Genetic impact of Neopyropia yezoensis cultivation on wild populations: a case study on the typical laver culture areas in China by SSR analysis

doi:10.21203/rs.3.rs-1748442/v1

Download PDF

Research Article

Genetic impact of Neopyropia yezoensis cultivation on wild populations: a case study on the typical laver culture areas in China by SSR analysis

https://doi.org/10.21203/rs.3.rs-1748442/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Neopyropia yezoensis is a typical intertidal seaweed and a major mariculture crops in China. The culture area of N. yezoensis has been largely increasing in the past decade. Whether large-scale cultivation of N. yezoensis has a genetic impact on wild populations remains unknown. Here, eleven polymorphic microsatellite markers were developed and applied for the genetic structure analysis of 22 N. yezoensis populations from along the coast of China. The populations were divided into 4 groups based on the Bayesian model-based structure analysis. A significant genetic structure difference was present between the cultivated populations and the wild ones. The 13 wild populations were divided into two distinct groups, with no obvious correlation between the inter-population genetic variation and geographical distance within each group. The average polymorphism of 9 cultured N. yezoensis populations was higher than that of the wild populations, and the percentage of polymorphic loci of the most cultivated populations was at a high level (P=90.91%). It indicated that the germplasm of cultivated N. yezoensis in China are diversified. The genetic differentiation between the cultivated populations and the wild populations decreased with the increasing cultivation time. But the gene flow between the cultivated populations and the wild ones was asymmetric, exhibiting a trend from wild population to cultured population. The result indicated that even if there is a genetic impact of N. yezoensis aquaculture on wild resource, it is a long-term and slow process. This research provided useful insights for future germplasm resource evaluation and genetic breeding of N. yezoensis.

Neopyropia yezoensis

microsatellite markers

genetic impact

genetic structure

gene flow

Under the influence of global warming and human activities, off-shore environmental factors (such as temperature and nutrient level) have undergone significant changes, which results in the change of macroalgal habitat, germplasm degradation, frequent occurrence of harmful algal blooms and other problems (Zhao, 2014; Huang and Yan 2019). The production and scale of artificially cultivated macroalgae in China has been increasing dramatically and ranked first in the world (Yang 2016). It is great significance to make clear whether large-scale cultivation of seaweed has a genetic impact on wild resources for the protection of germplasm resources and for making farming strategies. It was found that the cultivated population of Undaria pinnatifida (Shan et al. 2018; Li et al. 2019) and Saccharina japonica (Shan et al. 2019) had higher gene exchange with the spontaneous populations on the cultivation rafts, but less gene exchange with the spontaneous populations in the adjacent subtidal zone. In short, such research has just attracted attention and is worth further study.

Neopyropia yezoensis, previously known as Pyropia yezoensis (Yang et al. 2020), is a typical intertidal macroalgae and has received great interest as a model organism for the study of seaweed germplasm resources (Iitsuka et al. 2002; Mao et al. 2019). This species is widely spread in the western North Pacific (Sutherland et al. 2011). Among laver species, N. yezoensis has the widest natural distribution range and the largest number along the coastal areas of Yellow Sea and Bohai Sea in China (Zhang and Zhen 1962). It is one of the most important mariculture crops with high nutritional values and is mainly cultivated in Japan, Korea and China (Miura 1988; Park et al. 2007). In China, the earliest artificial cultivation of N. yezoensis began in the early 1970s and gained a rapid development in the late 1980s in Jiangsu province (Song and Zhao 2003). Jiangsu province has long been the main cultivation area of this species with the annual culture area being over 4×10⁴ hectare. According to the full-exploitation of the applicable culture area in Jiangsu and global warming, farming of N. yezoensis has been transplanted northward to Shandong and Liaoning province in recent years, with the culture area increasing year by year (Li et al. 2018; Lu et al. 2018; Wang et al. 2019). However, the genetic impact of large-scale aquaculture of N. yezoensis on the natural resource remains unknown.

Molecular markers can reflect the differences in plant genetic background at the DNA level (Lu and Zhu 1995). The most studies have been focused on the genetic diversity of different geographic populations of N. yezoensis and between N. yezoensis and other laver species by using different molecular markers, such as Amplified fragment length polymorphisms (AFLPs; Iitsuka et al. 2002; Yang et al. 2016; Cao et al. 2018), Inter-simple sequence repeats (ISSRs; Cui et al. 2006; Sun et al. 2007; Yang et al. 2016), and Randomly amplified polymorphic DNAs (RAPDs; Song et al. 1986; Jia et al. 2000; Yang et al. 2016). Besides, the genetic linkage map of N. yezoensis has also been constructed by Sequence-related amplified polymorphisms (SRAPs; Huang and Yan 2019) and RAPDs (Weng et al. 2005). Microsatellite DNA, also known as simple sequence repeats (SSRs), is ubiquitously distributed throughout both eukaryotic and prokaryotic genomes (Tautz et al. 1994). SSRs have been widely used in population genetic research, such as genetic map construction, genetic diversity analysis and population genetic structure analysis (Ge et al. 2010; Luo et al. 2016; Nie et al. 2014), due to the advantages of high polymorphism, codominant inheritance, objective and clear amplification bands, simple experimental operation, good stability and repeatability (Luo et al. 2010; Luo et al. 2013). Now, SSRs have now become the most widely used molecular marker system in plant molecular biological research despite a few disadvantages (Rungis et al. 2004; Pan et al. 2010). SSRs have been used for population genetic diversity analysis of N. yezoensis (Yu et al.2010; Wei 2012). In recent years, more and more microsatellite markers have been developed based on the genomic and transcriptomic data (Huang and Yan, 2019; Liu et al.2019; Kim et al. 2021).

In this study, SSRs was used to analyze and compare the genetic diversity and gene exchange among the cultivated and wild N. yezoensis populations along the coast in China, so as to understand the status of genetic impact of N.yezoensis cultivation on wild populations. This study can provide useful insights for future germplasm resource evaluation and genetic breeding of N. yezoensis.

