The therapeutic antischizophrenic activity of prodigiosin and selenium co-supplementation against amphetamine hydrochloride-induced behavioural changes, oxidative, inflammatory, and apoptotic challenges in rats

doi:10.21203/rs.3.rs-1732868/v1

Download PDF

Research Article

The therapeutic antischizophrenic activity of prodigiosin and selenium co-supplementation against amphetamine hydrochloride-induced behavioural changes, oxidative, inflammatory, and apoptotic challenges in rats

https://doi.org/10.21203/rs.3.rs-1732868/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Schizophrenia (SCZ), a multifactorial neuropsychiatric disorder, is treated with inefficient antipsychotics and linked to poor treatment outcomes. This study, therefore, investigated the combined administration of prodigiosin (PDG) and selenium (Na₂SeO₃) against SCZ induced by amphetamine (AMPH) in rats. Animals were allocated into four groups corresponding to their respective seven-day treatments: control, AMPH (2 mg/kg), PDG (300 mg/kg) + Na₂SeO₃ (2 mg/kg), and AMPH + PDG + Na₂SeO₃. The model group exhibited biochemical, molecular, and histopathological changes similar to those of the SCZ group. Contrastingly, co-administration of PDG and Na₂SeO₃ significantly increased the time for social interaction and decreased AChE and dopamine. It also downregulated the gene expression of NMDAR1 and restored neurotrophin (BDNF and NGF) levels. Further, PDG combined with Na₂SeO₃ improved the antioxidant defence of the hippocampus by boosting the activities of SOD, CAT, GPx, and GR. These findings were accompanied by an increased GSH, alongside decreased MDA and NO levels. Furthermore, schizophrenic rats having received PDG and Na₂SeO₃ displayed markedly lower IL-1b and TNF-α levels compared to the model group. Interestingly, remarkable declines in the Bax (pro-apoptotic) and increases in Bcl-2 (anti-apoptotic) levels were observed in the SCZ group that received PDG and Na₂SeO₃. The hippocampal histological examination confirmed these changes. Collectively, these findings show that the co-administration of PDG and Na₂SeO₃ may have a promising therapeutic effect for SCZ. This is mediated by mechanisms related to the modulation of cholinergic, dopaminergic, and glutaric neurotransmission and neurotrophic factors, alongside the suppression of oxidative damage, neuroinflammation, and apoptosis machineries.

apoptosis

neuroinflammation

oxidative stress

prodigiosin

schizophrenia

selenium

Schizophrenia (SCZ), a devastating neuropsychiatric disorder, affects around 1% of the world population and interferes with social and mental activities (George et al. 2020, Sun et al. 2020). It emerges in adolescence, usually between 15 and 30 years of age, and worsens with time (Swanepoel et al. 2018). Schizophrenic patients have high mortality rates and a short life expectancy compared to healthy people. This may reflect the increased rate of suicide and high prevalence of somatic diseases (Vidović et al. 2013b). Schizophrenia is characterized by positive symptoms (paranoia and hallucinations), negative symptoms (emotional isolation and reduced social behaviour), and cognitive impairments (learning and memory disorders) (George et al. 2020, Supp et al. 2021).

Cognitive deterioration is considered as a core feature of the disease, starting earlier during the developmental stages and persisting throughout the disease progress; thus, it should be considering in the management of schizophrenic patients (Ahmed et al. 2018). Alterations in brain chemistry may be explained by the pathogenesis of SCZ, particularly as regards to the dopaminergic, glutamatergic, serotonergic, and cholinergic systems (Abd Elkader et al. 2021, George et al. 2020). Former investigations have reported that SCZ is mainly accompanied by glutamate excitotoxicity with consequent dopaminergic hyperfunctioning and decreased gamma-Aminobutyric acid (GABA) levels (George et al. 2020). Furthermore, cholinergic dysfunctions such as reductions in acetylcholine may contribute to cognitive impairment in SCZ (Damazio et al. 2017). Brain-derived neurotrophic factor (BDNF), an abundant neurotrophin in the brain, has been shown to be a critical factor in SCZ pathogenesis; low levels of BDNF were associated with the development of SCZ symptoms (Ahmed et al. 2018, Sun et al. 2020).

There is growing evidence that oxidative stress and neuroinflammation are implicated in the pathophysiology of SCZ (Ahmed et al. 2018, George et al. 2020, Supp et al. 2021). The theory is that elevated levels of reactive oxygen species (ROS) coupled with exhausted antioxidant capacity may underpin the compromised levels of neuroprotection and neural impairment in SCZ (Talukdar et al. 2020). Increased activation of brain microglia and pro-inflammatory cytokine levels in serum were previously reported in clinical and experimental studies of this disease (Beumer et al. 2012, Talukdar et al. 2020). Furthermore, the role of apoptosis in the neuropathology of SCZ had been found to involve both intrinsic (mitochondrial damage) and extrinsic (death receptor) pathways (George et al. 2020, Nakato et al. 2011). Oxidative stress, NMDA dysfunction, glutamate excitotoxicity, decreased BDNF levels, and increased calcium influx can, individually or together, produce a pro-apoptotic environment (Abekawa et al. 2008).

Despite the availability of antipsychotic medications, potential side effects are associated with stiffness, tremors, and gait abnormalities (Hamer &Haddad 2007). Moreover, antipsychotic drugs are not effective in the management of cognitive impairment and negative symptoms scores (Ahmed et al. 2018, Jamilian &Ghaderi 2021). The likely contribution of oxidative stress and inflammation in SCZ has resulted in the advocation for the integration into medical practice of psychotropic herbal medicines, alone or in combination with other therapeutic agents (Al-Brakati et al. 2020, Jamilian &Ghaderi 2021, Li et al. 2021, Swanepoel et al. 2018). Prodigiosin (PDG) is a promising biologically active secondary metabolite produced by actinomycetes, Alteromonas rubra, Serratia rubidaea, and Serratia marcescens, among others (Abdelfattah et al. 2019, Chang et al. 2011). This red pigment has been a subject of research attention because of its vast range of potent activities against tumour growth and metastasis, as well as against bacterial, malarial, and protozoal infections (Abdelfattah et al. 2019, Papireddy et al. 2011). Besides these bioactivities, recent studies have begun to unveil the antioxidant and anti-inflammatory effects of PDG. High free radical scavenging activity and marked inhibition of the bacterial growth were reported in food by the addition of PDG (Arivizhivendhan et al. 2018b). PDG offered noteworthy suppression of free radicals induced by microcystin-LR in HepG2 cells (Chen et al. 2019) and in ischemic brain injury in mice (Chang et al. 2011). Moreover, remarkable anti-inflammatory action was observed after PDG administration against HCl/ethanol-induced gastritis (Abdelfattah et al. 2019) and lipopolysaccharide-mediated inflammation in macrophages (Huh et al. 2007). Abdelfattah et al. (Abdelfattah et al. 2019) reported that PDG counteracted the apoptotic events in gastric mucosa by lowering the expression levels of Bax and caspase-3 and increasing the expression of Bcl-2.

