Floralozone plays a role in heart failure treatment by down-regulating Vascular Endothelial Growth Factor Receptor 1 Expression

doi:10.21203/rs.3.rs-1737362/v1

Download PDF

Research Article

Floralozone plays a role in heart failure treatment by down-regulating Vascular Endothelial Growth Factor Receptor 1 Expression

https://doi.org/10.21203/rs.3.rs-1737362/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Floralozone (FL) is medicine with the refreshing aroma of rabbit's ear grass, which can be used to prevent the progression of atherosclerosis and reduces endothelial dysfunction. Vascular endothelial growth factor receptor 1 (VEGFR1) is one of the receptors of vascular endothelial factor (VEGF), which mainly plays a negative role in cardiovascular system regulation mainly by acting as a decoy receptor in endothelial cells. Therefore, the purpose of this study is to evaluate whether FL can down-regulate VEGFR1 expression in treating diabetes-induced heart failure (HF).

Methods

We used high-sugar and high-fat diet and tail vein injection of streptozotocin (STZ) to establish the rat model of HF. After intragastric administration of FL, the left ventricular function, pathological changes, oxidative stress condition in HF rats were assessed by echocardiography, oxidative stress monitoring, hematoxylin-eosin histological staining, argyrophilic staining, Masson staining, lichen red staining. The expression of VEGFR1 in the myocardial tissue of HF rats was detected by immunohistochemistry, immunofluorescence, western blot and RT-PCR analysis

Results

The HF model was established successfully. Through intragastric administration of FL, it was observed the cardiac function of HF rats was significantly improved, ventricular remodeling level was reversed, and the ability of antioxidant stress was enhanced. These therapeutic effects were closely connected with the down-regulation of VEGFR1 expression. ZM306416 is an antagonist of VEGFR1, which can up-regulate VEGFR1 expression and inhibit the protective effect of FL in rats with HF.

Conclusions

These results suggest that FL can play a salutary role in HF rats by down-regulating VEGFR1 expression, inhibiting ventricular remodeling and reducing oxidative stress.

heart failure

floralozone

vascular endothelial growth factor receptor 1

ventricular remodeling

aromatherapy

As a combination therapy for atherosclerosis, FL has not been reported for heart failure. Our study shows that FL may play a beneficial role in HF rats by inhibiting ventricular remodeling and reducing oxidative stress. This protective phenomenon was mediated at least in part by the inhibition of VEGFR1-mediated signaling pathways. This is the first study to investigate the role of VEGFR1 in HF pathogenesis and the target of FL against HF.

Heart failure (HF) is a pathological state of myocardial changes [1] and systolic and diastolic dysfunction [2] caused by various pathogenic reasons. It is the last stage of various cardiovascular diseases such as hyperlipemia [3], hypertension [4], myocardial infarction [5], and aortic stenosis [6]. In patients with diabetes, the endothelial dysfunction caused by hyperglycemia, the changes of hormone production and release, and the metabolic changes of smooth muscle cells, which lead to the injury of arterioles and microvessels, promote diabetic cardiomyopathy development, and finally lead to HF [7]. The molecular cytological basis of the occurrence and development of HF is ventricular remodeling, and its main pathological manifestations are cardiomyocyte disorder and myocardial interstitial fibrosis [8], increased oxidative stress will also aggravate ventricular remodeling [9]. There are many drugs for treating HF, such as angiotensin converting enzyme inhibitors, angiotensin receptor inhibitors and aldosterone receptor antagonists, which can improve the symptoms of HF and reduce the risks of hospitalization to death [10]. However, the incidence and long-term survival rate of HF have proved difficult to control effectively, and poor quality of life. Therefore, it is necessary to develop new therapeutic drugs to treat HF.

The biological function of vascular endothelial growth factor (VEGF) family includes induction of angiogenesis and angiogenesis, vascular permeability, nerve growth, inflammation, hematopoiesis and lymphangiogenesis [11]. Actin and development of HF, no matter what the etiology is, angiogenesis dysfunction is the main problem of advanced HF. VEGF is the basic cytokine involved in neovascularization. Many preclinical and clinical studies have obtained valuable information about the potential effectiveness of targeting vascular endothelial growth factor as a treatment choice for HF [12, 13]. Interestingly, regulating the number of VEGF specific receptors in cardiomyocytes can feedback the biologic activity of VEGF. Vascular endothelial growth factor receptor 1 (VEGFR1) is one of the specific membrane-binding receptor tyrosine kinases (RTKS) in the VEGF family. VEGFR1 interacts with vascular endothelial growth factor A (VEGFA), vascular endothelial growth factor B (VEGFB) and placental growth factor (PLGF) to promote angiogenesis by coordinating endothelial proteases and growth factors [13]. Interestingly it also forms a solvable bait receptor for VEGF without initiating signal transduction [14]. Also, VEGFR1 is not only a negative regulator of chelating of VEGF through its ligand binding domain, but also a positive regulator because of its mild tyrosine kinase signal transduction [15]. When VEGFR1 expression is up-regulated, the binding ability of VEGF to VEGFR1 is enhanced, which limits the angiogenic effect of VEGF and reduces the protective effect on the heart.

