Development of a multiplex PCR assay for simultaneous detection of monopartite and bipartite begomoviruses along with associated satellite DNAs

Abstract

Begomoviral diseases are one of the major factors behind economic losses in agriculturally important crops. Begomoviruses are transmitted by whiteflies (Bemisia tabaci) and are often found to be associated with alphasatellites and betasatellites. Rapid, reliable and early detection methods are invaluable in developing control strategies against these viruses. A multiplex polymerase chain reaction (mPCR) assay was developed for simultaneous detection of monopartite and bipartite begomoviruses along with the associated satellites. Symptomatic leaves of different plant species were used for begomovirus and satellite detection. Primer pairs for each component were designed using reference sequences from GenBank. The primer pairs were designed in such a way that the amplicons differ at least 100bp in size. Amplicons of ~ 185bp, ~ 290bp, ~ 420bp and ~ 685bp were obtained in the mPCR that correspond to betasatellite, DNA-A, alphasatellite and DNA-B respectively. Identities of the viral and satellite components were confirmed by sequencing of the amplicons obtained in mPCR. This mPCR assay can be used for rapid and simultaneous detection of begomovirus genomic components and associated satellites.

1. Introduction

Begomoviruses are the largest as well as the most important genus of the family Geminiviridae. These viruses are mainly transmitted by whiteflies which is a well-known and important agricultural pest worldwide (Varma and Malathi, 2003). Begomoviruses cause huge economical losses to a variety of crops in tropical and subtropical regions of the world. New begomovirus species emerge quite frequently throughout the world as a result of recombination and component exchange between related begomovirus species (Navas-Castillo et al., 2011). Begomoviruses contain circular single-stranded DNA (ssDNA) genomes that are either monopartite (having a single genomic component) or bipartite (with two genomic components named as DNA-A and DNA-B). Each genomic component is approximately 2.7kb in size. Monopartite begomoviruses are frequently found to be associated with alphasatellites and betasatellites. These satellites are circular ssDNA molecules of approximately 1.3kb size, and are dependent on their helper begomoviruses for encapsidation/replication and transmission. Betasatellites have been found to induce typical disease symptoms whereas alphasatellites typically do not contribute towards disease development (Zhou, 2013; Briddon and Stanely, 2006).

In recent years, significant progress has been made in developing virus diagnostic tools with high specificity and sensitivity, and reduced cost and testing time. These objectives can be achieved with simultaneous detection of several viruses in a single PCR assay, known as multiplex PCR or mPCR. PCR is one of the most widely used diagnostic methods for plant viruses. Multiplex PCR relies on the usage of carefully designed primer pairs having similar melting temperatures, annealing with different/multiple targets in a single tube. The use of higher number of primer pairs in mPCR increases the chance of self-annealing, formation of primer dimer and non-specific amplification. But this technique once standardized is quite simple, time saving, sensitive, and efficient for early diagnosis of plant viruses (Brownie et al., 1997).

Several mPCR assays have been developed and optimized by researchers for simultaneous detection of multiple plant viruses (Potter et al., 2003; Aloyce et al., 2013; Kumar et al., 2013; Mnari-Hattab et al., 2014; Chiquito et al., 2017; Lukman et al., 2019). Discovery of begomoviruses associated with satellites demands a sensitive and effective mPCR assay for their simultaneous detection. Therefore, the present study aimed at development of this mPCR assay. The assay will also be very useful in studying the frequency and nature of association between begomoviruses and the satellites.

2. Materials And Methods

2.1 Collection of symptomatic leaf samples and DNA extraction

Leaf samples of chilli (Capsicum annum L.), potato (Solanum tuberosum) and sow thistle (Sonchus arvensis) showing typical begomoviral symptoms (curling and/or mosaic; Fig. 1) were collected from adjoining areas of Jalandhar region of Punjab in Northern India. These plants were selected because the previous reports suggested that there are chances of amplification of all four targets in these samples (Kumar et al., 2011; Jeevalatha et al., 2017; Mubin et al., 2010). Samples were collected in Falcon tubes, put in liquid nitrogen and stored at -80ºC for further use. Total DNA was extracted from the samples using DNeasy® Plant Mini Kit (Qiagen, Germany). Quality of the extracted DNA was assessed by electrophoresing it in 1% agarose gel, and the DNA was stored at -20^◦C.