Selenium is a trace element vital to diverse functions of the brain and implicated in motor performance, coordination, memory and cognition, as well as the pathophysiology of brain disorders such as Alzheimer's, epilepsy and Parkinson's diseases (Solovyev 2015, Yuan et al. 2020). Daily selenium supplementation for 12 weeks to patients with SCZ resulted in significant improvement in their cognitive function and some clinical factors, such as appetite and memory (Li et al. 2018). Further, low selenium levels have been detected in serum samples of SCZ patients compared to healthy controls (Cai et al. 2015). Selenium levels are positively correlated with metabolic score, waist circumference, plasma glucose levels, and triglyceride levels in SCZ patients (Vidović et al. 2013a). Selenium administration had been reported to modulate oxidative stress, inflammation parameters, and apoptotic markers in many neurological disorders (Demirci et al. 2017, Zheng et al. 2019).

Considering the lack of literature, to the best of our knowledge, on the neuroprotective potential of PDG against SCZ, and given the variety of biological functions of selenium, we aimed to assess the effect of PDG combined with selenium against amphetamine (AMPH)-induced SCZ-like neural deficits in rats. Moreover, potential mechanisms, including antioxidant, anti-inflammatory and anti-apoptotic activities, were investigated. In addition, we sought to understand whether the modulation of brain neurotransmitters and BDNF are implicated in PDG’s neuroprotective effect.

Animals and chemicals

Amphetamine hydrochloride, Na₂SeO₃, and PDG were purchased from Sigma-Aldrich Chemical Co. (St Louis, Mo, USA). Male Wistar albino rats weighing 180–200 grams and aged 12 weeks old were obtained from the animal facilities of King Fahd Center for Medical Research, King Abdulaziz University, Jeddah, Saudi Arabia. Animals were kept under a controlled environmental condition of alternating 12-h dark-light cycle, 22±3 ºC temperature, and 50±10% relative humidity. Standard diet and water were offered ad libitum. They were acclimatized for one week prior to the start of the experimentation. All experimental protocols were approved by the Committee of Research Ethics for Laboratory Animal Care, Taif University (approval no. 43-221).

Experimental design

Following acclimation, rats were haphazardly divided into four groups (n=10 per group), as follows:

1- Control group: Rats were orally administered with normal saline solution (0.9% NaCl).

2- AMPH group: Rats received amphetamine hydrochloride orally at a dose of 2 mg/kg bwt dissolved in saline solution based on the protocol of Frey et al. (Frey et al. 2006)

3- PDG + Na2SeO3 group: Rats were orally co-administered PDG (300 mg/kg bwt) and sodium selenite (2 mg /kg bwt) according to Abdelfattah et al. (Abdelfattah et al. 2019) and Kędzierska et al. (Kędzierska et al. 2018), respectively.

4- PDG + Na2SeO3 + AMPH group: The rats received PDG and Na2SeO3 orally one hour before the administration of AMPH once every day for seven consecutive days.

Twenty-four hours after the last treatment, all rats were euthanized, and the hippocampal tissue was immediately harvested and washed with isotonic saline. For biochemical evaluations, hippocampal tissue was homogenized in ice-cold 10 mM phosphate buffer (pH 7.4) to produce a 10% (w/v) homogenate. For the evaluation of monoamine and amino acid-based neurotransmitters, hippocampal tissue was homogenized in 75% HPLC grade methanol (10% w/v) and centrifuged for 10 min at 4000 rpm, and the supernatant was subjected to HPLC. The hippocampal tissues were stored at -80 C fixed in 10% neutral buffered formalin for the molecular techniques and histopathological changes.

Behavioural analysis of social interaction

Prior to this test, rats were socially isolated for six hours. The test was performed by placing two animals from different cages, but from the same group, in the open field arena (50 × 25 × 50 cm) for 15 minutes. During this period, the total interaction time remained together (total time of social contacts), converted in seconds (s), was measured manually.

Neurochemical analysis

The hippocampal activity of acetylcholinesterase (AChE) was assessed according to the procedure described by Elman et al. (Ellman et al. 1961). AChE activity was determined based on the yellow colour developed following the addition of thionitrobenzoic acid, measured at 412 nm. HPLC reports and chromatograms were obtained using a specialized data acquisition program (ChemStation). Hippocampal samples were subjected to a solid-phase extraction using a CHROMABOND column (Cat. No. 730031) to remove trace elements and lipids, and the NH₂ phase was retrieved. The NH₂ phase was injected into an AQUA column (150 mm; 5 µm; C18, Phenomenex, USA). After 12 minutes, dopamine (DA) position and concentration in the sample were identified by comparing the resulting chromatogram with that of the corresponding standard (Sigma Chemical Co., St. Louis, MO, USA). According to Pagel et al. (Pagel et al. 2000), the concentration of DA was quantified relative to total brain tissue (µg/g).

Evaluation of brain Neurotrophic factors

BDNF and nerve growth factor (NGF) were assessed using enzyme-linked immunosorbent assay (ELISA) kits sourced from Abcam (catalogue numbers: ab213899) and Elabscience (catalogue numbers: E-EL-R0652), respectively, following the manufacturer's recommendations.

Antioxidant enzymatic activities

Hippocampal superoxide dismutase (SOD) activity was determined at 480 nm using the technique described by Misra and Fridovich (Misra &Fridovich 1972). Catalase (CAT) activity was estimated according to the method described by Aebi (Aebi 1984). The hippocampal activity of glutathione reductase (GR) was quantified as described by Factor et al. (Factor et al. 1998). Glutathione peroxidase (GPx) was assessed according to the procedures mentioned by Paglia and Valentine (Paglia &Valentine 1967).

Oxidative stress indices

Malondialdehyde (MDA) was assessed to reflect the level of lipid peroxidation using the thiobarbituric acid method described by Ohkawa et al. (Ohkawa et al. 1979). Dye formation following the addition of Griess reagent was measured at 540 nm to assess the nitric oxide (NO) level in the hippocampus, as previously described (Green et al. 1982). In addition, reduced glutathione (GSH) levels were estimated using Ellman’s reagent, and the yellow chromogen was estimated at 412 nm, as previously described (Ellman 1959).

