with the relative abundance of Comamonadaceae and Moraxellaceae in the whole Daphnia (Fig. 6, Table S6). The two traits (total offspring per female and number of brood) of D. magna were decreased by the high abundance of Comamonadaceae and increased by the high abundance of Moraxellaceae (Fig. 6, Table S6). In the culture medium, only the total offspring per female of D. magna was reduced by the high abundance of Comamonadaceae (Fig. 6, Table S6). In dissected guts of Daphnia, the abundance of the three types of bacteria showed no correlation with the two parameters (total offspring per female and number of brood) of D. magna (Fig. 6, Table S6).

Correlation between life history traits and microbial diversity

The spine length showed significantly negative correlation with the microbial diversity in culture medium, whereas the brood number showed significantly positive correlation with the microbial diversity in the whole Daphnia (Fig. 7, Table S7). However, the body size and the total offspring number of D. magna had no significant correlation with microbial diversity, whether in culture medium, gut, or the whole Daphnia (Fig. 7, Table S7).

Functional predictions

A total of 36 predicted functional categories representing 7 pathway diagrams in the KEGG level 2 functional modules were given by PICRUSt2. Multiple KEGG function abundance cluster analysis was conducted to check the changes of functions under the absence and presence of fish kairomone and different microflora detection sites (Fig. 8). When analyzing the effects of fish kairomone on microbial functional categories in whole Daphnia and culture medium, we found that there was little difference between different functional categories in whole Daphnia and culture medium in the presence or absence of fish kairomone (Fig. 8). However, when analyzing the effects of fish kairomone on microbial functional categories in dissected guts, we found that there was a significant effect on metabolic pathways, involved in enhancing the metabolism of cofactors, vitamins, and energy (Fig. 8). Furthermore, the presence of fish kairomone enhanced the functional categories folding, sorting, and degradation (Fig. 8).

Increasing evidences have shown that the gut microbiota is an essential mediator for changing life history, as well as acclimating and adapting to changeable environmental conditions [8, 9]. Determining the links between variation in gut microbiota and host phenotype and understanding how the microbiome are assembled, which can help us to predict how and to what extent the gut microbiota impacts host fitness [8]. In this study, we analyzed the composition of gut microbiota and the relative abundance of dominant bacteria related to D. magna under the stress of fish kairomone. Our results showed that fish kairomone affected the composition and decreased the Shannon diversity of D. magna gut microbiota with the increase of Daphnia instars. The relative abundance of some bacteria decreased due to the presence of fish kairomone, among which Comamonadaceae (mainly Limnohabitans sp.) was mainly reduced. Correlation analysis results showed that there was a linear correlation between the high relative abundance of Comamonadaceae, Moraxellaceae, and Flavobacteriaceae and the life history traits of D. magna. Among them, the body size of D. magna was positively correlated with the increased abundance of Comamonadaceae, while spine length of D. magna was negatively correlated with the increased abundance of Comamonadaceae, and positively correlated with the increased abundance of Flavobacteriaceae. These results well confirmed our scientific hypotheses. We speculated that predation risk may indirectly affect the defensive traits of D. magna by reshaping the composition of gut microbiota during the growth, although this speculation needed to be further verified. Our results were of great significance for understanding the influence of host-microbial interaction on individual anti-predation defense.

D. magna gut microbiota and its dominant bacterial groups

Peter and Sommaruga [51] detected most major bacterial groups of the surrounding water in gut homogenates of copepods and cladocerans, except for Actinobacteria. Therefore, the bacteria in the cultivation water can be reflected by filtering the different community members accumulated in the gut. However, in our study, D. magna possessed a unique gut microbiota, and there was a great difference between its gut microbial communities and the surrounding water. Grossart et al. [52] demonstrated that the bacteria associated with the cladoceran Bosmina were highly similar even in different lakes. Thus, it can be assumed that the gut microbiota in Daphnia is mainly composed of resident bacteria, which may be less susceptible to reflect the surrounding bacterial community. In agreement with previous reports [5, 16, 47, 53], Proteobacteria and Bacteroidetes were the dominant bacterial phyla in D. magna guts in our study. Comamonadaceae was the main component of Proteobacteria phyla, which induced positive fitness effects in Daphnia, and Limnohabitans was the most abundant Comamonadaceae, as described in previous studies [28, 54–57]. In this study, with the increase of Daphnia instar, the abundance of Comamonadaceae (mainly Limnohabitans sp.) in Daphnia guts was significantly reduced (Table S5). It was observed that the microbiota composition did not remain stable over time. However, fish kairomone had no significant effect on the relative abundance of Comamonadaceae (mainly Limnohabitans sp.) in Daphnia guts, nor did the interaction with instars, although fish kairomone significantly increased the fecundity of D. magna (Figs. 1 and 2, Table S5). This seemed to contradict the results of Peerakietkhajorn et al. [57, 58], which found that bacteria in the genus Limnohabitans have been linked to increased fecundity and population size in D. magna. Possibly, this shift in the community composition is caused by two reasons. For one thing, Daphnia might spend costs on growth in the early stage, and turn to spend more energy on resisting predators in the later developmental stage over time. For another, Daphnia might uptake and stimulate the inactive or underrepresented bacteria, as described in the guts of earthworms [59]. These bacteria were not detected, but were activated and thus increased in abundance over time, overriding the relative abundance of Limnohabitans. In addition to Limnohabitans, other bacteria detected in D. magna intestine include Acinetobacter and Flavobacterium. Furthermore, when comparing the relative abundance of bacterial phyla among treatments, we found that Epsilonbacteraeota only existed in the gut microbiota of D. magna exposed to fish kairomone. This suggests that Epsilonbacteraeota, especially Arcobacter and Helicobacter could be used as indicators for predation risk. In addition, Epsilonbacteraeota have also been suggested to be associated with hypertension [60], and the increased risk for hypertension is often associated with host psychological stress [61, 62].