2.2 Primer designing

Four pairs of primers were designed (Table 1) to simultaneously detect DNA-A, DNA-B, alphasatellite and betasatellite. Complete reference sequences of various distinct species of these components (reported from India) were retrieved from NCBI-GenBank and used for designing the primers. The sequences were aligned using MultAlin software (Corpet, 1988). Conserved regions were analyzed and potential primers were designed keeping in mind the physical properties, internal structures and similar annealing temperatures. OligoCalc (oligonucleotides properties calculator) software (Kibbe, 2007) was used to analyze these properties. Degeneracy was incorporated in the primers wherever required. The primers for mPCR were designed in such a way that the amplicons for each component could differ by at least 100bp, which could be separated easily by electrophoresing them in1% agarose gel. Designed primers were synthesized by Eurofins Genomics India Pvt. Ltd., Bengaluru, India.

2.3 Thermal profiles of simplex PCRs

Simplex PCRs were carried out with the designed component-specific primers in order to optimize the thermal profiles, and to evaluate their specificity. The reactions were carried out in a thermocycler (ThermoFisher Scientific, USA) with a total of 25µl volume containing 2.5µl of total DNA (~ 200ng), 2.5µl of 10X Taq buffer A, 0.5µl of 40mM dNTPs mix, 0.5µl each of 10mM forward and reverse primers, 0.3µl (3U/µl) of Taq DNA Polymerase (Genei, India), and the final volume was makeup with molecular grade water. The parameters used are: initial denaturation at 94ºC for 3 min, followed by 35 cycles of denaturation at 94ºC for 50 sec, annealing from 50ºC to 56ºCfor 30 sec to 1 min, extension at 72ºC for 1 min, and final extension at 72ºC for 7 min. The PCR products were analysed on 1% agarose gel in 1x TAE buffer for 45min at 3V/cm and visualized using EtBr (ethidium bromide) staining. A 100bp DNA ladder (Genei, India) was used as a molecular weight marker.

2.4 Thermal profile of Multiplex PCR

The simplex PCR component-specific primers were used to optimize the mPCR assay. Amplification was carried out in a reaction volume of 50 µl containing: total DNA 5µl (~ 200ng), 10x Taq Buffer A 5µl, 40mM dNTPs mix 1µl, 1µl each of 10mM forward and reverse primers, Taq DNA polymerase 0.6µl (3U/µl), and the final volume was adjusted to 50µl using molecular grade water. Multiplex PCR was performed in a thermocycler (ThermoFisher Scientific, USA) with an initial denaturation step at 94ºC for 3 min, followed by 35 cycles of denaturation at 94ºCfor 50 sec, annealing at 52ºC for 1 min, extension at 72ºC for 1 min, and final extension at 72ºC for 7 min. The PCR products were electrophoresed on 1% agarose gel in 1x TAE buffer for 45min at 3V/cm and visualized using EtBr staining. A 100bp DNA ladder (Genei, India) was used as molecular weight marker.

2.5 Sequencing of the PCR-amplified product

To confirm their identity, the amplicons from selected samples were excised from agarose gel and eluted using QIAquick Gel Extraction Kit (Qiagen, Germany). The eluted DNAs were sequenced by Eurofins Genomics India Pvt. Ltd., Bengaluru, India. The sequences were analysed using BLAST (Altschul et al., 1990) to confirm the specificity of PCR-amplified DNA fragments (data not shown).