Aromatherapy is commonly used adjuvant therapy, which can stimulate the limbic system of the brain by sniffing. It widely uses in cancer and palliative treatment. It has analgesic, anticonvulsant and antianxiety effects to improve the quality of life and relieve psychological pain [16].The prognosis of patients with HF is poor, but there are few reports of aromatherapy in HF treatment. The chemical name of Floralozone (FL) essential oil is 3-(4-Ethylphenyl)-2 midimethylpropanal, it is a mixture of ortho-, para- and eccentric isomers, with fresh rabdosia fragrance, ozone and sea breeze, and is often used as daily spices to improve freshness. Previous studies have found that FL, as one of the combined drugs for treating atherosclerosis (patent number: CN106822067A), can effectively reduce the injury of arterial endothelial cells and decrease the area of atherosclerotic plaque in atherosclerotic rats. At the same time, coronary atherosclerosis can lead to HF due to hypoxia caused by cardiac ischemia and vascular stenosis [17]. Therefore, it is speculated that FL may treat HF and explore the role of VEGFR1 in HF treatment by FL.

The purpose of this study was to study the effect of FL in the treatment of HF in rats. ZM306416 (a specific inhibitor of VEGFR, acting on VEGFR1) [18] was also studied to prove that FL may delay HF by down-regulating VEGFR1 expression, reversing ventricular remodeling and improving the ability of antioxidant stress.

Materials

FL (≥ 97% purity) was provided by Yuke (Beijing, China). Streptozotocin (STZ) was acquired from Sigma Chemical Company, St. Louis, Missouri. ZM306416 (≥ 98% purity) was provided by Shanghai Ruihui Pharmaceutical Technology Co., Ltd(Shanghai, China). Primary antibodies were anti-vascular growth factor receptor 1 (VEGFR1) was obtained from Santa Cruz Biotechnology Company.

Animals and experimental designs

Male Sprague-Dawley rats (200-300g) were obtained from the Laboratory Animal Center, Zhengzhou University (Zhengzhou, China). All animals received humane care by the National Institutes of Health Guide for the Care and Use of Laboratory Animals (8th edition, 2011). The study protocol on the Ethics of Animal was approved by the Zhengzhou University Veterinary Medicine Animal Care and Use Committee.

The rats were maintained under a 12-hour light / 12-hour dark cycle at 25°C. After one week of adaptative feeding, the animals were randomly divided into 6 groups: (a) the control group, (b) the HF group, (c) the FL (150mg/kg/d) group, (d) the ZM 306416 (0.1mg/kg/d) group, (e) the HF + FL (150mg/kg/d) group, (f) the HF + FL (150mg/kg/d) + ZM 306416 (0.1mg/kg/d) group.

FL and ZM306416 were dissolved in ethanol and given by intragastric administration. The animals in the the control group had a normal diet, the the model group and the treatment group were fed with high-sugar and high-fat diet (sucrose: lard: conventional diet = 20:20:60) for 4 weeks, fasted for 20 hours, and injected streptozotocin into the tail vein for 30 mg/kg. STZ was dissolved in sodium citrate saline buffer (pH = 4.5) and injected immediately within a few minutes to avoid degradation. It can establish the animal model of HF rats. During the administration period, the general condition and mortality of rats were recorded. From the 4th week, the heart was imaged by echocardiography once a week, and measurement of ejection fractin (EF) and stroke volume (SV) in rats. The average values of indexes were measured 3 times, and the standard of HF model was that EF decreased by 30% − 40% compared with the normal reference value. After that, the drug was provided for 4 weeks.

Echocardiography

We assessed the heart function in all groups at two time points (before treatment, at each time point after treatment) by echocardiography. Instrument: Vevo 770 High Resolution Ultrasonic Imaging system for small Animals. The parasternal left ventricular long axis and left ventricular short axis sections were taken respectively, and the M-mode echocardiography guided by two-dimensional long-axis images was obtained from the anterior and posterior walls of the left ventricle at the papillary muscle level. The global function of the left ventricle and the systolic, diastolic velocity, strain and strain rate of each ventricular wall were analyzed and compared. Finally, the EF and SV were calculated (VisualSonics, Toronto, Ontario, Canada).