1.1 Materials

From December 2020 to June 2021, 22 Neopyropia yezoensis populations, including 13 wild populations and 9 cultivated populations, were collected along the coast of Yellow Sea and Bohai Sea in China. The collecting information was shown in Table S1. The geographical locations of the sampling sites were shown in Fig. 1.

After the samples were transported to the laboratory in Qingdao at 4°C, they were rinsed three times in sterile petri dishes with filtered (0.22-µm pore size) and autoclaved seawater to remove any epiphytic organisms. Subsequently, the surface water was dried with absorbent paper. Then, approximately 0.1 g of each sample was immediately frozen in liquid nitrogen and stored at -80°C.

1.2 Genomic DNA Extraction

The DNA of the sample was extracted by using the Super Plant Genomic DNA Kit (for polysaccharide- and polyphenol-rich plants) (DP360, Tiangen, Beijing, China). The concentration and purity of the DNA were assessed by a nucleic acid protein detector and 1% agarose gel electrophoresis, respectively.

1.3 Screening of microsatellite primers

Eight DNA samples were randomly selected from 22 N. yezoensis populations for microsatellite markers screening. A total of 68 microsatellite markers were used for screening (Lu, 2016). All amplifications were performed in 20 µl reactions, which included 1 µl of template DNA, 0.1 µl of each primer, 10 µl of 2×Taq Master mix (Taq DNA Polymerase, dNTP, MgCl₂ and reaction buffer) and 8.8 µl of H₂O. The PCR amplification procedure was as follows: initial denaturation at 94°C for 5 min; followed by 35 cycles of denaturation at 94°C for 30 s, annealing for 30 s, and elongation at 72°C for 20 s; and a final extension at 72°C for 10 min.

The amplified products were stored at 4°C at the end of the reaction process. Electrophoresis of the amplified products was conducted in a 1.5% agarose gel at 100 V and 15 min and then photographed and detected by a gel imager. Capillary electrophoresis and genotyping of the PCR products with stable amplification process and clear bands were performed using a 3730xl sequencer, and the data were analysed by GeneMapper 4.1 software. According to the analysis of the loci information to determine whether the detection markers has the loci polymorphism, the microsatellite markers with fragment polymorphism and high amplification efficiency were screened out and used to analyze the genetic diversity of all samples from the 22 N. yezoensis populations.

1.4 Data analysis and statistics

Popgen 32 software (Yeh et al. 1999) was used to analyse the SSR loci and genetic diversity of the N. yezoensis population. The selected parameters included the number of different alleles (N_a), number of effective alleles (N_e), Shannon's information index (I), polymorphism information coefficient (PIC), expected heterozygosity (H_e), observed heterozygosity (H_o) and Hardy-Weinberg Equilibrium (HWE).

A structure (Version 2.3.4) cluster analysis based on a Bayesian model was performed for the N. yezoensis populations. Twenty independent runs were performed for each K under the admixture model and correlated allele frequency model (Pritchard et al. 2000), and the optimal K value was determined by the use of STRUCTURE HARVESTER according to the delta K value (Evanno et al. 2005).

The genetic differentiation coefficient (F_st) between populations were determined with GenAlex version 6.501 (Nei 1972). Analysis of molecular variance (AMOVA) was performed on the N. yezoensis populations, and principal coordinates analysis (PCoA) was performed based on individual genetic distance matrices (Anderson and Willis 2003; Chae and Warde 2006) to infer the genetic relationship between populations.

2.1 Characteristics and polymorphisms of microsatellite markers

Eleven pairs of polymorphic primers were obtained (Table 1). The genetic parameters showed that 60 alleles were amplified for 11 microsatellite loci from 375 individuals of 22 N. yezoensis populations (Table 2). The minimum N_a value was 3 (SSR23, SSR24, SSR48 and SSR66), and the maximum was 9 (SSR02 and SSR60). N_e varied from 1.271 (SSR48) to 4.414 (SSR01). Both I value (I = 0.376) and PIC value (PIC = 0.191) of SSR48 were the minimum, indicating the lowest polymorphism of this locus. The PIC values of the other 10 microsatellite markers were all higher than 0.25. Both I value (I = 1.578) and PIC value (PIC = 0.738) of SSR01 were the maximum, indicating the highest polymorphism of this locus. H_e ranged from 0.213 (SSR48) to 0.773 (SSR01), with an average of 0.510; H_o ranged from 0.009 (SSR01) to 0.343 (SSR29). All of the SSR deviated from the Hardy-Weinberg equilibrium significantly (P < 0.01).

Table 1

Characteristics of eleven pairs of SSR for *Neopyropia yezoensis*
	Primer sequence 5’-3’	Repetitive sequence	Annealing temperature	Fragment size/bp
SSR01	F: CTGCCACAGCCGCTCGTT R: CGCAGCATCAGCAGTCGG	(TGT)₁₂	60	294
SSR02	F: GTGTTTTCTCACGCCCAGTG R: CGGCAAGTTCGTTTTCCTC	(CCGTCA)₆	56	214
SSR12	F: GGGGACCCGAGGAGAACA R: AATCAGGCTGCCACGAAAA	(CG)₅	60	218
SSR23	F: CGTCGTGTCGCTTTGTAATGG R: AGGGAAGGCAGTGGTGGG	(CGC)₆	57	149
SSR24	F: CGTGGAGCAAATTGAGGA R: CCAGCGAATAGGACAGACA	(CT)₅	52	170
SSR29	F: TGGGCGTGTTGTCCTGTG R: GCTGCGAGGCACTCTTCAT	(CTG)₁₃	56	302
SSR40	F: CGCCGCTGAGGTGGAAACA R: CCCAGACACTTCGTGGCAGAC	(CA)₄	59	267
SSR48	F: CTTCTGGCGACCCAACGT R: ATCAAGCCCAAGCAGCAAT	(TG)₄	55	226
SSR53	F: GGGCGAGCAAGGAACAGA R: CGTGGTCGTGTCCGAAAGC	(GC)₆	57	273
SSR60	F: TCTTGTCCCTTCGCCGTGTC R: CGTGCGAGTGGGCTCTTTC	(GA)₄	57	157
SSR66	F: AGCATCGCCCGCTCAGTC R: GCGGGAAGGTCGTCAACA	(AG)₅	61	175