Neuroinflammatory markers

To determine hippocampal levels of different pro-inflammatory mediators, commercial ELISA kits were utilized for interleukin (IL)-1β and tumour necrosis factor (TNF)-α (Novus Biologicals, Centennial, CO, USA; catalogue numbers: NBP1-92702 and NBP1-92681, respectively), according to the manufacturer’s instructions.

Apoptotic-related proteins

Hippocampal apoptotic proteins were assayed using ELISA kits for Bax and Bcl-2 (BioVision, Inc.; catalog numbers E4513 and CSB-E08854r, correspondingly) following the manufacturer’s instructions.

RNA extraction and real-time polymerase chain reaction (PCR) analysis

The RNeasy Plus Mini-kit extracted total RNA from hippocampal tissue (Qiagen, Valencia, CA, USA). A cDNA synthesis kit was used to synthesize first-stranded cDNA (Bio-Rad, CA), then amplified in three technical replicates using Power SYBR Green (Life Technologies, CA, USA) and measured using an Applied Biosystems 7500 instrument. The polymerase chain reaction (PCR) conditions were 95 °C for 4 min, followed by 40 cycles of 94°C for 60 s and 55°C for 60 s, and a final extension at 72°C for 10 min. After amplification, cycle numbers at the linear amplification threshold (Ct) for the reference gene β-actin were determined for each sample, and relative gene expression was determined using the comparative Ct method (Pfaffl 2001). The Primer-Blast program provided by the National Center for Biotechnology Information (NCBI) was used to design PCR primers for NMDAR1 and β-actin, which were then synthesized by Jena BioscienceGmbH (Jena, Germany) (Table 1).

Histopathological assessment

Hippocampal tissues from the control and treated groups were fixed in 10% neutral buffered formalin, dehydrated, and paraffinized at room temperature for 24 hours. After that, the blocks were sectioned into 4–5-µm thick sections and stained with haematoxylin and eosin for light microscopy analysis.

Statistical analysis

Data are expressed as the mean ± standard deviation (SD). Measurements were examined by one-way analysis of variance (ANOVA), followed by a Duncan’s post hoc test, using the statistical package SPSS version 23.0. P-values <0.05 were considered statistically significant.

Effect of the PDG and Na₂SeO₃ combined administration on the social behaviour of schizophrenic rats

As shown in Fig. 1, a significant decline (P < 0.05) was observed in the interaction time in the AMPH-treated animals compared with the control animals. In contrast, administration of PDG combined with Na₂SeO₃ restored their social interaction, as reflected in a notable increase (P < 0.05) in the interaction time toward the control values compared to AMPH-treated rats.

Effect of the PDG and Na₂SeO₃ combined administration on neurotrophin levels in the hippocampus of schizophrenic rats

Fig. 2 illustrates the levels of neurotrophins determined in schizophrenic rats treated with Na2SeO3 and PDG. With regard to the control rats, noteworthy reductions (P < 0.05) were observed in BDNF and NGF levels in the hippocampal region of the group treated with AMPH. In contrast, pre-treatment of rats with PDG and selenium notably augmented (P < 0.05) the decreased levels of both tested neurotrophins related to the model group. These results revealed that the combined therapy with PDG and Na₂SeO₃may help improve neural functions via restoring the hippocampal neurotrophins in AMPH-treated rats.

Effect of the PDG and Na₂SeO₃ combined administration on the dopaminergic, glutamatergic, and cholinergic neurotransmitters in the hippocampus of schizophrenic rats

Noteworthy increases (P < 0.05) were found in the level of DA and the activity of AChE in the hippocampus of the AMPH-treated group related to the control one. In addition, marked upregulation was observed in the gene expression level of NMDAR1 in the hippocampal region of the SCZ group as compared to the untreated controls. In contrast, PDG and selenium co-administration to SCZ group markedly reinstated (P < 0.05) DA levels, the activity of AChE, and the expression level of NMDAR1 in the hippocampus region. These findings suggested that concomitant administration of PDG and Na2SeO3 improved the altered levels of neurotransmitters which are implicated in the pathophysiology of SCZ (Fig. 3).

Effect of the PDG and Na₂SeO₃ combined administration on the oxidant/antioxidant status of the hippocampus of schizophrenic rats

As firmly incorporated in the pathogenesis of SCZ, antioxidant status was assessed in the hippocampal area of the model and treated rats. Regarding the activities of hippocampal antioxidant enzymes (Fig. 4), notable decreases (P < 0.05) in the antioxidant enzymatic activities of SOD, CAT, GPx, and GR in the AMPH‐treated group compared with the sham group. Conversely, pre-treated rats with PDG and selenium evoked significant enhancement of the enzymatic activities of all tested enzymes compared to those in the model group.

Moreover, levels of oxidative injury biomarkers were detected in the hippocampus of AMPH-treated rats (Fig. 5). Notably, the levels MDA and NO displayed significant increases (P > 0.05), and the levels of GSH showed marked decreases in the AMPH-treated group. However, PDG and selenium in combination increased GSH levels and lessened NO and MDA levels compared to the SCZ group. In sum, PDG combined with selenium abolished AMPH-dependent oxidative stress via boosting the antioxidant defence against deleterious free radicals in the hippocampus of SCZ rats.

Effect of the PDG and Na₂SeO₃ combined administration on the neuroinflammatory status of the hippocampus of schizophrenic rats

Fig. 6 represents the influence of daily administered PDG together with Na₂SeO₃ on the pro-inflammatory cytokines in the hippocampus of SCZ and treated groups. Significant increases (P < 0.05) were detected in the levels of IL-1β and TNF-α following AMPH treatment compared with the sham rats. Interestingly, the opposite occurred in the hippocampus in the group treated with PDG and selenium simultaneously, as reflected in the significantly lower levels (P < 0.05) of these pro-inflammatory cytokines as compared to the SCZ group. This suggests the potency of concurrent PDG and selenium administration as an anti‐inflammatory therapeutic agent in SCZ management.

Effect of the PDG and Na₂SeO₃ combined administration on apoptotic events in the hippocampus of schizophrenic rats

A remarkable pro-apoptotic response was observed in the hippocampus of rats treated with AMPH that was evidenced by the significant increases (P < 0.05) in Bax (pro-apoptotic protein) levels and decreases (P < 0.05) in Bcl2 (anti-apoptotic protein) compared to the corresponding control group. Meanwhile, our results implied that administration of both PDG and selenium effectively halted the apoptotic evidence in hippocampi of SCZ group by decreasing levels of Bax and increasing levels of Bcl2 compared with their corresponding values in the model group (Fig. 7).