Effects of predation risk and instar on D. magna gut microbiota

In previous studies on humans and some vertebrates, researchers have shown that stress can affect and alter the gut microbiota. For example, when faced with academic pressure, the levels of fecal lactic acid bacteria in students decreased significantly [63]; the gut microbiota community in mice could be impacted by social disruption stressor [64]; in aquatic organisms, the species richness and microbial diversity of overall gut microbiota in perch significantly decreased in the presence of predator [15]. In our experiment, the presence of predation risk also decreased the diversity of D. magna gut microbiota with the increase of Daphnia instar (Fig. 4a). The stress responses of D. magna were similar to those in vertebrates, which are primarily regulated by stress-released hormones [25, 65]. In vertebrates, primary hormone responses would trigger endocrine responses, which have been previously suggested to associate with gut microbiota composition and diversity [66–68]. As we known, long-term exposure to stress is likely to cause endocrine disorders [69–71]. In studies of multiple species, endocrine-disrupted species have significantly lower gut microbial diversity compared to healthy species [72–75]. Alternately, there are differences in the composition of the gut microbiota community at different Daphnia instars, and these differences may be due to the physiological changes that occur during development of Daphnia. For example, in contrast to the small body size of Daphnia juveniles, the increased body size after juveniles growth could prolong the time of food passing through the guts and thus improve the efficiency of assimilation [76]. Furthermore, the characteristics of transportation time and morphological structure in the digestive system will affect the community composition of gut microbiota. Longer gut passage time may make the gut microbiota community have a longer time to use substrates [77–79]. This may be the main reason that fish kairomone significantly reduced the gut microbiota diversity of D. magna with its increasing instar.

Relationship between gut bacteria and D. magna life history traits

In the study on the comparing germ-free and conventionally reared individuals of D. magna, Sison-Mangus et al. [4] first reported that the gut microbiota is an important factor that affects life-history traits contributing to host fitness. Compared with conventionally reared individuals, germ-free D. magna have smaller body size, less fecundity, and higher mortality [4]. In the food chain, the body size and reproduction quantity of prey are important traits to cope with predation pressure [43, 80, 81]. For Daphnia, the significant reduction in body size and increase in fecundity can allow them to increase the probability of reproduction before being eaten by visual, size-selective predators such as fish [40, 80, 81]. Current study also showed that the presence of fish kairomone significantly decreased the body size and increased the spine length and the total offspring number of D. magna (Figs. 1 and 2, Table S1 and S2). We used these representative parameters to establish the correlation between the microbial abundance and composition in the guts and the fitness in D. magna, which was consistent with previous studies that used several key features such as fecundity, host survival time, and body size to correlate host fitness with the microbiome [16, 47, 82, 83].

In our study, the growth traits (the body size and the spine length) of D. magna were positively linked with Comamonadaceae abundance (Fig. 6, Table S6); the reproductive traits (the total offspring number and the brood number) of D. magna were directly linked with the abundance of either Comamonadaceae or Moraxellaceae, and the reproduction quantity of D. magna increased significantly in the presence of fish kairomone, which may depend on the abundance and presence of Moraxellaceae (Gammaproteobacteria, Pseudomonadales). It should be noted that in terms of the gut microbial diversity, it had no significant correlation with growth and reproduction traits of D. magna (Fig. 7, Table S7), indicating that there was a differential effect between partial bacterial abundance and overall microbial diversity on life history traits of D. magna, and the increase of the abundance of some key bacteria played a particularly important role. Previous studies have shown that some strains of bacteria can provide the essential elements for host reproduction and growth to the benefit of the host [58, 83]. For example, the key components of Daphnia gut microbiota, Limnohabitans, Aeromonas, and Acidovorax [57, 84], have been linked to Daphnia obtaining essential amino acids [85, 86], polyunsaturated fatty acids, and sterols [87] that positively affect Daphnia growth and reproduction [86]. These bacteria in Daphnia’s gut can produce some useful enzymes for digestion [58], and then increase the production of nutrients incorporated into the female and parthenogenetic eggs during development of oocytes, which may promote Daphnia growth and increase viable Daphnia juveniles. These bacteria are thus more likely to have advantages under predation risks. Besides, coping with stress is a process of expending energy for animals and may have an impact on metabolism [88]. The gut microbiota plays a crucial role in host metabolism [89–91]. In this study, the presence of fish kairomone indeed promoted the metabolic pathway in the gut of D. magna (Fig. 8). Bile salts, as the main active substance of fish kairomone [65, 92], can regulate gut microbial composition both directly and indirectly by activating innate immune response genes in guts. The dominant microbiota of different metabolic substrates is significantly different [93, 94], thus Daphnia need to re-allocate metabolic substrates to cope with the increasing energy needs when facing stress, such as investment in reproduction to increase the chances of survival, instead of spending them on a high-energy growth [95]. Based on the above results, we speculated that fish kairomone may alter the host physiology by changing the host microbiomes, although this needs to be further examined.