Table 2

Genetic parameters (per locus) of eleven pairs of SSR primers for *Neopyropia yezoensis*
	N_a	N_e	H_e	H_o	I	PIC
SSR01	8	4.414	0.773	0.009	1.578	0.738**
SSR02	9	3.077	0.675	0.024	1.491	0.646**
SSR12	4	2.194	0.544	0.046	0.946	0.487**
SSR23	3	1.514	0.339	0.021	0.530	0.283**
SSR24	3	2.326	0.570	0.059	0.951	0.498**
SSR29	8	3.493	0.714	0.343	1.372	0.665**
SSR40	6	2.781	0.640	0.124	1.226	0.589**
SSR48	3	1.271	0.213	0.078	0.376	0.191**
SSR53	4	1.461	0.316	0.083	0.530	0.271**
SSR60	9	1.911	0.477	0.039	0.750	0.377**
SSR66	3	1.531	0.347	0.046	0.596	0.301**
Mean	5.455	2.361	0.510	0.079	0.941	0.459
SE		0.991	0.185	0.093	0.423
Notes: N_a: number of different alleles; N_e: number of effective alleles;
H_e: expected heterozygosity; H_o: observed heterozygosity;
I: Shannon's information index; PIC: polymorphic information coefficient.

2.2 Genetic diversity analysis of Neopyropia yezoensis populations

Among the 22 N. yezoensis populations, N_a ranged from 1.364 to 3.091, N_e varied from 1.112 to 2.092, H_e ranged from 0.082 to 0.474, and H_o ranged from 0.000 to 0.286 (Table 3). The N_a, N_e, H_e and H_o value of population DL-W2 were all the minimum. At the same time, the Shannon's information index and percentage of polymorphic loci of DL-W2 were the lowest. It indicated that DL-W2 had the lowest genetic diversity among the studied N. yezoensis populations. The average percentage of polymorphic SSR loci in the 22 populations was 69.83%, with the average I value of 0.400.

Table 3

Genetic parameters for 22 *Neopyropia yezoensis* populations
	N_a	N_e	He	H_o	I	P/%
DL-C	1.636	1.158	0.115	0.073	0.198	54.55%
QD-C1	2.273	1.955	0.461	0.061	0.694	90.91%
QD-C2	2.364	2.092	0.474	0.080	0.726	90.91%
QD-C3	2.091	1.353	0.224	0.023	0.392	90.91%
QD-C4	2.000	1.238	0.155	0.000	0.275	90.91%
RZ-C	3.091	1.775	0.396	0.286	0.698	90.91%
LYG-C1	2.909	2.062	0.469	0.036	0.778	90.91%
LYG-C2	1.909	1.240	0.147	0.086	0.253	72.73%
NT-C	1.545	1.220	0.127	0.055	0.208	36.36%
DL-W1	2.182	1.735	0.355	0.078	0.570	72.73%
DL-W2	1.364	1.112	0.082	0.000	0.137	36.36%
DL-W3	2.182	1.369	0.246	0.100	0.425	90.91%
DY-W	2.000	1.344	0.184	0.121	0.318	63.64%
YT-W1	2.364	1.565	0.233	0.131	0.437	72.73%
YT-W2	1.545	1.267	0.169	0.091	0.262	54.55%
YT-W3	2.455	1.426	0.247	0.100	0.433	90.91%
YT-W4	2.455	1.977	0.420	0.059	0.669	81.82%
WH-W	2.000	1.380	0.171	0.077	0.315	54.55%
QD-W1	1.364	1.165	0.099	0.071	0.153	36.36%
QD-W2	1.364	1.210	0.124	0.061	0.187	36.36%
QD-W3	2.455	1.389	0.183	0.112	0.358	72.73%
RZ-W	2.000	1.301	0.181	0.051	0.313	63.64%
Mean	2.070	1.470	0.239	0.080	0.400	69.83%
SE	0.064	0.036	0.014	0.010	0.024	4.41%
Notes: N_a: number of different alleles; N_e: number of effective alleles;
H_e: expected heterozygosity; H_o: observed heterozygosity;
I: Shannon's information index; P: Percentage of polymorphic loci

The genetic differentiation was the highest (F_st=0.767) between DL-C and NT-C and the lowest between QD-C1 and QD-C2 (F_st=0.006) (Table S2). The phylogenetic tree showed that 22 populations were divided into 2 main subgroups (Fig. 2). The 5 cultured populations of DL-C, LYG-C2, QD-C3, QD-C1 and QD-C2 were grouped into one branch. Another 17 populations were divided into 2 subgroups, in which 4 populations of DL-W1, DL-W2, YT-W3 and YT-W4 were grouped into one branch. In the remaining subgroup, 9 wild populations clustered together.

The optimal K value was 4 (Fig. 3), indicating that the 22 populations were divided into 4 groups based on the structure analysis (Fig. 4a). Thirteen wild populations and 9 cultivated populations were divided into two distinct groups. If K-value was manually adjusted to 2 (Fig. 4b), the cultivated populations and the wild populations were divided into two groups, with some cultivated populations (NT-C, QD-C4, LYG-C1 and RZ-C) containing high gene exchange with the wild population. The 22 populations were divided into three regions roughly by PCoA, in which DL-W1, DL-W2,YT-W3,YT-W4 clustered together, DL-C, LYG-C2, QD-C1, QD-C2, QD-C3 and a small amount of individuals from RZ-C clustered together, and the rest of the populations clustered together (Fig. 5).