Effect of the PDG and Na₂SeO₃ combined administration on hippocampal histopathological alterations in schizophrenic rats

Histological alterations in the hippocampal region in all treated groups were assessed to better understand the neuroprotective potential of selenium and PDG on SCZ-related brain injury. Sections of hippocampi from the control (Figure 8-A) and PDG + Na₂SeO₃ (Figure 8-C) groups revealed a normal neural cell structure, and the nuclei were prominent and clear. However, the hippocampi of the model group showed progressive neuronal loss associated with atrophy in the surviving neurons and the neurocytes had hyperchromatic nuclei (Figure 8-B). Co-administration of selenium and PDG resulted in a marked improvement in hippocampal histology (Figure 8-D).

Disorders in social interaction that result in the difficulty of animals to communicate socially with other animals of the same species is a core clinical sign characterizing variable neuropsychiatric conditions, including SCZ (Abd Elkader et al. 2021). In order to evaluate the antipsychotic-like activity of co-administered PDG and selenium, we performed a social interaction test. Social isolation corresponds to the negative symptoms of SCZ that appear very frequently at the beginning of the disease. Consistently with former studies (El-Sayed El-Sisi et al. 2016, Swanepoel et al. 2018, You et al. 2020), AMPH-treated rats displayed a significant decrease in the time of social interaction as compared to the control rats. However, groups that received selenium and PDG showed considerable improvements in social behaviour and increases in social interaction compared to the AMPH-treated group. Previous studies have demonstrated that treatment with selenium or PDG significantly ameliorated rats' social, memory, and cognitive deficits-associated behaviours (Bortolatto et al. 2013, Chang et al. 2011, Leirós et al. 2015). Given the ineffectiveness of current antipsychotics in treating the negative symptoms, these findings suggest that combined selenium and PDG are effective agents against SCZ. The negative symptoms represent the primary reason for the disability in schizophrenic patients, which resemble the signs of depression (Zugno et al. 2016). Therefore, selenium and PDG may counteract SCZ via their antidepressant effect.

Accumulating evidence has pointed to a tight association between SCZ-like behaviours and altered expression levels of neurotrophic proteins, such as BDNF or NGF, in the brain (Ben-Azu et al. 2018). Our results revealed that AMPH induced notable decreases in the levels of BDNF and NGF in the rat hippocampus. BDNF is involved in neuronal survival and plasticity and maintains dopaminergic neurons (Turkmen et al. 2021). Intraperitoneal administration of AMPH to rats for eight days was reported to lessen the level of BDNF in the occipital cortex and hypothalamus (Angelucci et al. 2007). Deficiency in hippocampal BDNF levels was documented in different models of SCZ (Ahmed et al. 2018). Consistent with previous studies (Abd Elkader et al. 2021, Angelucci et al. 2007), our data showed marked decreases in DA levels, indicating AMPH-induced neurotoxic action on dopaminergic neurons by decreasing BDNF synthesis. NGF is produced in the hippocampus and cortex and has an atrophic action on cholinergic neurons, which is crucial for memory function (Angelucci et al. 2007). Lower NGF levels were reported in experimental models and schizophrenic patients (Angelucci et al. 2007, Turkmen et al. 2021). Consistent with previous research (Bencherif et al. 2012, Damazio et al. 2017), we observed notable declines in NGF and increases in AchE activities in SCZ rats. Lowered trophic support of NGF in cholinergic neurons contributed strongly to AMPH-mediated hippocampal damage and impaired memory performance (Angelucci et al. 2007). The cognitive dysfunction in schizophrenic patients is related to the altered cholinergic system, such as reduced cerebral acetylcholine levels (Bencherif et al. 2012). Consequently, it is possible that the decline in NGF synthesis in the hippocampus, with subsequent dysfunction of cholinergic neurons, may exacerbate AMPH-induced neurotoxicity.

In contrast, we found that administration of PDG and selenium to AMPH-treated rats resulted in increases in the hippocampal levels of BDNF and NGF, alongside decreases in the AChE and DA. This indicated that the cholinergic and dopaminergic systems were improved in the hippocampus of treated SCZ rats. Selenium supplementation has clearly reinstated levels of brain dopamine and its derivatives induced by AMPH in both in vitro and in vivo studies (Imam &Ali 2000, Imam et al. 1999). Previous researchers found normalized AChE activity in the cortex and hippocampus following organoselenium compound treatment in rat models of neurotoxicity (Pinton et al. 2013, Sreekala &Indira 2009). Moreover, marked in vitro acetylcholinesterase inhibitory action of purified PDG was reported by Nguyen et al. (Nguyen et al. 2020). Studies demonstrated that selenium was also influential in restoring hippocampal BDNF levels in cortical tissues in rodents exposed to monosodium glutamate and methylmercury (Glaser et al. 2013, Rosa et al. 2016). Thus, in this study, the co-administration of PDG and selenium to diseased rats remarkably improved SCZ-related neural disorders by normalizing the disturbed levels of neurotransmitters and neurotrophins in the rat hippocampus.

Moreover, the neuroprotective effect of PDG combined with selenium on cognitive dysfunction in AMPH-induced schizophrenic rats may be mediated by the downregulation of NDMAR1 gene expression in the hippocampus. Our results demonstrated downregulated NMDAR1 expression levels in the hippocampus following AMPH treatment, similar to the results of a former study (Zhou et al. 2020). Furthermore, the post-mortem assessment of different cortex areas in schizophrenic patients revealed notable upregulation of the NMDAR1 gene (Dracheva et al. 2001). Supplementation of selenomethionine completely abolished the upregulated NMDA expression in rat neurons in Alzheimer disease model (Zhang et al. 2021). Therefore, the downregulation in NMDAR1 gene expression is helpful to significantly reverse glutamate efflux alongside a marked improvement in behavioural and cognitive effects.

A growing body of evidence shows that cellular redox disturbances are implicated in the pathophysiology and neuro-progression of SCZ (Ahmed et al. 2018, Górny et al. 2020, Swanepoel et al. 2018). In the current study, significant suppressions were observed in the antioxidant enzymatic activities of SOD, CAT, GPx, and GR, alongside decreased GSH levels, indicating oxidative stress induction by AMPH. The hyperdopaminergic state in SCZ was reported to induce oxidative stress by lowering GSH levels (Grima et al. 2003). Additionally, it has been assumed that the NMDA receptor's hypofunction may result in the overstimulation of other ionotropic receptors, triggering a cascade of excitotoxic events, including oxidative stress and apoptosis (Bitanihirwe &Woo 2011). We also detected high MDA and NO levels in the AMPH-treated group, which is consistent with the results of former studies (Ahmed et al. 2018, Camacho-Abrego et al. 2021, Swanepoel et al. 2018). Increased plasma lipid peroxidation levels were noticed in SCZ patients to be correlated with specific clinical symptoms (Gama et al. 2008).