Levels of B-type brain natriuretic peptide (BNP), malondialdehyde (MDA) and superoxide dismutase (SOD) in the serum of rats

After anesthesia, the abdomen of rats was quickly dissected. The abdominal organs of rats were bluntly separated, 5 ml of blood was collected from the abdominal aorta in a 10 ml syringe and placed in a biochemical tube. The blood was naturally coagulated for 20 minutes under natural conditions and centrifuged for 20 minutes for 25 minutes at 4℃(3000r/min). The supernatant was taken and stored at -80℃. Using the commercial kit purchased by Nanjing Jiancheng Biological Company, the activities of malondialdehyde (MDA) and superoxide dismutase (SOD) in B-type brain natriuretic peptide (BNP) were determined according to the recommended method.

Pathomorphological observations

After taking blood from animals under anesthesia, the heart was removed, the capsule and blood vessels were cut off, and part of the myocardium was cut up and down perpendicular to the long axisymmetric midpoint of the left ventricle, and fixed in 4% paraformaldehyde solution. After dehydration, transparency, wax immersion, embedding and paraffin section (5µm), then hematoxylin-eosin histological staining, argyrophilic staining, Masson staining, lichen red staining, and under optical microscope observation (magnification, X400; CX21BIM-SET5, Olympus, Tokyo, Japan).

Immunohistochemical analysis

The paraffin tissue sections of the heart (7µm) were dewaxed and hydrated with PBS (pH = 7.4, Beyotime Institute of Biotechnology) solution for three times, and the citrate buffer (pH = 6.0) of 0.01 mol/L was repaired at 90 degrees Celsius for 20 minutes each time. The sections were incubated with 3% hydrogen peroxide (Beyotime Institute of Biotechnology) and buffered with phosphate PBS washed, sealed at room temperature for 30 minutes in normal goat serum (Beyotime Institute of Biotechnology), dripped with VEGFR1 polyclonal primary antibody diluent of VEGFR1 (1: 200,Santa Cruz, CA), overnight at 4°C, washed with PBS, dripped with horseradish peroxidase labeled goat anti-rabbit IgG secondary antibody diluent, incubated at room temperature for 40 minutes, washed with PBS, stained with chromogenic reagent (Beyotime Institute of Biotechnology), Mayer hematoxylin re-staining nucleus, gradient alcohol dehydration and drying, xylene transparent, neutral gum sealed film, observed under microscope and photographed.

Immunofluorescence analysis

As mentioned earlier19,20, paraffin tissue sections of the heart (7µm) were dewaxed and hydrated, and then blocked with 5% normal serum (Beyotime Institute of Biotechnology). The slices were subsequently incubated with specific VEGFR1 antibodies. Then the sections were incubated with fluorescent secondary antibody for 30 minutes. 3,3’- Diaminobenzidine or avidin fluorescent D (Vector Laboratories, Burlingame, CA) was utilized to visualize positive immunoreactivity. Staining of VEGFR1 is carried out in a kit provided by Vector laboratory according to the scheme provided by the company and observed on SLM510 laser scanning confocal microscope (Carl Zeiss Meditec, Inc., Jena, Germany).

Protein extractins and Western blotting analysis

The heart tissue was homogenized. The precooled cell lysate was added, and the protein samples were collected. The protein concentration was determined by using Bicinchonininc acid (BCA) protein detection kit (Semel Fisher Technology Co, Ltd). 10% SDS-PAGE protein was added to the collected protein samples, and the protein was retained in boiling water for 5 minutes to fully denature the protein. After cooling to room temperature, each swimming lane was 60 µg proteins. Add sample hole to SDS-PAGE gel, SDS-PAGE electrophoresis solution, add VEGFR1 polyclonal antibody diluent of LRV 200 to transfer membrane, incubate overnight at 4 degrees Celsius, wash membrane with TBST for 3 times, then add 1000 horseradish peroxidase to label goat anti-rabbit IgG second antibody diluent, put it at room temperature for 2 hours, and use optical density analysis software to deal with and analyze.

RNA extractins and RT-PCR analysis

According to the standard procedure, RNA is extracted from myocardial tissue. Using RT Revert aid first strand cDNA synthesis kit (Thermo Fisher Scientific, Inc.,Waltham, MA, USA), total RNA was extracted to synthesize complementary deoxyribonucleic acid (cDNA). After reverse transcription, PCR is performed according to the instructions of the Invitrogen kit (Invitrogen, Carlsbad, CA, USA). Determine band grayscale value using the ImageJ software (X version of; Media Cyber diagnostic netics, Silver Springs, Maryland, USA). The primer sequence is shown in the figure (Table.1).