The AMOVA (Table 4) showed that the genetic variation among 22 N. yezoensis populations (53%) was higher than the intra-population genetic variation (47%). However, the degree of genetic variation within cultivated (53%) or wild (55%) populations was higher than that among populations (47% and 45%, respectively).

Table 4

AMOVA of the *Neopyropia yezoensis* populations
Source of variation	Degree of freedom	Sum of squares	Variance component	Rate of variation
Among 9 cultivated Pops.	8	803.004	5.309	47%
Within 9 cultivated Pops.	152	917.865	6.039	53%
Total	160	1720.870	11.347	100%
Among 13 wild Pops.	12	777.835	3.724	45%
Within 13 wild Pops.	200	898.179	4.491	55%
Total	212	1676.014	8.215	100%
Among 22 Pops.	21	2160.332	5.757	53%
Within 22 Pops.	353	1832.806	5.192	47%
Total	374	3993.139	10.949	100%

2.3 Gene exchange between cultivated and wild populations

Among the 3 N. yezoensis populations in the Changshan Islands in the northern Yellow Sea, the genetic differentiation coefficient between DL-C and DL-W2 was the highest (F_st=0.683), and that between DL-W1 and DL-W2 was the lowest (F_st=0.141) (Table S2). The optimal K value was identified to be 2, i.e., 3 populations were divided into two groups (Fig. 6a). DL-C was clustered into a separate group with a high proportion of membership (average Q = 0.981) and DL-W1 and DL-W2 were clustered into another group (average Q = 0.997 and 0.997).

There were 7 N. yezoensis populations along Qingdao Peninsula. The genetic differentiation coefficient between QD-C3 and QD-W2 was the highest (F_st=0.641), and that between QD-C1 and QD-C2 was the lowest (F_st=0.006). The genetic identity was the highest between QD-W1 and QD-W2 (0.994) and was the lowest between QD-C3 and QD-W2 (0.273) (Table S2). The optimal K value was 2. QD-W1, QD-W2, QD-W3 and QD-C4 were clustered into a group with high proportion of membership (average Q = 0.993, 0.998, 0.981 and 0.950) and QD-C3 was clustered into another group with high proportion of membership (average Q = 0.874) (Fig. 6b). A marked admixture was identified in QD-C1 and QD-C2, with the membership proportion from the 2 groups were 0.586:0.414 and 0.582:0.418.

Among the 4 N. yezoensis populations along Haizhou Bay, the genetic differentiation coefficient between LYG-C2 and RZ-W was the highest (F_st=0.605), and that between LYG-C1 and RZ-C was the lowest (F_st=0.072). The genetic identity was the highest between RZ-C and RZ-W (0.909) and the lowest between LYG-C2 and RZ-W (0.309) (Table S2). The optimal K value was 2. RZ-W was clustered into a separate group with high proportion of membership (average Q = 0.994) and LYG-C2 was clustered into another group with high proportion of membership (average Q = 0.974). Marked admixture was identified in LYG-C1 and RZ-C, with the membership proportion being 0.697:0.303 and 0.716: 0.284, respectively (Fig. 6c).

3.1 Polymorphism of the microsatellite loci

As codominant markers, microsatellite markers have a high mutation rate among tandem repeat sequences and can form many alleles. Therefore, microsatellite markers have been known with highly polymorphic (Weber 1990; Gur-Arie et al. 2000). According to Botstein et al. (1980), PIC is divided into three grades: PIC < 0.25 (indicating a low polymorphism level), 0.25 < PIC < 0.5 (a moderate polymorphism level), and PIC > 0.5 (a high polymorphism level). Eleven microsatellite markers were developed in this study. The mean PIC of the 11 markers was 0.459, with the values for SSR01, SSR02, SSR 029 and SSR40 above 0.5 and only the value for SSR48 lower than 0.25, indicating that the developed microsatellite markers were highly polymorphic.

Analysis of microsatellite DNA characteristics found that most of them being dinucleotide and trinucleotide repeats. This result was consistent with the distribution characteristics of microsatellite loci in most plant (Sonah et al. 2011; Shan et al. 2018; Zhang et al. 2018). Besides, CG-rich repeats types are the most populous. The CG-rich SSRs identified here is mostly owing to the high GC content of N. yezoensis genome (Xu et al. 2006; Wang et al. 2007; Kim et al. 2021). SSR01 and SSR02 had the longest sequences and were highly polymorphic. Generally speaking, the longer the microsatellite DNA sequence or the more nucleotide repeats, the higher polymorphism of this microsatellite locus (Gou et al. 2007). In addition, the genetic parameters of SSR markers screened in this study were all higher than those of Wei (2012) when both cultivated and wild N. yezoensis populations were used as samples. And the number of allele per SSR were higher than the SSRs developed by Kim et al (2021). The H_o of 11 microsatellite markers were all lower than the H_e, and the microsatellite markers all deviated significantly from the Hardy-Weinberg Equilibrium. Purifying selection, population substructure, copy number variation, genotyping error and sampling effect are all potential causes of departure from Hardy-Weinberg Equilibrium (Chen et al. 2017; Kang et al. 2013; Qi et al. 2017). These markers would be valuable tools for N. yezoensis germplasm resource evaluation, genetic diversity protection and breeding.