3. Results

3.1 Optimization of simplex PCR for each component

The primer pairs MPDNA-AF / MPDNA-AR, MPDNA-BF / MPDNA-BR, MPAlpha-F/ MPAlpha-R and MPBeta-F/ MPBeta-R were designed (Table 1) for amplification of the begomovirus components DNA-A and DNA-B, alphasatellite and betasatellite respectively. Simplex PCR assays were optimized and tested using DNA from different field samples (symptomatic leaves) of chilli, potato and sow thistle. DNA-A (~ 290bp) and betasatellite (~ 185bp) were amplified from chilli DNA sample, DNA-A (~ 290bp) and DNA-B (~ 685bp) were amplified from potato DNA sample, DNA-A (~ 290bp) and both the satellite components i.e., alphasatellite (~ 420bp) and betasatellite (~ 185bp) were amplified from sow thistle DNA sample. Each designed primer pair amplified the expected amplicons of the respective components. Optimal annealing temperature for each primer pair was found to be 52ºC for 1 min.

3.2 Optimization of the multiplex PCR

The component-specific simplex PCR primers were used for mPCR assay for simultaneous amplification of begomovirus components and satellites, and expected results (as obtained in simplex PCRs) were obtained. DNA-A and betasatellite were amplified from chilli, DNA-A and DNA-B were amplified from potato, and DNA-A, alphasatellite and betasatellite were amplified from sow thistle samples (Fig. 2). The results were also confirmed by direct sequencing of the PCR products (data not shown).

4. Discussion

Begomovirus-satellite complexes have emerged as one of the most serious threats to cultivation of agriculturally important crops in different parts of the world. Same satellite may associate with different begomoviruses and new disease complexes may emerge as a result. There is a pressing need to understand of the diversity of these disease complexes globally, and to keep an eye on the evolution of begomoviruses and the satellites. Unravelling the complex relationship between helper viruses, satellites and their hosts will be very useful for the researchers to strategize effective control of the related diseases. Simultaneous detection of helper viruses and associated satellites would be the first step in this direction. In the present study, a single tube mPCR assay was developed to detect either or both genomic components of begomoviruses and the associated alphasatellites and/or betasatellites. To the best of our knowledge this is the first attempt of this kind. This mPCR assay will be reliable, sensitive, simple, rapid and cost-effective method in screening large number of field samples for begomovirus disease complexes. The method will also be useful in developing more stringent quarantine and certification programs, in which a large numbers of infected samples are often tested.

Declarations

Ethics approval and consent to participate: The present research did not involve humans and/or animals.

Consent for publication: Consent has been taken from all the authors and concerned authorities before submission of this manuscript.

Availability of data and materials: All data generated or analyzed during this study are included in this manuscript.

Competing interests: The authors declare no competing financial interests.

Funding: CSIR-HRDG Project No. 38 (1466)/18/EMR-II

Authors' contributions: All authors contributed to the study conception and design. Material preparation, data collection were performed by Jyoti Sharma and Priya Lager. Data analysis was performed by Dr. Yogesh Kumar and the first draft of the manuscript was written by Jyoti Sharma. All authors read and approved the final manuscript.

Acknowledgements: The authors are thankful to the competent authorities of DAV University, Jalandhar Punjab, India for providing necessary research facilities, and CSIR-HRDG, Govt. of India for financial support [38 (1466)/18/EMR-II].