Statistical analysis

The results are presented as the mean ± SEM. The comparisons were performed using GraphPad Prism software (version 6; GraphPad Software, Inc) with unpaired Student's t-test and the one-way ANOVA followed by the Tukey's post hoc test. P < 0.05 was considered to indicate a statistically significant difference.

FL can improve cardiac function and relieve HF in rats

Cardiac function of rats was observed by echocardiography. Compared with the control group, the EF and SV in the HF group were significantly lower than those, while those in the HF + FL group were significantly higher than those in the HF group (P < 0.05). There was no significant difference in the EF and SV between the HF + FL + ZM 306416 group and the HF group (Fig. 1A, B). To confirm further the role of FL in HF rats, the serum BNP was determined. The serum BNP in the HF group was markedly higher than that in the control group. The serum BNP level in the HF + FL group was significantly lower than that in the HF group (P < 0.05). There was no significant difference in the content of the serum BNP between the HF + FL + ZM 306416 group and the HF group (Fig. 1C). The results showed that FL dramatically improved the state of HF in rats and the observed effect may be related to VEGFR1 expression.

FL can reverse ventricular remodeling and improve cardiac contractility in rats with HF

After dissecting the rats, the morphological changes of myocardial tissue were observed by H&E staining. In the control group, cardiomyocytes were arranged compactly and orderly, muscle fibers were arranged neatly, and there were no breaks and defects. In the HF group, there were varying degrees of inflammatory cell infiltration and interstitial edema, myocardial nuclei and myocardial fibers were disordered, broken and missing, and blank areas appeared. Compared with the HF group, the HF + FL group improved these structural abnormalities, but the therapeutic effect of cardiomyocytes in the HF + FL + ZM 306416 group was not obvious (Fig. 2A). Masson staining was performed to investigate the degree of myocardial fibrosis. In the control group, the myocardial tissue fiber bundles were arranged closely and orderly, there was no obvious collagen fiber proliferation, and the collagen fibers were mainly distributed around the blood vessels. While in the HF group, the collagen fibers proliferated obviously, part of the myocardium was replaced by collagen tissue, and a large area of collagen hyperplasia was observed locally, spreading in the myocardial fiber bundles with a reticulated distribution. In the HF + FL group, the proliferation of collagen fibers was inhibited, the cardiomyocytes were arranged neatly, and the myocardial fibrosis was relieved. There was no significant difference between the HF + FL + ZM306416 group and the HF group, and myocardial fibrosis was not relieved (Fig. 2B). The brown-stained reticular fibers were observed by argyrophilic staining (Fig. 2C), which was similar to the above results. It can be seen that the purplish red elastic fibers were observed by lichen red staining (Fig. 2D). Compared with the control group, the elastic fibers were significantly decreased and seriously broken in the HF group. However, after FL treatment, compared with the HF group, the elastic fibers in the HF + FL group were increased, but there was no significant difference between the HF + FL + ZM306416 group and the HF group. The consequences were identical to those mentioned above. Results suggested that FL could reduce ventricular remodeling and improve cardiac contractility in rats with HF.

FL attenuates oxidative stress in HF rats

Detection of SOD and MDA in serum by kit provided by Nanjing Jiancheng Biological Co, Ltd.. The results showed that the MDA level in the HF group was significantly higher than that in the control group (P < 0.05; Fig. 3B). Compared with the control group, the SOD activity in the HF group was significantly lower than that (P < 0.05; Fig. 3A). After FL treatment, the MDA level was significantly lower and the SOD activity was significantly higher than that (P < 0.05; Fig. 3A, B). After treatment with VEGFR1 inhibitor, the effect of FL was decreased. These results suggest that after treatment with FL, the antioxidant effect of cardiomyocytes was enhanced and the oxidative stress injury in HF was weakened.

FL attenuates myocardial injury in rats with congestive HF by down-regulating VEGFR1 expression

To identify the mechanism of FL in treating HF, We detected VEGFR1 protein expression and gene expression. VEGFR1 protein expression and gene expression in the HF group was significantly higher than these in the control group (P < 0.05). The protein expression and gene expression of VEGFR1 in the HF + FL group was significantly lower than that in the HF group (P < 0.05). While that in the HF + FL + ZM306416 group was similar to that in the control group (Fig. 4B, C). These results were confirmed by immunohistochemical staining (Fig. 4A) and immunofluorescence staining (Fig. 5). All the above results suggested that FL attenuates myocardial injury in rats with HF by down-regulating VEGFR1 expression.