It should be noted that the correlation in our results was more pronounced in whole Daphnia and culture medium microorganisms, but not in Daphnia gut, which may be because Daphnia feeding behavior plays an important role in structuring Daphnia-associated microbial communities [56, 96]. Host metabolism and immunity might further extend to affect the external environment of Daphnia in order to shape the gut environment, for instance through the shedding of immune effectors [97], thereby affecting the bacterioplankton community structure. This is in accordance with the results of Mack et al. [98], who found that diet or microbial inoculation has less influence on the gut microbiota but greater impact on the surrounding environmental microbiota.

Our results showed that D. magna not only developed defense traits, but also changed gut microbiota in response to predation risk. The change in the abundance of microbiota was mainly manifested in Comamonadaceae which was significantly reduced under the influence of fish kairomone. As for defense traits, the body size of D. magna was positively correlated with the increased abundance of Comamonadaceae, whereas the spine, total offspring number, and brood number of D. magna were negatively correlated with the increased abundance of Comamonadaceae, indicating there was a differential effect between partial bacterial abundance and overall microbial diversity on the defense traits of D. magna, and the increase of the abundance of some key bacteria played a particularly important role. In addition, the interaction of Daphnia instar and fish kairomone significantly reduced the diversity of gut microbiota, which may be related to the effect of fish kairomone on the endocrine of Daphnia. This study suggested that gut microbiota may play an important role in the development of defensive traits in Daphnia in response to fish predators. Linking anti-predation defense characteristics to the change of microbiota may help us to better predict the interaction between host and its microbiota under multiple stressors.

Supplementary Information

Additional Supplementary Information may be found in the online version of this article at the publisher’s web-site.

Data Availability

Data deposited into the NCBI Sequence Read Archive database and available online under BioProject SAMN28549279.

Acknowledgements

The authors greatly appreciate the anonymous reviewers for their constructive comments.

Funding

This research was supported by the Key Project of National Natural Science Foundation of China (31730105) and the Priority Academic Program Development of Jiangsu Higher Education Institutions.

Competing Interests

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Author Contributions

Z.Y. developed the ideas and designed the experiments with Q.L.; Q.L. performed the experiments and collected the data with S.A., Q.Z., and Z.D.; Q.L., Y.S., and Z.D. analyzed the data; Q.L. wrote the initial draft of the manuscript, while Z.Y. provided substantial feedback. All authors contributed critically to the drafts and gave final approval for publication.

Ethics approval

Not applicable.

Consent to participate

The authors declare their consent to participate in the present work.

Consent to publish

The authors declare their consent for the publication of the present work.