3.2 Genetic diversity of wild N. yezoensis resource in China

The wild populations of N. yezoensis collected in this study were distributed in 6 cities along the coast of the Yellow Sea and Bohai Sea, which covered the major natural distribution of this species in China (Zhang and Zheng 1962; Cao et al. 2018). The collecting sites were almost geographically separated from each other. Fujio et al. (1985) found that the natural population structure of N. yezoensis has more geographical genetic differentiation than many other diploid organisms. It has been reported that the degree of genetic differentiation among laver populations is related to geographical location and growth environment (Xu et al. 2001; Yang et al. 2002). It has been tested in the other aquatic organisms as well (Niu et al. 2007; Guo et al. 2011). The present AMOVA analysis of 13 wild populations showed that genetic variation mainly existed within the population. The phylogenetic tree, structure and PCoA analysis consistently showed that the wild populations were divided into two distinct groups with Miaodao Strait as the boundary (Fig. 2). However, no obvious correlation between the genetic variation and geographical distance was found among the wild populations within each group in this study. The previous study revealed the similar phenomenon that the genetic distance between laver species is not always related to geography or growing environment (Cui et al. 2006). The genetic differentiation coefficients (F_st) among the 9 wild populations from south of Miaodao Strait were 0.018–0.117, indicating a high level of gene flow and low level of genetic differentiation (Wright 1978). Yu (2010) also analyzed the genetic diversity of N. yezoensis collected from Qingdao, Jiangsu and Japan using microsatellite markers, and got the similar conclusion. During the long evolutionary process of wild N. yezoensis, ocean drift may result in high gene exchanges and similar genetic background between wild populations in different geographical locations in the same sea area.

3.3 Genetic diversity of cultivated N. yezoensis resource in China

The cultivation area of N. yezoensis in China is distributed in Jiangsu, Shandong, and Liaoning province, with more than 99% of the production and processing enterprises are distributed along the coast of Jiangsu province (An et al. 2018; Lu et al. 2018). The semi-floating raft or standing-pole culture systems are generally used for laver cultivation, which leads to the limitation of laver aquaculture in shallow water (Wang et al. 2016). Intensive cultivation and long-term selective breeding of cultivated N. yezoensis germplasm leads to reduced genetic diversity of stock, fragility to climate change, susceptibility to disease, and reduced product quality (Li et al. 2018). New strains of N. yezoensis with varying good agronomic characters such as adaptation to non-drying culture system (Wang et al. 2016; Li et al. 2018), resistance to high temperature (Zhang et al. 2011) and disease (Park and Hwang 2014) were cultured to expand culture space, improve product quality, and adapt to different sea conditions and market demands.

The cultivated populations of N. yezoensis were collected from 5 cities along the coast of Jiangsu, Shandong and Liaoning province. Rizhao cultivated populations had the highest diversity (I = 0.698, P = 90.91%), and Nantong had a low diversity level (I = 0.208, P = 36.16%). AMOVA analysis of 9 cultivated populations showed that the genetic variation mainly existed within the population, which was consistent with the previous study (Yang et al. 2016). The average polymorphism of 9 cultured N. yezoensis populations in this study was higher than that of the wild populations, and the percentage of polymorphic loci of the most cultivated populations was at a high level (P = 90.91%). The previous studies based on different molecular markers found that there were great genetic differences among cultivated populations of different N. yezoensis cultivars (Mei et al. 2000; Chen et al. 2012). This suggested that the germplasm of cultivated N. yezoensis in China are diversified.

3.4 Comparison of diversity between cultivated and wild populations

Generally, the genetic diversity is higher in wild populations than in cultured ones, owing to multi-generational selection and purification of the cultivars. Wei (2012) used SSR markers to analyze the genetic diversity of some cultivated populations from Rizhao and Lianyungang (average I = 0.3537) and some wild populations from Qingdao, Yantai and Weihai (average I = 0.3856). They found that the genetic diversity of the wild populations was slightly higher than that of the cultivated populations. The genetic variation was largely present within the populations (Wei 2012). In this study, a higher genetic diversity was identified in the cultivated populations (average I = 0.469, P = 78.79%) than in the wild populations (average I = 0.352, P = 63.64%). In recent years, wild resources of seaweeds were deteriorated and biodiversity was declining due to global climate and coastal environmental change (Sun et al. 2010; Tanaka et al. 2012; Koh and Kim 2020). New germplasm resources from wild populations and new strains obtained from mutation or cross breeding have been recruited for aquaculture (Zhang et al. 2011; Park and Hwang 2014; Li et al. 2018). Usually, a mixture of seedlings from several sources is used in a nursery farm, which may increase the genetic diversity within the cultured populations.

The genetic diversity of wild N. yezoensis populations was lower than the cultivated ones. Whether years of N. yezoensis cultivation resulted in the lower genetic diversity of wild populations? From the structure analysis, it can be seen that significant differences were present between the cultured populations and the wild ones. On one hand, it has been reported that some of the N. yezoensis cultivars in China were introduced from abroad (Qiao et al. 2007). On the other hand, the distinct genetic background of some cultured populations may also result from mutation or cross breeding.

According to Wright (1978) classification, there was a high genetic differentiation between the cultivated populations and the wild populations (F_st=0.529–0.683) in the Changshan Islands. Along Qingdao Peninsula, gene exchange was present between some of the cultivated populations and the wild ones (F_st=0.218–0.641). In Haizhou Bay, there were a high gene exchange and a low genetic variation between the cultured populations and the wild one, especially between RZ-C and RZ-W (F_st=0.095). RZ-W, RZ-C and LYG-C1 were aggregated into a group. As mentioned above, there is the longest N. yezoensis culture history along Haizhou Bay (40–50 years). Industrial aquaculture of N. yezoensis in Qingdao and Dalian started just 5–7 years ago. The gene exchange between the cultivated populations and the wild populations seemed to be related to the length of culture time. However, it can be seen from the structure analysis that the gene flow between the cultivated populations and the wild populations was asymmetric, and the gene flow from the cultivated populations to the wild populations was limited. In other words, even if there is an impact of N. yezoensis cultivation on wild populations, it is a long-term and slow process.