In Western societies, the use of aromatic plants for medical and health problems has a long history. The medicinal properties of aromatic plants are partly attributed to essential oils. According to widely published reports and recommendations from private practitioners, essential oils are useful for most diseases, such as Alzheimer's disease, cancer, sleep disorders and pregnancy pain [19, 20]. This study expands the new application of aromatherapy in HF treatment. FL has a fresh aroma and has a good effect on the prevention and treatment of coronary atherosclerosis. After treatment with FL, we found that the symptoms of HF induced by high-sugar and high-fat diet and STZ injection were significantly alleviated, the effect of ventricular remodeling was reversed, and the mechanism was closely related to the down-regulation of VEGFR1 expression. As far as we know, this is the first study to report that aromatherapy can be used to treat HF.

In the adult heart, EF drops to 30%-40% and BNP upregulation were used as a marker of HF, while BNP is a marker of HF, because it is secreted in response to cardiac wall tension [21]. In our study, the expression of factors induced by high-sugar and high-fat diet + STZ indicated that the HF model was successfully established. In the HF + FL group, BNP was down-regulated, EF and SV were significantly increased, which show that FL can improve the cardiac function of HF rats. The basic pathological of HF is ventricular remodeling, which is mainly characterized by disordered arrangement of cardiomyocytes and significant increase of myocardial fibrosis in cardiac morphology [22]. A number of previous studies have confirmed that reducing collagen deposition can reverse myocardial fibrosis and improve cardiac function. For example, dipeptidyl peptidase 4 inhibitor can down-regulate collagen expression, reverse the myocardial fibrosis induced by obesity, and increase EF significantly, which has a therapeutic effect [23]. In this study, after treatment of HF with FL, the expression of collagen and reticular fibers decreased, collagen deposition decreased, and myocardial fibrosis was reversed. It is also confirmed that the elastic fibers increase to improve the contractile force of the ventricular wall and improve effectively the systolic and diastolic function of the heart after FL treatment of HF [24]. Oxidative stress plays an important role in the occurrence and development of HF. ROS activates endogenous mitochondrial apoptosis pathway. They also stimulate the proliferation of cardiac fibroblasts and activate matrix metalloproteinases, leading to extracellular matrix remodeling [25]. Li Bo et al [26] confirmed that reducing oxidative stress can reverse cardiac hypertrophy and mediate the autophagy of cardiomyocytes to change HF. MDA and SOD are widely used in many studies to indicate oxidative stress level [27]. In this study, FL treatment was followed by down-regulation of MDA and up-regulation of SOD, increasing the ability of antioxidant stress to further treat HF.

Vascular endothelial growth factor receptor family (VEGFRs) consists of three subtypes (VEGFR1, VEGFR2, VEGFR3), which bind to VEGF and participate in many biological reactins. However, unique biological functions of different subtypes in vivo still have controversy. VEGFR1 and VEGFR2 combine VEGFA competitively, VEGFR1 is also the specific binding receptor of VEGFB and PLGF. VEGFA participates in strong angiogenic function, and its expression is low in normal cardiomyocytes, up-regulated in pathological conditions, but down-regulated with the passage of time [28]. VEGFR1 is a negative regulator of VEGFA. Under pathological conditions, VEGFR1 is positively regulated by hypoxia [29] and inhibits cardiac angiogenesis. At the same time, the binding level of VEGFR1 and PLGF increases under pathological conditions. PLGF promotes the growth, migration and survival of endothelial cells, promoting atherosclerosis [30], and further damages blood vessels. There is increasing evidence that VEGFR1 plays an important role in ventricular remodeling and oxidative stress [31, 32]. In the treatment of bleomycin-induced pulmonary fibrosis, down-regulation of VEGFR1 can reverse the level of pulmonary fibrosis [33]. It has also been reported that silencing PLGF gene expression can also reverse liver fibrosis [34]. The upregulation of VEGFR1 increases vascular permeability and accumulates a large amount of material, which can activate the extracellular matrix process, induce cardiac secretion and promote collagen synthesis [35, 36]. In this study, the current results show that the expression of VEGFR1 is up-regulated in the model group and down-regulated in the FL treatment group, but in the FL + ZM306416 treatment group, VEGFR1 expression is up-regulated, FL can't reverse that and have a therapeutic effect. Therefore, FL can reverse ventricular remodeling at least in part by the inhibition of VEGFR1 signal transduction. Moreover, VEGFR1 expression is also involved in regulating oxidative stress level. Many experiments have shown that the excessive production of ROS can also up-regulate VEGFR1 expression [32]. After the use of FL, oxidative stress can be reduced and the VEGFR1 expression can be further down-regulated. Therefore, down-regulation of VEGFR1 expression is beneficial to antioxidant stress [37]. In this experiment, VEGFR1 expression increased, MDA level increased and SOD activity decreased in the ZM306416 control group, evidenced by increased oxidative stress level, but after FL treatment, VEGFR1 expression decreased and the ability of antioxidant stress increased, indicating that FL may partially down-regulate VEGFR1 expression and play a role in antioxidant stress. However, in the FL + ZM306416 treatment group, the SOD activity has been enhanced, which requires follow-up studies.