Adjunctive treatment with antioxidants improves symptoms in animal models and patients with schizophrenia (Supp et al. 2021, Swanepoel et al. 2018). Arivizhivendhan et al. (Arivizhivendhan et al. 2018a) had reported robust free radical-scavenging activity for PDG. Further, pre-treatment with PDG attenuated the brain oxidative injury induced by middle cerebral artery occlusion/reperfusion in mice (Chang et al. 2011). PDG exerted noteworthy antioxidant activities in both in vitro and in vivo experimental models (Abdelfattah et al. 2019, Chen et al. 2019). In addition, co-supplementation with probiotics and selenium to patients with chronic SCZ for 12 weeks resulted in significant increases in total antioxidant capacity and total GSH (Jamilian &Ghaderi 2021). Selenium counteracted the oxidative injury by enhancing antioxidant enzymatic activities in experimental models of dementia, epilepsy, and Alzheimer’s (Demirci et al. 2017, Lakshmi et al. 2015, Yuan et al. 2020). In this study, pre-treatment with PDGs notably restored the antioxidant capacity of cells by boosting the activities of SOD, CAT, GR, and GPx, alongside reducing the levels of MDA and NO in hippocampal tissue. This suggests that combined therapy with selenium and PDG may offer beneficial effects against SCZ-mediated neurotoxicity through their antioxidant activities.

Emerging evidence has pointed to the notable increases in the pro-inflammatory interleukins levels during the progress of SCZ; these increases were closely related to exacerbating the behavioural disorders such as cognitive deficits and social withdrawal (Supp et al. 2021). Pro-inflammatory cytokines are implicated in neurodevelopmental disorders' brain developmental processes and pathogenic mechanisms (Yuan et al. 2020). Consistent with previous studies (Ahmed et al. 2018, Swanepoel et al. 2018, You et al. 2020), rats in the model group displayed a significant increase in hippocampal levels of IL-1β and TNF-α. Furthermore, increased pro-inflammatory markers are reported in the brains of patients with schizophrenia (Fillman et al. 2013). Increased levels of TNF-α activate nuclear factor-kappa B (NF-κB), in turn triggering the release of pro-inflammatory cytokines such as IL-1β. These events may stimulate the overproduction of free radicals and peroxidation of lipids, activate microglial cells, and exacerbate neuroexcitatory effects (Ahmed et al. 2018).

In contrast, the group treated with PDG and selenium had lower pro-inflammatory cytokines (TNF-α and IL-1β) in the hippocampus in relation to the model group. Liposomal prodigiosin was able to reduce the expression of IL-1 and IL-6 in microglial cells (Rashidi &Jebali 2019). PDG treatment decreased the nuclear translocation of NF-κB in brain hypoxia induced by middle cerebral artery ligation (Chang et al. 2011). Similar anti-inflammatory effects were previously reported for PDG (Abdelfattah et al. 2019, Huh et al. 2007). Selenium induced marked declines in plasma and brain TNF-α, IL-1β, and IL-4 levels of aged rats with scopolamine-induced dementia (Demirci et al. 2017). Moreover, selenium prevented the interferon-gamma-mediated production of cytokines (TNF-α, IL-1β, and IL-6) in microglia (Akyuva et al. 2021). Consequently, the effect induced by PDG and selenium may contribute to the inhibition of the hippocampal inflammation associated with AMPH treatment.

Alongside its direct deleterious effect, AMPH can induce apoptosis in the hippocampus, which consists of a key process in the pathogenesis of SCZ (Nakato et al. 2011). METH-induced hippocampal apoptosis associated with increased Bax levels and decreased Bcl-2 levels has been confirmed by this study’s histopathological findings. This apoptotic effect may result from oxidants, reactive oxygen, NO radicals, and activated NMDA receptors triggered by excess glutamate and DA released by METH (Abekawa et al. 2008, Nakato et al. 2011). In contrast, PDG and selenium markedly inhibited hippocampal apoptosis in the SCZ group by decreasing the levels of Bax and increasing the levels of Bcl2. PDG treatment resulted in marked decreases in Bax and caspase-3 levels and increases in Bcl-2 levels in gastric mucosa, remarkably lessening gastric ulceration in rats (Abdelfattah et al. 2019). Co-treatment with selenium and vitamin E decreased the levels of apoptotic biomarkers (active caspase-3 and procaspase-9) in the brain of aged rats with dementia (Demirci et al. 2017). An in vitro study confirmed that selenium reduced the apoptotic damage in microglia cells by decreasing the levels of caspase-3 and caspase-9 in interferon-gamma-treated cells (Akyuva et al. 2021). Therefore, the blockade of apoptosis in the rat hippocampus might support the neuroprotective effects of co-administered selenium and PDG in a rat model of SCZ.

In summary, this study offers reflective insights into the distinct therapeutic benefits of PDG and selenium co-supplementation to SCZ rats. The antischizophrenic activity of both protective agents may be endorsed to enhance cholinergic and dopaminergic neurotransmission and decrease NMDAR1 expression in the hippocampus. Moreover, both protective agents increased the levels of neurotrophic factors, resulting in marked improvements in the social behaviour of diseased rats. Simultaneous treatment with selenium and PDG attenuates oxidative stress, inflammation, and apoptotic activities induced by AMPH in the hippocampus. Thus, these results confirm that combined selenium and PDG is a new therapeutic strategy in managing SCZ, highlighting further evidence in support of this.

Author contributions

Khalaf F Alsharif, Ashraf Albrakati, Naif E. Al omairi and Abdulraheem S. Almalki, Abdulhakeem S. Alamri and Ahmad Agil: Conceptualization, Methodology. Walaa Alsanie, Zakaria Y. Abd Elmageed, Ola A. Habotta, and Ahmed E. Abdel Moneim: Data curation, Writing- Original draft preparation. Ahmed E. Abdel Moneim: Visualization, Investigation. Maha S. Lokman, Hussam A. Althagafi, Abdullah A. A. Alghamdi, Ahmed E. Abdel Moneim and Hussain Alyami: Resources, Validation. Saied K. Belal, Ghaliah Alnefaie, Mohamed M. Abdel-Daim and Rami B. Kassab and Alaa Jameel A. Albarakati: Writing- Reviewing and Editing.

Data Availability

The collected data in this study are available from the corresponding author on reasonable request.