Douglas AE (2015) Multiorganismal insects: diversity and function of resident microorganisms. Annu Rev Entomol 60:17–34. https://doi.org/10.1146/annurev-ento-010814-020822
Amato KR (2016) Incorporating the gut microbiota into models of human and non-human primate ecology and evolution. Am J Phys Anthropol 159:196–215. https://doi.org/10.1002/ajpa.22908
Engel P, Moran NA (2013) The gut microbiota of insects-diversity in structure and function. FEMS Microbiol Rev 37:699–735. https://doi.org/10.1111/1574-6976.12025
Sison-Mangus MP, Mushegian AA, Ebert D (2015) Water fleas require microbiota for survival, growth and reproduction. ISME J 9:59–67. https://doi.org/10.1038/ismej.2014.116
Callens M, Macke E, Muylaert K, Bossier P, Lievens B, Waud M, Decaestecker E (2016) Food availability affects the strength of mutualistic host-microbiota interactions in Daphnia magna. ISME J 10:911–920. https://doi.org/10.1038/ismej.2015.166
Storelli G, Defaye A, Erkosar B, Hols P, Royet J, Leulier F (2011) Lactobacillus plantarum promotes drosophila systemic growth by modulating hormonal signals through TOR-dependent nutrient sensing. Cell Metab 14:403–414. https://doi.org/10.1016/j.cmet.2011.07.012
Coon KL, Vogel KJ, Brown MR, Strand MR (2014) Mosquitoes rely on their gut microbiota for development. Mol Ecol 23:2727–2739. https://doi.org/10.1111/mec.12771
Alberdi A, Aizpurua O, Bohmann K, Zepeda-Mendoza ML, Gilbert MTP (2016) Do vertebrate gut metagenomes confer rapid ecological adaptation? Trends Ecol Evol 31:689–699. https://doi.org/10.1016/j.tree.2016.06.008
Macke E, Tasiemski A, Massol F, Callens M, Decaestecker E (2017) Life history and eco-evolutionary dynamics in light of the gut microbiota. Oikos 126:508–531. https://doi.org/10.1111/oik.03900
Shapira M (2016) Gut microbiotas and host evolution: scaling up symbiosis. Trends Ecol Evol 31:539–549. https://doi.org/10.1016/j.tree.2016.03.006
Roth Rosenberg D, Haber M, Goldford J, Lalzar M, Aharonovich D, Al-Ashhab A, Lehahn Y, Segrè D, Steindler L, Sher D (2021) Particle‐associated and free‐living bacterial communities in an oligotrophic sea are affected by different environmental factors. Environ Microbiol 23:4295–4308. https://doi.org/10.1111/1462-2920.15611
Wong AC, Luo Y, Jing X, Franzenburg S, Bost A, Douglas AE (2015) The host as the driver of the microbiota in the gut and external environment of drosophila melanogaster. Appl Environ Microbiol 81:6232–6240. https://doi.org/10.1128/AEM.01442-15
Spor A, Koren O, Ley R (2011) Unravelling the effects of the environment and host genotype on the gut microbiome. Nat Rev Microbiol 9:279–290. https://doi.org/10.1038/nrmicro2540
Akbar S, Gu L, Sun Y, Zhang L, Lyu K, Huang Y, Yang Z (2021) Understanding host-microbiome-environment interactions: Insights from Daphnia as a model organism. Sci Total Environ 808:152093. https://doi.org/10.1016/j.scitotenv.2021.152093
Zha Y, Eiler A, Johansson F, Svanback R (2018) Effects of predation stress and food ration on perch gut microbiota. Microbiome 6:28. https://doi.org/10.1186/s40168-018-0400-0
Akbar S, Gu L, Sun Y, Zhou Q, Zhang L, Lyu K, Huang Y, Yang Z (2020) Changes in the life history traits of Daphnia magna are associated with the gut microbiota composition shaped by diet and antibiotics. Sci Total Environ 705:135827. https://doi.org/10.1016/j.scitotenv.2019.135827
Svanbäck R, Persson L (2004) Individual diet specialization, niche width and population dynamics: implications for trophic polymorphisms. J Anim Ecol 973–982. https://doi.org/10.1111/j.0021-8790.2004.00868.x
Svanbäck R, Eklöv P, Fransson R, Holmgren K (2008) Intraspecific competition drives multiple species resource polymorphism in fish communities. Oikos 117:114–124. https://doi.org/10.1111/j.2007.0030-1299.16267.x
Tonn WM, Holopainen IJ, Paszkowski CA (1994) Density-dependent effects and the regulation of crucian carp populations in single-species ponds. Ecology: 824–834. https://doi.org/10.2307/1941738
Pauwels K, Stoks R, De Meester L (2010) Enhanced anti-predator defence in the presence of food stress in the water flea Daphnia magna. Funct Ecol 24:322–329. https://doi.org/10.1111/j.1365-2435.2009.01641.x
Brönmark C, Miner JG (1992) Predator-induced phenotypical change in body morphology in crucian carp. Science: 1348–1350. https://doi.org/10.1126/science.258.5086.1348