References

Aloyce, R.C., Tairoa, F., Sseruwagia, P., Rey, M.E.C., & Ndunguru, J. (2013). A single-tube duplex and multiplex PCR for simultaneous detection of four cassava mosaic begomovirus species in cassava plants. Journal of Virological methods, 189, 148–156.
Altschul, S.F., Gish, W., Miller, W., Myers, E.W., & Lipman, D.J. (1990). Basic local alignment search tool. Journal of Molecular Biology, 215, 403–410.
Briddon, R.W., & Stanley, J. (2006). Subviral agents associated with plant single-stranded DNA viruses. Virology, 344,198–210.
Brownie, J., Shawcross, S., Theaker, J., Whitcombe, D., Ferrie, R., Newton, C., & Little, S. (1997). The elimination of primer-dimer accumulation in PCR. Nucleic Acids Research, 25, 3235–3241.
Chiquito-Almanza, E., Acosta-Gallegos, J., García-Álvarez, N., Garrido-Ramírez, E., Montero-Tavera, V., Guevara Olvera, L., & Anaya-López, J. (2017). Simultaneous Detection of Both RNA and DNA Viruses Infecting Dry Bean and Occurrence of Mixed Infections by BGYMV, BCMV and BCMNV in the Central-West Region of Mexico. Viruses, 9(4), 63.
Corpet, F. (1988). "Multiple sequence alignment with hierarchical clustering". Nucleic Acids Research, 16 (22), 10881–10890.
Hyun, J.W., Yi, S.H., & MacKenzie, S.J. (2009). Pathotypes and genetic relationship of worldwide collections of Elsinoe spp. causing scab diseases of citrus. Phytopathology, 99(6), 721–728.
Jeevalatha, A., Chakrabarti, S.K., Sharma, S., Sagar, V., Malik, K., Raigond, B., & Singh, B.P. (2017). Diversity analysis of Tomato leaf curl New Delhi virus-[potato], causing apical leaf curl disease of potato in India. Phytoparasitica, 45(1), 33–43.
Kibbe, W.A. (2007). 'OligoCalc: an online oligonucleotide properties calculator'. Nucleic Acids Research, 35.
Kumar, S., Singh, L., Ram, R., Zaidi, A.A., & Hallan, V., 2013. Simultaneous Detection of Major Pome Fruit Viruses and a Viroid. Indian Journal of Microbiology, 54(2), 203–210.
Kumar, Y., Hallan, V., & Zaidi, A.A. (2011). Chilli leaf curl Palampur virus is a distinct begomovirus species associated with a betasatellite. Plant Pathology, 60(6), 1040–1047.
Lukman, R., Afifuddin, A., Deynze, A.V., Hill, T., & Jimenez, R. (2019). A survey of mixed Begomovirus infection in solanaceae and fabaceae at different altitudes in East Java, Indonesia. Archives of Phytopathology and Plant Protection, 52, 385–406.
Mnari-Hattab, M., Zammouri, S., Pellegrin, F., & Gauthier, N. (2014). Natural occurrence of begomovirus recombinants associated with tomato yellow leaf curl disease co-existing with parental viruses in tomato crops and weeds in Tunisia. Journal of Plant Pathology, 96, 195–200.
Mubin, M., Shahid, M.S., Tahir, M.N., Briddon, R.W., & Mansoor, S. (2010). Characterization of begomovirus components from a weed suggests that begomoviruses may associate with multiple distinct DNA satellites. Virus Genes, 40(3), 452–457.
Navas-Castillo, J., Fiallo-Olivé, E., & Sánchez-Campos, S. (2011). Emerging virus diseases transmitted by whiteflies. Annual Review of Phytopathology, 49, 219–248.
Potter, J.L., Nakhla, M.K., Mejía, L., & Maxwell, D.P. (2003). PCR and DNA hybridization methods for specific detection of bean-infecting begomoviruses in the Americas and Caribbean. Plant Disease, 87, 1205–1212.
Varma, A., & Malathi, V.G. (2003). Emerging geminivirus problems: a serious threat to crop production. Annals of Applied Biology, 142, 145–164.
Zhou, X. (2013). Advances in understanding begomovirus satellites. Annual Review of Phytopathology, 51, 357–381.

table

Table 1: Details of the designed primers used in the simplex PCR and multiplex PCR assays

Primers	No. of Nucleotides	Sequence	DNA Component	Amplicon size
MPDNA-AF	20	CAGTGATGNRTTCCCCTGTG	DNA-A	~290bp
MPDNA-AR	21	ATTCCCRCTATCTTCCTSTGC	DNA-A	~290bp
MPDNA-BF	22	TTATGTATGGTTAAGCGATGTA	DNA-B	~685bp
MPDNA-BR	20	AACCTGCACTACTACTCTTC	DNA-B	~685bp
MPAlpha-F	20	GAAACTAGGGTTTCYGGYCC	Alphasatellite	~420bp
MPAlpha-R	20	TGGAYTTYCCTTCCCCACCA	Alphasatellite	~420bp
MPBeta-F	20	TGTGTCTGGTAGGCGCGTGG	Betasatellite	~185bp
MPBeta-R	20	CGGCGTAGCTAAGGCTGCTG	Betasatellite	~185bp