Funding

The authors extend their appreciation to the Deputyship for Research and Innovation, Ministry of Education in Saudi Arabia, for funding this research work through project number [135-1441-1].

Ethics approval

All experimental protocols, including the use of animals, were approved by the Committee of Research Ethics for Laboratory Animal Care, Taif University (approval no. HAO-08-T-105).

Consent to participate

Not applicable.

Consent for publication

Consented.

Conflict of interest

The author declares no competing interest.

Abd Elkader H-TAE, Abdou HM, Khamiss OA, Essawy AE (2021) Anti-anxiety and antidepressant-like effects of astragaloside IV and saponins extracted from Astragalus spinosus against the bisphenol A-induced motor and cognitive impairments in a postnatal rat model of schizophrenia. Environmental Science and Pollution Research, pp 1–17
Abdelfattah MS, Elmallah MI, Ebrahim HY, Almeer RS, Eltanany RM, Abdel Moneim AE (2019) : Prodigiosins from a marine sponge-associated actinomycete attenuate HCl/ethanol-induced gastric lesion via antioxidant and anti-inflammatory mechanisms.PLOS ONE14, e0216737
Abekawa T, Ito K, Nakagawa S, Nakato Y, Koyama T (2008) Olanzapine and risperidone block a high dose of methamphetamine-induced schizophrenia-like behavioral abnormalities and accompanied apoptosis in the medial prefrontal cortex. Schizophr Res 101:84–94
Aebi H (1984) Catalase in vitro. Methods Enzymol 105:121–126
Ahmed HI, Abdel-Sattar SA, Zaky HS (2018) Vinpocetine halts ketamine-induced schizophrenia-like deficits in rats: Impact on BDNF and GSK-3β/β-catenin pathway. Naunyn Schmiedebergs Arch Pharmacol 391:1327–1338
Akyuva Y, Nazıroğlu M, Yıldızhan K (2021) Selenium prevents interferon-gamma induced activation of TRPM2 channel and inhibits inflammation, mitochondrial oxidative stress, and apoptosis in microglia. Metab Brain Dis 36:285–298
Al-Brakati A, Albarakati AJA, Daabo HM, Baty RS, Salem FEH, Habotta OA, Elmahallawy EK, Abdel-Mohsen DM, Taha H, Akabawy AM (2020) Neuromodulatory effects of green coffee bean extract against brain damage in male albino rats with experimentally induced diabetes. Metab Brain Dis 35:1175–1187
Angelucci F, Gruber SH, El Khoury A, Tonali PA, Mathé AA (2007) Chronic amphetamine treatment reduces NGF and BDNF in the rat brain. Eur Neuropsychopharmacol 17:756–762
Arivizhivendhan K, Mahesh M, Boopathy R, Swarnalatha S, Mary RR, Sekaran G (2018a) Antioxidant and antimicrobial activity of bioactive prodigiosin produces from Serratia marcescens using agricultural waste as a substrate. J Food Sci Technol 55:2661–2670
Arivizhivendhan KV, Mahesh M, Boopathy R, Swarnalatha S, Regina Mary R, Sekaran G (2018b) Antioxidant and antimicrobial activity of bioactive prodigiosin produces from Serratia marcescens using agricultural waste as a substrate. J Food Sci Technol 55:2661–2670
Ben-Azu B, Aderibigbe AO, Ajayi AM, Eneni AO, Umukoro S, Iwalewa EO (2018) Involvement of GABAergic, BDNF and Nox-2 mechanisms in the prevention and reversal of ketamine-induced schizophrenia-like behavior by morin in mice. Brain Res Bull 139:292–306
Bencherif M, Stachowiak MK, Kucinski AJ, Lippiello PM (2012) Alpha7 nicotinic cholinergic neuromodulation may reconcile multiple neurotransmitter hypotheses of schizophrenia. Med Hypotheses 78:594–600
Beumer W, Drexhage RC, De Wit H, Versnel MA, Drexhage HA, Cohen D (2012) Increased level of serum cytokines, chemokines and adipokines in patients with schizophrenia is associated with disease and metabolic syndrome. Psychoneuroendocrinology 37:1901–1911
Bitanihirwe BK, Woo T-UW (2011) Oxidative stress in schizophrenia: an integrated approach. Neurosci Biobehavioral Reviews 35:878–893
Bortolatto CF, Guerra Souza AC, Wilhelm EA, Nogueira CW (2013) : Acute treatment with bis selenide, an organic compound containing the trace element selenium, prevents memory deficits induced by reserpine in rats. Biological trace element research 151, 92 – 9
Cai L, Chen T, Yang J, Zhou K, Yan X, Chen W, Sun L, Li L, Qin S, Wang P, Yang P, Cui D, Burmeister M, He L, Jia W, Wan C (2015) Serum trace element differences between Schizophrenia patients and controls in the Han Chinese population. Sci Rep 5:15013
Camacho-Abrego I, González-Cano SI, Aguilar-Alonso P, Brambila E, de la Cruz F, Flores G (2021) Changes in nitric oxide, zinc and metallothionein levels in limbic regions at pre-pubertal and post-pubertal ages presented in an animal model of schizophrenia. J Chem Neuroanat 111:101889
Chang C-C, Wang Y-H, Chern C-M, Liou K-T, Hou Y-C, Peng Y-T, Shen Y-C (2011) Prodigiosin inhibits gp91phox and iNOS expression to protect mice against the oxidative/nitrosative brain injury induced by hypoxia–ischemia. Toxicol Appl Pharmcol 257:137–147
Chen J, Li Y, Liu F, Hou D-X, Xu J, Zhao X, Yang F, Feng X (2019) Prodigiosin promotes Nrf2 activation to inhibit oxidative stress induced by microcystin-LR in HepG2 cells. Toxins 11:403
Damazio LS, Silveira FR, Canever L, CASTRO AA, Estrela JM, Budni J, Zugno AI (2017) The preventive effects of ascorbic acid supplementation on locomotor and acetylcholinesterase activity in an animal model of schizophrenia induced by ketamine. Anais da Academia Brasileira de Ciências 89:1133–1141
Demirci K, Nazıroğlu M, Övey İS, Balaban H (2017) Selenium attenuates apoptosis, inflammation and oxidative stress in the blood and brain of aged rats with scopolamine-induced dementia. Metab Brain Dis 32:321–329
Dracheva S, Marras SA, Elhakem SL, Kramer FR, Davis KL, Haroutunian V (2001) N-methyl-D-aspartic acid receptor expression in the dorsolateral prefrontal cortex of elderly patients with schizophrenia. Am J Psychiatry 158:1400–1410