VEGFR1 interacts with many factors and has complex biological functions. Therefore, in order to show that VEGFR1 may be the target of FL against HF, we used VEGFR1 receptor inhibitor as positive control, which interacted with VEGFR1 to inhibit the signal transduction of VEGF pathway. FL treatment of ZM306416 treated HF rats could not down-regulate VEGFR1 expression. It can be observed that FL can treat HF by down-regulating VEGFR1. However, it not knows why ZM306416 treatment up-regulated the expression of VEGFR1. It is speculated that the up-regulation of VEGFR1 may lead to the weakening of the binding level of VEGF and VEGFR2 and inhibit the biological effect of VEGF.

This study showed that the treatment with FL decreased VEGFR1 expression in HF rats, which inhibited cardiomyocyte disorder and collagen fiber deposition, which further alleviated oxidative stress injury in rats. These findings suggest that FL has a potential therapeutic effect on HF by inhibiting VEGFR1 signal transduction pathway. However, it is not clear that the optimal dose of FL in the treatment of HF and further study is needed. In addition, up-regulation of VEGFR1 expression also plays an important part in tumor angiogenesis, and down-regulation of VEGFR1 expression is a hot research direction in tumors treatment. FL can treat HF by down-regulating VEGFR1 expression. Therefore, extending FL therapy to the tumor could be an attempt.

Floralozone

VEGFR1

Vascular endothelial growth factor receptor 1

VEGF

vascular endothelial factor

heart failure

STZ

streptozotocin

RTKS

receptor tyrosine kinases

VEGFA

vascular endothelial growth factor A

VEGFB

vascular endothelial growth factor B

PLGF

placental growth factor

ejection fractin

stroke volume

MDA

malondialdehyde

SOD

superoxide dismutase

BNP

brain natriuretic peptide

BCA

bicinchonininc acid

cDNA

complementary deoxyribonucleic acid

VEGFRs

Vascular endothelial growth factor receptor family

H&E

hematoxylin and eosin

q-PCR

quantitative polymerase chain reactin.

Authorship Contributions

Participated in research design: Ya-ling Yin, Peng Li, Mo-li Zhu

Conducted experiments and the study: Ya-ling Yin, Zi-tian Li, Yu-tian Fu

Performed data analysis: Yu-tian Fu, Wei-Zhen Liu, Rui-Zhu Yue, Ya-qi Guo, Hong-yan Hou, Hua-dong Que

Wrote or contributed to the writing of the manuscript: Peng Li, Mo-li Zhu, Ya-ling Yin, Ya-qi Guo

Funding

This work was supported by National Natural Science Foundation of China (U1804197, 81874312), and Research Foundation of Henan Province (202300410308, 2018GGJS102, 18HASTIT047, ZD2020006, 219906, 212102311046), and Research Foundation of Xinxiang Medical University (XYBSKYZZ505319, XYBSKYZZ201626, XYBSKYZZ202202, KYCX2020-38, YJSCX202123Z, YJSCX202160Y, xyxskyz202140).

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Ethics Approval and Consent to Participate

All applicable international, national, and/or institutional guidelines for the care and use of animals were followed. This article does not contain any studies with human participants performed by any of the authors.

Consent for Publication

All authors approved its publication.

Conflict of intereststatement

The authors declare that they have no conflict of interest.