N. yezoensis is a monoecious and self-fertilized seaweed, and the thallus is capable of repeating itself by means of asexual reproduction through archeospores (Fujio et al. 1985). The spreading of archeospores may cause genetic exchange and the decrease of genetic variation between the geographically adjacent populations (Cao et al. 2018). Nevertheless, the survival and germinating of archeospores depends on suitable environmental conditions. Although there is the longest N. yezoensis culture history of about 50 years in Jiangsu province, no flourishing of spontaneous populations have been identified along the coast. It may be due to the sandy substrate. It has been found that the cultivated population of U. pinnatifida (Shan et al. 2018; Li et al. 2019) and S. japonica (Shan et al. 2019) had higher gene exchange with the spontaneous populations on the cultivation rafts, but less gene exchange with the spontaneous populations in the adjacent subtidal zone. In practice, there are very few individuals of N. yezoensis growing on the cultivation stem ropes and rafts. In this study, the QD-C4 was genetically distinct from the other 3 populations (QD-C1, C2, C3) that were cultured at the same time and next to each other. It indicated that the genetic impact between the adjacent populations was limited.

In conclusion, the 11 SSRs markers efficiently distinguished the wild and cultured populations of N. yezoensis. The relationship between some populations can be well-traced. e.g., QD-C4 and LYG-C1 seemed to come from the same parents or germplasm, and the germplasm for DL-C and LYG-C2 had very close genetic relationship. It was firstly identified that there are at least two distinct genetic resources of wild N. yezoensis in China. The genetic exchange between the cultivated N. yezoensis populations and the wild populations seemed to be related to the length of culture time. Even if there is a genetic impact of N. yezoensis aquaculture on wild resource, it is a long-term and slow process.

Funding information: This project was supported by the National Key R&D Program of China "Scientific and Technological Innovation of Blue Granary" (2018YFD0901500), National Marine Genetic Resource Centre, Central Public-interest Scientific Institution Basal Research Fund (2020TD27) and Central Public-interest Scientific Institution Basal Research Fund, YSFRI, CAFS (NO. 20603022021008).

Competing interests: The authors declare no conflicts of interest regarding this article.

Availability of data and materials: We confirm that we have included a statement specifying the local, national or international guidelines and legislation and the required or appropriate permissions and/or licences for the study.

Author contributions:

Rujie Jia: original concept, fieldwork and algae collection, experimental design, laboratory work, data analysis, drafting and editing of manuscript; Wenjun Wang: original concept, experimental design and editing of manuscript; Zhourui Liang: fieldwork and algae collection, data analysis and editing of manuscript; Xiaoping Lu: fieldwork and algae collection and data analysis; Haiqin Yao: data analysis and editing of manuscript; Yi Liu: fieldwork and algae collection; Baoxian Li: data analysis; Citong Niu: fieldwork and algae collection.