El-Sayed El-Sisi A, Sokkar SS, El-Sayed El-Sayad M, Sayed Ramadan E, Osman EY (2016) : Celecoxib and omega-3 fatty acids alone and in combination with risperidone affect the behavior and brain biochemistry in amphetamine-induced model of schizophrenia. Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie 82, 425 – 31
Ellman GL (1959) : Tissue sulfhydryl groups. Arch Biochem Biophys 82, 70 – 7
Ellman GL, Courtney KD, Andres V Jr, Featherstone RM (1961) A new and rapid colorimetric determination of acetylcholinesterase activity. Biochem Pharmacol 7:88–95
Factor VM, Kiss A, Woitach JT, Wirth PJ, Thorgeirsson SS (1998) Disruption of redox homeostasis in the transforming growth factor-α/c-myc transgenic mouse model of accelerated hepatocarcinogenesis. J Biol Chem 273:15846–15853
Fillman S, Cloonan N, Catts V, Miller L, Wong J, McCrossin T, Cairns M, Weickert CS (2013) Increased inflammatory markers identified in the dorsolateral prefrontal cortex of individuals with schizophrenia. Mol Psychiatry 18:206–214
Frey BN, Valvassori SS, Réus GZ, Martins MR, Petronilho FC, Bardini K, Dal-Pizzol F, Kapczinski F, Quevedo J (2006) Changes in antioxidant defense enzymes after d-amphetamine exposure: implications as an animal model of mania. Neurochem Res 31:699–703
Gama CS, Salvador M, Andreazza AC, Lobato MI, Berk M, Kapczinski F, Belmonte-de-Abreu PS (2008) Elevated serum thiobarbituric acid reactive substances in clinically symptomatic schizophrenic males. Neurosci Lett 433:270–273
George MY, Menze ET, Esmat A, Tadros MG, El-Demerdash E (2020) Potential therapeutic antipsychotic effects of Naringin against ketamine-induced deficits in rats: involvement of Akt/GSK-3β and Wnt/β-catenin signaling pathways. Life Sci 249:117535
Glaser V, Moritz B, Schmitz A, Dafré AL, Nazari EM, Müller YMR, Feksa L, Straliottoa MR, de Bem AF, Farina M (2013) Protective effects of diphenyl diselenide in a mouse model of brain toxicity. Chemico-Biol Interact 206:18–26
Górny M, Bilska-Wilkosz A, Iciek M, Hereta M, Kamińska K, Kamińska A, Chwatko G, Rogóż Z, Lorenc-Koci E (2020) Alterations in the Antioxidant Enzyme Activities in the Neurodevelopmental Rat Model of Schizophrenia Induced by Glutathione Deficiency during Early Postnatal Life. Antioxidants 9:538
Green LC, Wagner DA, Glogowski J, Skipper PL, Wishnok JS, Tannenbaum SR (1982) Analysis of nitrate, nitrite, and [15N]nitrate in biological fluids. Anal Biochem 126:131–138
Grima G, Benz B, Parpura V, Cuénod M, Do KQ (2003) Dopamine-induced oxidative stress in neurons with glutathione deficit: implication for schizophrenia. Schizophr Res 62:213–224
Hamer S, Haddad PM (2007) Adverse effects of antipsychotics as outcome measures. Br J Psychiatry 191:s64–s70
Huh J-E, Yim J-H, Lee H-K, Moon E-Y, Rhee D-K, Pyo S (2007) Prodigiosin isolated from Hahella chejuensis suppresses lipopolysaccharide-induced NO production by inhibiting p38 MAPK, JNK and NF-κB activation in murine peritoneal macrophages. Int Immunopharmacol 7:1825–1833
Imam SZ, Newport GD, Islam F, Slikker W Jr, Ali SF (1999) Selenium, an antioxidant, protects against methamphetamine-induced dopaminergic neurotoxicity. Brain Res 818:575–578
Imam SZ, Ali SF (2000) Selenium, an antioxidant, attenuates methamphetamine-induced dopaminergic toxicity and peroxynitrite generation. Brain Res 855:186–191
Jamilian H, Ghaderi A (2021) The Effects of Probiotic and Selenium Co-supplementation on Clinical and Metabolic Scales in Chronic Schizophrenia: a Randomized, Double-blind, Placebo-Controlled Trial. Biol Trace Elem Res 199:4430–4438
Kędzierska E, Dąbkowska L, Obierzyński P, Polakowska M, Poleszak E, Wlaź P, Szewczyk K, Kotlińska J (2018) Synergistic Action of Sodium Selenite with some Antidepressants and Diazepam in Mice. Pharmaceutics 10:270
Lakshmi BV, Sudhakar M, Prakash KS (2015) Protective effect of selenium against aluminum chloride-induced Alzheimer's disease: behavioral and biochemical alterations in rats. Biol Trace Elem Res 165:67–74
Leirós M, Alonso E, Rateb ME, Ebel R, Jaspars M, Alfonso A, Botana LM (2015) The Streptomyces metabolite anhydroexfoliamycin ameliorates hallmarks of Alzheimer's disease in vitro and in vivo. Neuroscience 305:26–35
Li Z, Liu Y, Li X, Ju W, Wu G, Yang X, Fu X, Gao X (2018) Association of Elements with Schizophrenia and Intervention of Selenium Supplements. Biol Trace Elem Res 183:16–21
Li Z, Liu Y, Wang F, Gao Z, Elhefny MA, Habotta OA, Abdel Moneim AE, Kassab RB (2021) Neuroprotective effects of protocatechuic acid on sodium arsenate induced toxicity in mice: Role of oxidative stress, inflammation, and apoptosis. Chemico-Biol Interact 337:109392
Misra HP, Fridovich I (1972) The role of superoxide anion in the autoxidation of epinephrine and a simple assay for superoxide dismutase. J Biol Chem 247:3170–3175
Nakato Y, Abekawa T, Ito K, Inoue T, Koyama T (2011) Lamotrigine blocks apoptosis induced by repeated administration of high-dose methamphetamine in the medial prefrontal cortex of rats. Neurosci Lett 490:161–164
Nguyen VB, Nguyen DN, Wang S-L (2020) Microbial reclamation of chitin and protein-containing marine by-products for the production of prodigiosin and the evaluation of its bioactivities. Polymers 12:1328
Ohkawa H, Ohishi N, Yagi K (1979) Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal Biochem 95:351–358
Pagel P, Blome J, Wolf HU (2000) High-performance liquid chromatographic separation and measurement of various biogenic compounds possibly involved in the pathomechanism of Parkinson's disease. J Chromatogr B Biomed Sci Appl 746:297–304