Mast TP, James CA, Calkins H, Teske AJ, Tichnell C, Murray B, et al. Evaluation of Structural Progression in Arrhythmogenic Right Ventricular Dysplasia/Cardiomyopathy. JAMA Cardiol. 2017;2(3):293–302.
Maurer MS, Packer M. How Should Physicians Assess Myocardial Contraction?: Redefining Heart Failure With a Preserved Ejection Fraction. JACC Cardiovasc Imaging. 2020;13(3):873–8.
Pownall HJ, Gotto AM Jr. Lipids and Cardiovascular Disease: Putting It All Together. Methodist Debakey Cardiovasc J. 2019;15(1):5–8.
Messerli FH, Rimoldi SF, Bangalore S. The Transition From Hypertension to Heart Failure: Contemporary Update. JACC Heart Fail. 2017;5(8):543–51.
Sulo G, Igland J, Nygård O, Vollset SE, Ebbing M, Cerqueira C, et al. Trends in the risk of early and late-onset heart failure as an adverse outcome of acute myocardial infarction: A Cardiovascular Disease in Norway project. Eur J Prev Cardiol. 2017;24(9):971–80.
Pibarot P, Messika-Zeitoun D, Ben-Yehuda O, Hahn RT, Burwash IG, Van Mieghem NM, et al. Moderate Aortic Stenosis and Heart Failure With Reduced Ejection Fraction: Can Imaging Guide Us to Therapy? JACC Cardiovasc Imaging. 2019;12(1):172–84.
Huang CC, Weng SF, Tsai KT, Chen PJ, Lin HJ, Wang JJ, et al. Long-term Mortality Risk After Hyperglycemic Crisis Episodes in Geriatric Patients With Diabetes: A National Population-Based Cohort Study. Diabetes Care. 2015;38(5):746–51.
Bing R, Cavalcante JL, Everett RJ, Clavel MA, Newby DE, Dweck MR. Imaging and Impact of Myocardial Fibrosis in Aortic Stenosis. JACC Cardiovasc Imaging. 2019;12(2):283–96.
Chen Y, Chen C, Dong B, Xing F, Huang H, Yao F, et al. AMPK attenuates ventricular remodeling and dysfunction following aortic banding in mice via the Sirt3/Oxidative stress pathway. Eur J Pharmacol. 2017;814335–42.
Tamargo J, Caballero R, Delpón E. New drugs in preclinical and early stage clinical development in the treatment of heart failure. Expert Opin Investig Drugs. 2019;28(1):51–71.
Simons M, Gordon E, Claesson-Welsh L. Mechanisms and regulation of endothelial VEGF receptor signalling. Nat Rev Mol Cell Biol. 2016;17(10):611–25.
Taimeh Z, Loughran J, Birks EJ, Bolli R. Vascular endothelial growth factor in heart failure. Nat Rev Cardiol. 2013;10(9):519–30.
Cao Y. Positive and negative modulation of angiogenesis by VEGFR1 ligands. Sci Signal. 2009;2(59):re1.
Wu FT, Stefanini MO, Mac Gabhann F, Kontos CD, Annex BH, Popel AS. A systems biology perspective on sVEGFR1: its biological function, pathogenic role and therapeutic use. J Cell Mol Med. 2010;14(3):528–52.
Shibuya M. Differential roles of vascular endothelial growth factor receptor-1 and receptor-2 in angiogenesis. J Biochem Mol Biol. 2006;39(5):469–78.
Fellowes D, Barnes K, Wilkinson S. Aromatherapy and massage for symptom relief in patients with cancer. Cochrane Database Syst Rev. 2004(2):Cd002287.
Bakhshi H, Varadarajan V, Ambale-Venkatesh B, Meyghani Z, Ostovaneh MR, Durda P, et al. Association of soluble interleukin-2 receptor α and tumour necrosis factor receptor 1 with heart failure: The Multi-Ethnic Study of Atherosclerosis. ESC Heart Fail. 2020;7(2):639–44.
Hennequin LF, Thomas AP, Johnstone C, Stokes ES, Plé PA, Lohmann JJ, et al. Design and structure-activity relationship of a new class of potent VEGF receptor tyrosine kinase inhibitors. J Med Chem. 1999;42(26):5369–89.
Esposito ER, Bystrek MV, Klein JS. An elective course in aromatherapy science. Am J Pharm Educ. 2014;78(4):79.
Lewis DD, Tan C. Aroma-triggered pain relief. Nat Biomed Eng. 2018;2(2):58–9.
Rørth R, Jhund PS, Yilmaz MB, Kristensen SL, Welsh P, Desai AS, et al. Comparison of BNP and NT-proBNP in Patients With Heart Failure and Reduced Ejection Fraction. Circ Heart Fail. 2020;13(2):e006541.
Puntmann VO, Arroyo Ucar E, Hinojar Baydes R, Ngah NB, Kuo YS, Dabir D, et al. Aortic stiffness and interstitial myocardial fibrosis by native T1 are independently associated with left ventricular remodeling in patients with dilated cardiomyopathy. Hypertension. 2014;64(4):762–8.
Hong SK, Choo EH, Ihm SH, Chang K, Seung KB. Dipeptidyl peptidase 4 inhibitor attenuates obesity-induced myocardial fibrosis by inhibiting transforming growth factor-βl and Smad2/3 pathways in high-fat diet-induced obesity rat model. Metabolism. 2017;7642–55.