An J, Chen BY, Lu JK, Zheng Y, Tang XB, Fu GH, Zhang ZY (2018) Effects of environmental factors on sporulation and attachment of Porphyra yezoensis shell spores. Journal of Aquaculture 39: 11–13.
Anderson MJ, Willis TJ (2003) Canonical analysis of principal coordinates: a new ecologically meaningful approach for constrained ordination. Ecology 84: 511–525.
Botstein D, White RL, Skolnick M, Davis RW (1980) Construction of a genetic linkage map in man using restriction fragment length polymorphism. American Journal of Human Genetics 32: 314–331.
Cao WY, Xiao LX, Wang D, Hou ZX (2018) Temporal and spatial distributions of carbon sink capacity and scale of algae culture in the Yellow and Bohai Seas. Marine Sciences 42: 112–119.
Cao Y, Wang WJ, Liu FL, Liang ZR, Sun XT, Li XL, Sun TQ, Wang FJ (2018) AFLP fingerprints of Pyropia yezoensis (Bangiales, Rhodophyta) populations revealed the important effect of farming protocols on genetic diversity. Botanica Marina 61: 141–147.
Chae SS, Warde WD (2006) Effect of using principal coordinates and principal components on retrieval of clusters. Computational Statistics & Data Analysis 50: 1407–1417.
Chen B, Cole J W, Grond-Ginsbach C (2017) Departure from Hardy Weinberg Equilibrium and Genotyping Error. Frontiers in Genetics 8:167.
Chen SY, Lu QQ, Zhang MR, Hu CM, Xu GP (2012) ISSR analysis of ten breeding lines of Pyropia yezoensis. Tianjin Agricultural Sciences 18: 19–23.
Cui LY, Xu P, Zhu JY, Xu GP, Luo QJ, Ma JH (2006) Inter-simple sequence repeats (ISSR) applied in four species of Porphyra (Rhodophyta, Bangiales). Journal of Fishery Sciences of China 13: 371–377.
Evanno G, Regnaut R, Goudet J (2005) Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study. Molecular Ecology 14: 2611–2620.
Fujio Y, Kodaka PLG, Hara M (1985) Genetic differentiation and amount of genetic variability in natural populations of the haploid layer Porphyra yezoensis. Japanese Journal of Genetics 60: 347–354.
Ge XL, Yin HB, Bi B, Sun ZW (2010) A preliminary research of genetic linkage map construction and QTL analysis for growth-related traits in yellow catfish (Pelteobagrus fulvidraco). Journal of Fisheries of China 34: 185–193.
Gou LW, Wang GY, He HC, Liu Y, Yang XH, Zhang QY (2007) The research and application of microsatellite marher. Grass-Freeding Livestock 3:1–4
Guo BY, Zhou C, Lv ZM, Li JJ, Wu CW (2011) Genetic diversity of different geographical populations in Octopus Variabilis revealed by ISSR analysis. Oceanologia Et Limnologia Sinica 42: 868–873.
Gur-Arie R, Cohen CJ, Eitan Y, Shele L, Kashi Y (2000) Simple Sequence Repeats in Escherichia coli: Abundance, Distribution, Composition, and Polymorphism. Genome Research 10: 62–71.
Huang LB, Yan XH (2019) Construction of a genetic linkage map in Pyropia yezoensis (Bangiales, Rhodophyta) and QTL analysis of several economic traits of blades. PLoS One 14: e0209128.
Huang LB, Yan XH (2019) Development of simple sequence repeat markers in Pyropia yezoensis (Bangiales, Rhodophyta) by high-throughput sequencing technology. Aquaculture Research 00: 1–9.
Iitsuka O, Nakamura K, Ozaki A, Okamoto N, Saga N (2002) Genetic information of three pure lines of Porphyra yezoensis (Bangiales, Rhodophyta) obtained by AFLP analysis. Fisheries Science 68: 1113–1117.
Jia JH, Wang P, Jin DM, Qu XP, Wang Q, Li CY, Weng ML, Wang B (2000) The application of RAPD markers in diversity detection and variety identification of Porphyra. Acta Botanica Sinica 42: 403–407.
Kang JH, Kim YK, Park JY, Noh ES, Jeong JE, Lee YS, Choi TJ (2013) Development of microsatellite markers for a hard-shelled mussel, Mytilus coruscus, and cross-species transfer. Genetics and Molecular Research 12: 4009–4017.
Kim MS, Wi JW, Lee JH, Cho WB, Park EJ, Hwang MS, Choi SJ, Jeong WJ, Kim GH, Choi DW (2021) Development of genomic simple sequence repeat (SSR) markers of Pyropia yezoensis (Bangiales, Rhodophyta) and evaluation of genetic diversity of Korean cultivars. Journal of Applied Phycology. https://doi.org/10.1007/s10811-021-02536-7
Koh YH, Kim MS (2019) Genetic diversity and distribution pattern of economic seaweeds Pyropia yezoensis and Py. suborbiculata (Bangiales, Rhodophyta) in the northwest Pacific. Journal of Applied Phycology. https://doi.org/10.1007/ s10811-019-01984-6.
Li QX, Shan TF, Wang XM, Su L, Pang SJ (2020) Evaluation of the genetic relationship between the farmed populations on a typical kelp farm and the adjacent subtidal spontaneous population of Undaria pinnatifida (Phaeophyceae, Laminariales) in China. Journal of Applied Phycology 32:653–659.
Li XL, Wang WJ, Liu FL, Liang ZR, Sun XT, Yao HQ, Wang FJ (2018) Periodical drying or no drying during aquaculture affects the desiccation tolerance of a sublittoral Pyropia yezoensis strain. Journal of Applied Phycology 30: 697–705.
Liu Y, Pan X, Xu KP, Mao UX (2019) Distribution, Function and Polymorphism Characteristics of Microsatellites in Pyropia yezoensis Transcriptome. Journal of Ocean University of China 18:693–700.
Lu QQ, Zhou W, Zhu JY, Yan BL, Ni JZ, Yang LE (2018) The history, status quo and development trend of Pyropia yezoensis industry of China. Marine Economy in China 1: 3–11
Lu XP (2016) Analysis of resistance related pathway and screening of SSR molecular markers in Porphyra yezoensis. PhD Thesis, University of Chinese Academy of Sciences, China 98pp.
Lu, C.F. and Zhu, L.H. (1995). Marker-assisted selection in plant breeding. Progress in Biotechnology 15: 11–17.
Luo B, Sun HY, Xu GM, Yang ZG, Shen ZG, Gu WW, Gao Y, Zhen JL (2013) Research progress of SSR molecular marker. Journal of Anhui Agri 41: 5210–5212, 5246.
Luo K, Lu HX, Wu ZD, Wu XL, Yin W, Tang DB, Wang JC, Zhang K (2016) Genetic diversity and population structure analysis of main sweet potato breeding parents in Southwest China. Scientia Agricultura Sinica 49: 593–608.
Luo R, Wu WL, Zhang Y, Li YH (2010) SSR marker and its application to crop genetics and breeding. Genomics and Applied Biology 29: 137–143.
Mao YX, Chen NC, Cao M, Chen R, Guan XW, Wang DM. (2019) Functional Characterization and Evolutionary Analysis of Glycine-Betaine Biosynthesis Pathway in Red Seaweed Pyropia yezoensis. Marine Drugs 17:70–82.
Mei JX, Jin DM, Jia JH, Fei XG (2000) DNA polymorphism of Porphyra yezoensis and its application to cultivar discrimination. Journal of Shandong University 35: 230–234.