Paglia DE, Valentine WN (1967) : Studies on the quantitative and qualitative characterization of erythrocyte glutathione peroxidase. The Journal of laboratory and clinical medicine 70, 158 – 69
Papireddy K, Smilkstein M, Kelly JX, Shweta, Salem SM, Alhamadsheh M, Haynes SW, Challis GL, Reynolds KA (2011) : Antimalarial activity of natural and synthetic prodiginines. Journal of medicinal chemistry 54, 5296 – 306
Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res 29:e45–e45
Pinton S, Brüning CA, Sartori Oliveira CE, Prigol M, Nogueira CW (2013) Therapeutic effect of organoselenium dietary supplementation in a sporadic dementia of Alzheimer's type model in rats. J Nutr Biochem 24:311–317
Rashidi M, Jebali A (2019) Liposomal prodigiosin and plasmid encoding serial GCA nucleotides reduce inflammation in microglial and astrocyte cells by ATM/ATR signaling. J Neuroimmunol 326:75–78
Rosa SG, Quines CB, Stangherlin EC, Nogueira CW (2016) Diphenyl diselenide ameliorates monosodium glutamate induced anxiety-like behavior in rats by modulating hippocampal BDNF-Akt pathway and uptake of GABA and serotonin neurotransmitters. Physiol Behav 155:1–8
Solovyev ND (2015) Importance of selenium and selenoprotein for brain function: From antioxidant protection to neuronal signalling. J Inorg Biochem 153:1–12
Sreekala S, Indira M (2009) Impact of co administration of selenium and quinolinic acid in the rat's brain. Brain Res 1281:101–107
Sun X-j, Zhao X, Xie J-n, Wan H (2020) Crocin alleviates schizophrenia-like symptoms in rats by upregulating silent information regulator-1 and brain derived neurotrophic factor. Compr Psychiatr 103:152209
Supp AD, Avila S Jr, Mastella GA, Damasio L, de Oliveira IH, Godoi AK, Michels A, Schuck PF, Zugno AI (2021) Ascorbic acid supplementation attenuates schizophrenia-like symptoms in an animal model induced by ketamine. Int J Dev Neurosci 81:26–36
Swanepoel T, Möller M, Harvey BH (2018) N-acetyl cysteine reverses bio-behavioural changes induced by prenatal inflammation, adolescent methamphetamine exposure and combined challenges. Psychopharmacology 235:351–368
Talukdar PM, Abdul F, Maes M, Binu VS, Venkatasubramanian G, Kutty BM, Debnath M (2020) Maternal Immune Activation Causes Schizophrenia-like Behaviors in the Offspring through Activation of Immune-Inflammatory, Oxidative and Apoptotic Pathways, and Lowered Antioxidant Defenses and Neuroprotection. Mol Neurobiol 57:4345–4361
Turkmen BA, Yazici E, Erdogan DG, Suda MA, Yazici AB (2021) BDNF, GDNF, NGF and Klotho levels and neurocognitive functions in acute term of schizophrenia. BMC Psychiatry 21:1–12
Vidović B, Dorđević B, Milovanović S, Škrivanj S, Pavlović Z, Stefanović A, Kotur-Stevuljević J (2013a) : Selenium, zinc, and copper plasma levels in patients with schizophrenia: relationship with metabolic risk factors. Biological trace element research 156, 22 – 8
Vidović B, Đorđević B, Milovanović S, Škrivanj S, Pavlović Z, Stefanović A, Kotur-Stevuljević J (2013b) Selenium, zinc, and copper plasma levels in patients with schizophrenia: relationship with metabolic risk factors. Biol Trace Elem Res 156:22–28
You M-J, Bang M, Park H-S, Yang B, Jang KB, Yoo J, Hwang D-Y, Kim M, Kim B, Lee S-H, Kwon M-S (2020) Human umbilical cord-derived mesenchymal stem cells alleviate schizophrenia-relevant behaviors in amphetamine-sensitized mice by inhibiting neuroinflammation. Transl Psychiatry 10:123–123
Yuan X, Fu Z, Ji P, Guo L, Al-Ghamdy AO, Alkandiri A, Habotta OA, Moneim AEA, Kassab RB (2020) Selenium nanoparticles pre-treatment reverse behavioral, oxidative damage, neuronal loss and neurochemical alterations in pentylenetetrazole-induced epileptic seizures in mice. Int J Nanomed 15:6339
Zhang ZH, Chen C, Jia SZ, Cao XC, Liu M, Tian J, Hoffmann PR, Xu HX, Ni JZ, Song GL (2021) Selenium Restores Synaptic Deficits by Modulating NMDA Receptors and Selenoprotein K in an Alzheimer's Disease Model. Antioxid Redox Signal 35:863–884
Zheng R, Zhang ZH, Zhao YX, Chen C, Jia SZ, Cao XC, Shen LM, Ni JZ, Song GL (2019) : Transcriptomic Insights into the Response of the Olfactory Bulb to Selenium Treatment in a Mouse Model of Alzheimer's Disease. International journal of molecular sciences 20
Zhou X, Cai G, Mao S, Xu D, Xu X, Zhang R, Yao Z (2020) Modulating NMDA receptors to treat MK-801-induced schizophrenic cognition deficit: effects of clozapine combining with PQQ treatment and possible mechanisms of action. BMC Psychiatry 20:1–10
Zugno AI, Canever L, Heylmann AS, Wessler PG, Steckert A, Mastella GA, de Oliveira MB, Damázio LS, Pacheco FD, Calixto OP (2016) Effect of folic acid on oxidative stress and behavioral changes in the animal model of schizophrenia induced by ketamine. J Psychiatr Res 81:23–35

Table 1: Primer sequences of genes analysed in real time polymerase chain reaction

Name	Accession number	Forward primer (5'-3')	Reverse primer (5'-3')
NMDAR1	NM_001270602.1	GTCCAGCGTCTGGTTTGAGA	TCCGCGCTTGTTGTCATAGG
β-actin	NM_031144.3	GTCCACCCGCGAGTACAAC	GGATGCCTCTCTTGCTCTGG

Download PDF

Editorial decision: Major Revision
04 Jul, 2022
Reviewers agreed at journal
20 Jun, 2022
Reviewers invited by journal
20 Jun, 2022
Editor invited by journal
20 Jun, 2022
Editor assigned by journal
16 Jun, 2022
First submitted to journal
06 Jun, 2022

You are reading this latest preprint version

The therapeutic antischizophrenic activity of prodigiosin and selenium co-supplementation against amphetamine hydrochloride-induced behavioural changes, oxidative, inflammatory, and apoptotic challenges in rats

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Conclusion

Declarations

References

Tables

Status:

Version 1