Bollache E, Guzzardi DG, Sattari S, Olsen KE, Di Martino ES, Malaisrie SC, et al. Aortic valve-mediated wall shear stress is heterogeneous and predicts regional aortic elastic fiber thinning in bicuspid aortic valve-associated aortopathy. J Thorac Cardiovasc Surg. 2018;156(6):2112-20.e2.
Kiyuna LA, Albuquerque RPE, Chen CH, Mochly-Rosen D, Ferreira JCB. Targeting mitochondrial dysfunction and oxidative stress in heart failure: Challenges and opportunities. Free Radic Biol Med. 2018;129155–68.
Li B, Chi RF, Qin FZ, Guo XF. Distinct changes of myocyte autophagy during myocardial hypertrophy and heart failure: association with oxidative stress. Exp Physiol. 2016;101(8):1050–63.
Ghorbanzadeh V, Mohammadi M, Mohaddes G, Dariushnejad H, Chodari L, Mohammadi S. Protective effect of crocin and voluntary exercise against oxidative stress in the heart of high-fat diet-induced type 2 diabetic rats. Physiol Int. 2016;103(4):459–68.
Pfau D, Thorn SL, Zhang J, Mikush N, Renaud JM, Klein R, et al. Angiotensin Receptor Neprilysin Inhibitor Attenuates Myocardial Remodeling and Improves Infarct Perfusion in Experimental Heart Failure. Sci Rep. 2019;9(1):5791.
Ulyatt C, Walker J, Ponnambalam S. Hypoxia differentially regulates VEGFR1 and VEGFR2 levels and alters intracellular signaling and cell migration in endothelial cells. Biochem Biophys Res Commun. 2011;404(3):774–9.
Roncal C, Buysschaert I, Gerdes N, Georgiadou M, Ovchinnikova O, Fischer C, et al. Short-term delivery of anti-PlGF antibody delays progression of atherosclerotic plaques to vulnerable lesions. Cardiovasc Res. 2010;86(1):29–36.
Liu H, Zhao M, Yang S, Gong DR, Chen DZ, Du DY. (2R,3S)-Pinobanksin-3-cinnamate improves cognition and reduces oxidative stress in rats with vascular dementia. J Nat Med. 2015;69(3):358–65.
Kusmartsev S, Eruslanov E, Kübler H, Tseng T, Sakai Y, Su Z, et al. Oxidative stress regulates expression of VEGFR1 in myeloid cells: link to tumor-induced immune suppression in renal cell carcinoma. J Immunol. 2008;181(1):346–53.
Amano H, Mastui Y, Ito Y, Shibata Y, Betto T, Eshima K, et al. The role of vascular endothelial growth factor receptor 1 tyrosine kinase signaling in bleomycin-induced pulmonary fibrosis. Biomed Pharmacother. 2019;117109067.
Li X, Jin Q, Yao Q, Zhou Y, Zou Y, Li Z, et al. Placental Growth Factor Contributes to Liver Inflammation, Angiogenesis, Fibrosis in Mice by Promoting Hepatic Macrophage Recruitment and Activation. Front Immunol. 2017;8801.
Wu MH, Ying NW, Hong TM, Chiang WF, Lin YT, Chen YL. Galectin-1 induces vascular permeability through the neuropilin-1/vascular endothelial growth factor receptor-1 complex. Angiogenesis. 2014;17(4):839–49.
Buczek-Thomas JA, Rich CB, Nugent MA. Hypoxia Induced Heparan Sulfate Primes the Extracellular Matrix for Endothelial Cell Recruitment by Facilitating VEGF-Fibronectin Interactions. Int J Mol Sci. 2019;20(20).
Arjunan P, Lin X, Tang Z, Du Y, Kumar A, Liu L, et al. VEGF-B is a potent antioxidant. Proc Natl Acad Sci U S A. 2018;115(41):10351–6.

Table 1 The primers sequence used in PCR

Gene name	Upstream sequence (5’-3’)	Downstream sequence (5’-3’)
VEGFR1	CTGGTAAAGCAACTAAGAA	GGACAGCCGATGGGACCGTT
β-actin	CACCGCGAGTACAACCTTC	CCCATACCCACCATCACACC

Download PDF

Version 1

posted

You are reading this latest preprint version

Floralozone plays a role in heart failure treatment by down-regulating Vascular Endothelial Growth Factor Receptor 1 Expression

Status:

Version 1

Abstract

Background

Methods

Results

Conclusions

Figures

Significance Statement

Introduction

Materials And Methods

Materials

Animals and experimental designs

Echocardiography

Pathomorphological observations

Immunohistochemical analysis

Immunofluorescence analysis

Protein extractins and Western blotting analysis

RNA extractins and RT-PCR analysis

Statistical analysis

Results

FL can improve cardiac function and relieve HF in rats

FL can reverse ventricular remodeling and improve cardiac contractility in rats with HF

FL attenuates oxidative stress in HF rats

FL attenuates myocardial injury in rats with congestive HF by down-regulating VEGFR1 expression

Discussion

Abbreviations

Declarations

References

Tables

Status:

Version 1