Johansson F, Andersson J (2009) Scared fish get lazy, and lazy fish get fat. J Anim Ecol 78:772–777. https://doi.org/10.1111/j.1365-2656.2009.01530.x
Svanbäck R, Zha Y, Brönmark C, Johansson F (2017) The interaction between predation risk and food ration on behavior and morphology of Eurasian perch. Ecol Evol 7:8567–8577. https://doi.org/10.1002/ece3.3330
Sadeq SA, Mills RIL, Beckerman AP (2021) The microbiome mediates the interaction between predation and heavy metals. Sci Total Environ 775:145144. https://doi.org/10.1016/j.scitotenv.2021.145144
Fischer EK, Harris RM, Hofmann HA, Hoke KL (2014) Predator exposure alters stress physiology in guppies across timescales. Horm Behav 65:165–172. https://doi.org/10.1016/j.yhbeh.2013.12.010
Forsythe P, Kunze WA, Bienenstock J (2012) On communication between gut microbes and the brain. Curr Opin Gastroenterol 28:557–562. https://doi.org/10.1097/MOG.0b013e3283572ffa
Candela M, Biagi E, Maccaferri S, Turroni S, Brigidi P (2012) Intestinal microbiota is a plastic factor responding to environmental changes. Trends Microbiol 20:385–391. https://doi.org/10.1016/j.tim.2012.05.003
Callens M, Watanabe H, Kato Y, Miura J, Decaestecker E (2018) Microbiota inoculum composition affects holobiont assembly and host growth in Daphnia. Microbiome 6:56. https://doi.org/10.1186/s40168-018-0444-1
Chen B, Teh BS, Sun C, Hu S, Lu X, Boland W, Shao Y (2016) Biodiversity and activity of the gut microbiota across the life history of the insect herbivore spodoptera littoralis. Sci Rep 6:29505. https://doi.org/10.1038/srep29505
Moll RM, Romoser WS, Modrakowski MC, Moncayo AC, Lerdthusnee K (2001) Meconial peritrophic membranes and the fate of midgut bacteria during mosquito (Diptera: Culicidae) metamorphosis. J Med Entomol 38:29–32. https://doi.org/10.1603/0022-2585-38.1.29
Chen B, Du K, Sun C, Vimalanathan A, Liang X, Li Y, Wang B, Lu X, Li L, Shao Y (2018) Gut bacterial and fungal communities of the domesticated silkworm (Bombyx mori) and wild mulberry-feeding relatives. ISME J 12:2252–2262. https://doi.org/10.1038/s41396-018-0174-1
Kohl KD, Cary TL, Karasov WH, Dearing MD (2013) Restructuring of the amphibian gut microbiota through metamorphosis. Environ Microbiol Rep 5:899–903. https://doi.org/10.1111/1758-2229.12092
Burns AR, Stephens WZ, Stagaman K, Wong S, Rawls JF, Guillemin K, Bohannan BJ (2016) Contribution of neutral processes to the assembly of gut microbial communities in the zebrafish over host development. ISME J 10:655–664. https://doi.org/10.1038/ismej.2015.142
Koenig JE, Spor A, Scalfone N, Fricker AD, Stombaugh J, Knight R, Angenent LT, Ley RE (2011) Succession of microbial consortia in the developing infant gut microbiome. PNAS 108:4578–4585. https://doi.org/10.1073/pnas.1000081107
Palmer C, Bik EM, Digiulio DB, Relman DA, Brown PO (2007) Development of the human infant intestinal microbiota. PLoS Biol 5:e177. https://doi.org/10.1371/journal.pbio.0050177
Smith CC, Snowberg LK, Caporaso JG, Knight R, Bolnick D (2015) Dietary input of microbes and host genetic variation shape among-population differences in stickleback gut microbiota. ISME J 9:2515. https://doi.org/10.1038/ismej.2015.64
Yang Z, Zhang L, Zhu X, Wang J, Montagnes DJS (2016) An evidence-based framework for predicting the impact of differing autotroph-heterotroph thermal sensitivities on consumer-prey dynamics. ISME J 10:1767–1778. https://doi.org/10.1038/ismej.2015.225
Yang Z, Lowe CD, Crowther W, Fenton A, Watts PC, Montagnes DJS (2013) Strain-specific functional and numerical responses are required to evaluate impacts on predator-prey dynamics. ISME J 7:405–416. https://doi.org/10.1038/ismej.2012.117
Moeller AH, Sanders JG (2020) Roles of the gut microbiota in the adaptive evolution of mammalian species. Philos Trans R Soc Lond B Biol Sci 375:20190597. https://doi.org/10.1098/rstb.2019.0597
Stoks R, Govaert L, Pauwels K, Jansen B, De Meester L (2016) Resurrecting complexity: the interplay of plasticity and rapid evolution in the multiple trait response to strong changes in predation pressure in the water flea Daphnia magna. Ecol Lett 19:180–190. https://doi.org/10.1111/ele.12551
Stibor H, Muller Navarra D (2000) Constraints on the plasticity of Daphnia magna influenced by fish-kairomones. Funct Ecol 14:455–459. https://doi.org/10.2307/2656538
Sakwińska O (1998) Plasticity of Daphnia magna life history traits in response to temperature and information about a predator. Freshw Biol 39:681–687. https://doi.org/10.1046/j.1365-2427.1998.00320.x
Gu L, Lyu K, Dai Z, Fan M, Zhu X, Wang J, Wang X, Yang Z (2017) Predator-specific responses of Moina macrocopa to kaironmones from different fishes. Int Rev Hydrobiol 102:83–89. https://doi.org/10.1002/iroh.201601872
Dodson SI, Ryan S, Tollrian R, Lampert W (1997) Individual swimming behavior of Daphnia: effects of food, light and container size in four clones. J Plankton Res 19:1537–1552. https://doi.org/10.1093/plankt/19.10.1537
Huang J, Xu X, Li D, Sun Y, Gu L, Zhang L, Lyu K, Yang Z (2021) Decreased calcium concentration interferes with life history defense strategies of Ceriodaphnia cornuta in response to fish kairomone. Limnol Oceanogr. https://doi.org/10.1002/lno.11876
Okazaki Y, Fujinaga S, Tanaka A, Kohzu A, Oyagi H, Nakano S-I (2017) Ubiquity and quantitative significance of bacterioplankton lineages inhabiting the oxygenated hypolimnion of deep freshwater lakes. ISME J 11:2279–2293. https://doi.org/10.1038/ismej.2017.89
Akbar S, Huang J, Zhou Q, Gu L, Sun Y, Zhang L, Lyu K, Yang Z (2021) Elevated temperature and toxic Microcystis reduce Daphnia fitness and modulate gut microbiota. Environ Pollut 271:116409. https://doi.org/10.1016/j.envpol.2020.116409
Sun Y, Lei J, Wang Y, Cheng J, Zhou Q, Wang Z, Zhang L, Gu L, Huang Y, Yang Z (2019) High concentration of Phaeocystis globosa reduces the sensitivity of rotifer Brachionus plicatilis to cadmium: based on an exponential approach fitting the changes in some key life-history traits. Environ Pollut 246:535–543. https://doi.org/10.1016/j.envpol.2018.12.054
Zhu X, Wang J, Chen Q, Chen G, Huang Y, Yang Z (2016) Costs and trade-offs of grazer-induced defenses in Scenedesmus under deficient resource. Sci Rep 6:22594. https://doi.org/10.1038/srep22594
Huang Y, Cui G, Li B, Zhu X, Yang Z (2018) Elevated atmospheric CO2 enhances grazer-induced morphological defense in the freshwater green alga Scenedesmus obliquus. Limnol Oceanogr 63:1004–1014. https://doi.org/10.1002/lno.10715
Peter H, Sommaruga R (2008) An evaluation of methods to study the gut bacterial community composition of freshwater zooplankton. J Plankton Res 30:997–1006. https://doi.org/10.1093/plankt/fbn061
Grossart H-P, Dziallas C, Tang KW (2009) Bacterial diversity associated with freshwater zooplankton. Environ Microbiol Rep 1:50–55. https://doi.org/10.1111/j.1758-2229.2008.00003.x
Freese HM, Schink B (2011) Composition and stability of the microbial community inside the digestive tract of the aquatic crustacean Daphnia magna. Mol Ecol 62:882–894. https://doi.org/10.1007/s00248-011-9886-8
Eckert EM, Pernthaler J (2014) Bacterial epibionts of Daphnia: a potential route for the transfer of dissolved organic carbon in freshwater food webs. ISME J 8:1808–1819. https://doi.org/10.1038/ismej.2014.39
Macke E, Callens M, De Meester L, Decaestecker E (2017) Host-genotype dependent gut microbiota drives zooplankton tolerance to toxic cyanobacteria. Nat Commun 8:1608. https://doi.org/10.1038/s41467-017-01714-x
Mushegian AA, Arbore R, Walser J-C, Ebert D (2019) Environmental sources of bacteria and genetic variation in behavior influence host-associated microbiota. Appl Environ Microbiol 85:e01547–e01518. https://doi.org/10.1128/AEM.01547-18
Peerakietkhajorn S, Tsukada K, Kato Y, Matsuura T, Watanabe H (2015) Symbiotic bacteria contribute to increasing the population size of a freshwater crustacean, Daphnia magna. Environ Microbiol Rep 7:364–372. https://doi.org/10.1111/1758-2229.12260
Peerakietkhajorn S, Kato Y, Kasalický V, Matsuura T, Watanabe H (2016) Betaproteobacteria Limnohabitans strains increase fecundity in the crustacean Daphnia magna: symbiotic relationship between major bacterioplankton and zooplankton in freshwater ecosystem. Environ Microbiol 18:2366–2374. https://doi.org/10.1111/1462-2920.12919
Drake HL, Horn MA (2007) As the worm turns: the earthworm gut as a transient habitat for soil microbial biomes. Annu Rev Entomol 61:169–189. https://doi.org/10.1146/annurev.micro.61.080706.093139
Thiba A (2018) Differences in gut microbiota in rat models of cardiovascular disease. Dissertation, University of the Witwatersrand
Hu B, Liu X, Yin S, Fan H, Feng F, Yuan J (2015) Effects of psychological stress on hypertension in middle-aged Chinese: a cross-sectional study. PLoS ONE 10:e0129163. https://doi.org/10.1371/journal.pone.0129163
Pickering TG (1990) Does psychological stress contribute to the development of hypertension and coronary heart disease? EurJ Clin Pharmacol 39:1–S7. https://doi.org/10.1007/BF01409199
Knowles SR, Nelson EA, Palombo EA (2008) Investigating the role of perceived stress on bacterial flora activity and salivary cortisol secretion: A possible mechanism underlying susceptibility to illness. Biol Psychol 77:132–137. https://doi.org/10.1016/j.biopsycho.2007.09.010
Bailey MT, Dowd SE, Galley JD, Hufnagle AR, Allen RG, Lyte M (2011) Exposure to a social stressor alters the structure of the intestinal microbiota: Implications for stressor-induced immunomodulation. Brain Behav Immun 25:397–407. https://doi.org/10.1016/j.bbi.2010.10.023
Hahn M, von Elert E (2022) One kairomone and multiple effects in Daphnia species—5α-cyprinol sulfate induces morphological defenses in the invasive species Daphnia lumholtzi. Front Ecol Evol 10:804521. https://doi.org/10.3389/fevo.2022.804521
Zhang H, Sparks JB, Karyala SV, Settlage R, Luo XM (2015) Host adaptive immunity alters gut microbiota. ISME J 9:770–781. https://doi.org/10.1038/ismej.2014.165
Vijay-Kumar M, Aitken JD, Carvalho FA, Cullender TC, Mwangi S, Srinivasan S, Sitaraman SV, Knight R, Ley RE, Gewirtz AT (2010) Metabolic syndrome and altered gut microbiota in mice lacking Toll-like receptor 5. Science 328:228–231. https://doi.org/10.1126/science.1179721
Qi X, Yun C, Pang Y, Qiao J (2021) The impact of the gut microbiota on the reproductive and metabolic endocrine system. Gut Microbes 13:1–21. https://doi.org/10.1080/19490976.2021.1894070
Lyu K, Zhu X, Wang Q, Chen Y, Yang Z (2013) Copper/zinc superoxide dismutase from the cladoceran Daphnia magna: molecular cloning and expression in response to different acute environmental stressors. Environ Sci Technol 47:8887–8893. https://doi.org/10.1021/es4015212
Keskin G (2019) Approach to stress endocrine response: somatization in the context of gastroenterological symptoms: a systematic review. Afr Health Sci 19:2537–2545. https://doi.org/10.4314/ahs.v19i3.29
Ariyasu D, Yoshida H, Hasegawa Y (2017) Endoplasmic reticulum (ER) stress and endocrine disorders. Int J Mol Sci 18:382. https://doi.org/10.3390/ijms18020382
Rizk MG, Thackray VG (2021) Intersection of polycystic ovary syndrome and the gut Microbiome. J Endocr Soc 5:bvaa177. https://doi.org/10.1210/jendso/bvaa177
Mukherjee R, Pandya P, Baxi D, Ramachandran AV (2021) Endocrine disruptors-'food' for thought. Proc Zool Soc 74:432–442. https://doi.org/10.1007/s12595-021-00414-1
Lindheim L, Bashir M, Munzker J, Trummer C, Zachhuber V, Leber B, Horvath A, Pieber TR, Gorkiewicz G, Stadlbauer V, Obermayer-Pietsch B (2017) Alterations in gut microbiome composition and barrier function are associated with reproductive and metabolic defects in women with polycystic ovary syndrome (PCOS): a pilot study. PLoS ONE 12:e0168390. https://doi.org/10.1371/journal.pone.0168390
De Vadder F, Joly A, Leulier F (2021) Microbial and nutritional influence on endocrine control of growth. J Mol Endocrinol 66:R67–R73. https://doi.org/10.1530/JME-20-0288
Demott WR, Mckinney EN, Tessier AJ (2010) Ontogeny of digestion in Daphnia: implications for the effectiveness of algal defenses. Ecology 31:540–548. https://doi.org/10.1890/08-2103.1
Kashyap PC, Marcobal A, Ursell LK, Larauche M, Duboc H, Earle KA, Sonnenburg ED, Ferreyra JA, Higginbottom SK, Million M, Tache Y, Pasricha PJ, Knight R, Farrugia G, Sonnenburg JL (2013) Complex interactions among diet, gastrointestinal transit, and gut microbiota in humanized mice. Gastroenterology 144:967–977. https://doi.org/10.1053/j.gastro.2013.01.047
Stearns JC, Lynch MD, Senadheera DB, Tenenbaum HC, Goldberg MB, Cvitkovitch DG, Croitoru K, Moreno-Hagelsieb G, Neufeld JD (2011) Bacterial biogeography of the human digestive tract. Sci Rep 1:170. https://doi.org/10.1038/srep00170
Pees B, Johnke J, Möhl M, Hamerich IK, Leippe M, Petersen C (2021) Microbes to-go: slugs as source for Caenorhabditis elegans microbiota acquisition. Environ Microbiol. https://doi.org/10.1111/1462-2920.15730
Tollrian R, Harvell CD (1999) The ecology and evolution of inducible defenses. Princeton University Press
Lass S, Spaak P (2003) Chemically induced anti-predator defences in plankton: a review. Hydrobiologia 491:221–239. https://doi.org/10.1023/A:1024487804497
Walters AW, Hughes RC, Call TB, Walker CJ, Wilcox H, Petersen SC, Rudman SM, Newell PD, Douglas AE, Schmidt PS, Chaston JM (2020) The microbiota influences the Drosophila melanogaster life history strategy. Mol Ecol 29:639–653. https://doi.org/10.1111/mec.15344
Motiei A, Brindefalk B, Ogonowski M, El-Shehawy R, Pastuszek P, Karin E, Liewenborg B, Udekwu K, Gorokhova E (2020) Disparate effects of antibiotic-induced microbiome change and enhanced fitness in Daphnia magna. PLoS ONE 15:e0214833. https://doi.org/10.1371/journal.pone.0214833
Mushegian AA, Walser JC, Sullam KE, Ebert D (2018) The microbiota of diapause: How host–microbe associations are formed after dormancy in an aquatic crustacean. J Anim Ecol 87:400–413. https://doi.org/10.1111/1365-2656.12709
Fink P, Pflitsch C, Marin K (2011) Dietary essential amino acids affect the reproduction of the keystone herbivore Daphnia pulex. PLoS ONE 6:e28498. https://doi.org/10.1371/journal.pone.0028498
Taipale SJ, Brett MT, Pulkkinen K, Kainz MJ (2012) The influence of bacteria-dominated diets on Daphnia magna somatic growth, reproduction, and lipid composition. FEMS Microbiol Ecol 82:50–62. https://doi.org/10.1111/j.1574-6941.2012.01406.x
Wacker A, Elert VE (2001) Polyunsaturated fatty acids: evidence for non-substitutable biochemical resources in Daphnia galeata. Ecology 82:2507–2520. https://doi.org/10.1890/0012-9658(2001)082
Lyu K, Meng Q, Zhu X, Dai D, Zhang L, Huang Y, Yang Z (2016) Changes in iTRAQ-based proteomic profiling of the cladoceran Daphnia magna exposed to microcystin-producing and microcystin-free microcystis aeruginosa. Environ Sci Technol 50:4798–4807. https://doi.org/10.1021/acs.est.6b00101
Visconti A, Le Roy CI, Rosa F, Rossi N, Martin TC, Mohney RP, Li W, de Rinaldis E, Bell JT, Venter JC, Nelson KE, Spector TD, Falchi M (2019) Interplay between the human gut microbiome and host metabolism. Nat Commun 10:4505. https://doi.org/10.1038/s41467-019-12476-z
Martin AM, Sun EW, Rogers GB, Keating DJ (2019) The influence of the gut microbiome on host metabolism through the regulation of gut hormone release. Front Physiol 10:428. https://doi.org/10.3389/fphys.2019.00428
Alberto González-Regueiro J, Moreno-Castañeda L, Uribe M, Carlos Chávez-Tapia N (2017) The role of bile acids in glucose metabolism and their relation with diabetes. Ann Hepatol 16:S15–S20. https://doi.org/10.5604/01.3001.0010.5494
Hahn MA, Effertz C, Bigler L, von Elert E (2019) 5a-cyprinol sulfate, a bile salt from fish, induces diel vertical migration in Daphnia. eLife. https://doi.org/10.7554/eLife.44791
Krautkramer KA, Fan J, Backhed F (2021) Gut microbial metabolites as multi-kingdom intermediates. Nat Rev Microbiol 19:77–94. https://doi.org/10.1038/s41579-020-0438-4
Rooks MG, Garrett WS (2016) Gut microbiota, metabolites and host immunity. Nat Rev Immunol 16:341–352. https://doi.org/10.1038/nri.2016.42
Ejsmond A, Kozłowski J, Ejsmond MJ, Houslay T (2019) Probing of mortality rate by staying alive: The growth-reproduction trade‐off in a spatially heterogeneous environment. Funct Ecol 33:2327–2337. https://doi.org/10.1111/1365-2435.13442
Degans H, Zolllner E, Gucht K, De Meester L, Jurgens K (2002) Rapid Daphnia-mediated changes in microbial community structure: an experimental study. FEMS Microbiol Ecol 42:137–149. https://doi.org/10.1111/j.1574-6941.2002.tb01003.x
Otti O, Tragust S, Feldhaar H (2014) Unifying external and internal immune defences. Trends Ecol Evol 29:625–634. https://doi.org/10.1016/j.tree.2014.09.002
Macke E, Callens M, Massol F, Vanoverberghe I, De Meester L, Decaestecker E (2020) Diet and genotype of an aquatic invertebrate affect the composition of free-living microbial communities. Front microbiol 11:380. https://doi.org/10.3389/fmicb.2020.00380

SupplementaryInformation.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

Induced anti-predation defense traits of Daphnia are associated with the gut microbiota composition

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Conclusions

Declarations

References

Supplementary Files

Status:

Version 1