Miura A. (1988). Taxonomic studies of Porphyra species cultivated in Japan, referring to their transition to the cultivated variety. J. Tokyo Univ. Fish 75: 311–325.
Nei M (1972) Genetic distance between populations. Am Nat 106: 283–292.
Nie XH, You CY, Li XF, Qin JH, Huang C, Guo HL, Wang XQ, Zhao WX, Lin ZX (2014) Construction of DNA fingerprinting and analysis of genetic diversity for Xinluzao cotton varieties. ACTA Agronomica Sinica 40: 2104–2117.
Niu DH, Li JL, Wang GL, Jiang ZY, Zhang WB, Shen YB, Feng BB (2007) The genetic diversity of mitochondrial 16S rRNA gene fragment in six populations of Sinonovacula constricta. Journal of Shanghai Fisheries University 16: 1–6.
Pan HT, Wang JJ, Wang YY, Qi ZL, Li SS (2010) Development and Mapping of EST-SSR Markers in Wheat. Scientia Agricultura Sinica 43: 452–461.
Park CS, Hwang, EK (2014) Isolation and evaluation of a strain of Pyropia yezoensis (Bangiales, Rhodophyta) resistant to red rot disease. Journal of Applied Phycology 26: 811–817.
Park EJ, Fukuda S, Endo H, Kitade Y, Saga N (2007) Genetic polymorphism within Porphyra yezoensis (Bangiales, Rhodophyta) and related species from Japan and Korea detected by cleaved amplified polymorphic sequence analysis. European Journal of Phycology 42: 29–40.
Pritchard JK, Stephens MJ, Donnelly PJ (2000) Inference of population structure using multilocus genotype data. Genetic 155: 945–959.
Qi ZC, Shen C, Han YW, Shen W, Yang M, Liu JL, Liang ZS, Li P, Fu CX (2017) Development of microsatellite loci in Mediterranean sarsaparilla (Smilax aspera; Smilacaceae) using transcriptome data. Applications in Plant Sciences 5: 1700005.
Qiao LX, Weng ML, Kong FN, Dai JX, Wang B (2007) The application of RSAP marker technique in diversity detection and germplasms identification of Porphyra. Periodical of Ocean University of China 37: 951–956.
Rungis D, Bérubé Y, Zhang J, Ralph S, Ritland CE, Ellis BE, Douglas C, Bohlmann J, Ritland K (2004) Robust simple sequence repeat markers for spruce (Picea spp.) from expressed sequence tags. Theoretical and Applied Genetics 109:1283–1294.
Shan TF, Li QX, Wang XM, Li S, Pang SJ (2019) Assessment of the Genetic Connectivity Between Farmed Populations on a Typical Kelp Farm and Adjacent Spontaneous Populations of Saccharina japonica (Phaeophyceae, Laminariales) in China. Frontiers in Marine Science 6:494.
Shan TF, Pang SJ, Wang XM, Li J, Su L (2018) Assessment of the genetic connectivity between farmed and wild populations of Undaria pinnatifida (Phaeophyceae) in a representative traditional farming region of China by using newly developed microsatellite markers. Journal of Applied Phycology 30: 2707–2714.
Sonah H, Deshmukh RK, Sharma A, Singh VP, Gupta DK, Gacche RN, Ranna JC, Singh NK, Sharma TR (2011) Genome-wide distribution and organization of microsatellites in plants: An insight into marker development in Brachypodium. PLoS One 6: e21298.
Song LS, Duan DL, Li XH, Li CX (1998) Use of RAPD for detecting and identifying Porphyra (Bangiales, Rhodophyta). Chinese Journal of Oceanology and Limnology 16:237–242.
Song QH, Zhao YF (2003) The present situation of Porphyra yezoensis cultivation in our country -- A survey of marine aquatic products in Jiangsu Province. Scientific Fish Farming: 8–9.
Sun JZ, Ning XR, Le FF, Chen WD, Zhuang DG (2010) Long term changes of biodiversity of benthic macroalgae in the intertidal zone of the Nanji Islands. Acta Ecologica Sinica 30: 106–112.
Sun X, Luo QJ, Yang R, Pei LQ (2007) ISSR analysis on genetic variation in porphyra. Oceanologia Et Limnologia Sinica 38: 141–145.
Sutherland JE, Lindstrom SC; Nelson WA, Brodie J, Lynch MDJ, Hwang MS, Choi HG, Miyata M; Kikuchi N; Oliveira MC; Farr T, Neefus C, Mols-Mortensen A, Milstein D, Müller KM (2011) A new look at an ancient order: generic revision of the Bangiales (Rhodophyta). Jounal of Phycology 47: 1131–1151.
Tanaka K, Taino S, Haraguchi H, Prendergast G, Hiraoka M (2012) Warming off southwestern Japan linked to distributional shifts of subtidal canopy-forming seaweeds. Ecology and Evolution 2: 2854–2865.
Tautz D, Schlötterer C (1994) Simple sequences. Current Opinion in Genetics and Development 4: 832–837.
Wang MQ, Hu JJ, Zhuang YY, Zhang L, Liu W, Mao YX (2007) In Silico screening for microsatellite markers from expressed sequence tags of Porphyra yezoensis (Bangiales, Rhodophyta). Journal of Ocean University of China 6: 161–166.
Wang WJ, Li XL, Sun TQ, Liang ZR, Liu FL, Sun XT, Wang FJ (2019) Effects of periodical drying and non-drying on nutrient content and desiccation tolerance of an intertidal Pyropia yezoensis strain subject to farming conditions. Journal of Applied Phycology 31:1897–1906.
Wang WJ, Sun XT, Liu FL, Liang ZR, Zhang JH, Wang FJ (2016) Effect of abiotic stress on the gameophyte of Pyropia katadae var. hemiphylla (Bangiales, Rhodophyta). Journal of Applied Phycology 28: 469–479.
Weber JL (1990) Informativeness of human poly (GT)_n polymorphisms. Genomics 7: 524–530.
Wei L (2012) Genetic diversity analysis of P. yezoensis and P. haitanensis with Simple Sequence Repeat. MSc Thesis, Ocean University of China, China 65 pp.
Weng ML, Liu B, Jin DM, Yang QK, Zhao G, Ma JH, Xu P, Duan DL, Wang B (2005) Identification of 27 Porphyra lines (Rhodophyta) by DNA fingerprinting and molecular markers. Journal of Applied Phycology 17: 91–97.
Wright S. (1978). Evolution and the genetics of populations Vol-1. University of Chicago Press, Chicago.
Xu D, Song LS, Qin S, Alessandro P, Fei XG, Zeng CK (2000) RAPD analysis of genetic variation among cultivated Porphyra. High Technology Letters 10: 1–3
Xu MJ, Mao YX, Zhang XC, Zhou XJ, Sui ZH, Zhou HL, Li JH (2006) Bioinformatic analysis of expressed sequence tags from sporophyte of Porphyra yezoensis (Bagiaceae, Rhodophyta. Progress in Natural Science 16:39–49.
Yang LE, Deng YY, Xu GP, Russell S, Lu QQ, Brodie J (2020) Redefining Pyropia (Bangiales, Rhodophyta): four new genera, resurrection of Porphyrella and description of Calidia pseudolobata sp. nov. from China. Journal of Phycology 56
Yang LE, Han XL, Zhou W, Deng YY, Xu GP, Hu CM, Zhu JY, Lu QQ, Xu JG (2016) Genetic diversity of different cultivars of Pyropia yezoensis. Guangxi Sciences 23: 241–247.
Yang R, Liu BQ, Luo QJ, Wang YJ, Zhou XC, Dai JX (2002) Genetic variation of Porphyra haitanensis by applying AFLP. High Technology Letters 12: 83–86
Yang YF (2016) Coastal Environmental Bioremediation and Seaweed Resource Utilization. Science Press. Beijing.
Yeh FC, Yang RC, Boyle T, Ye ZH, Mao JX, Yeh B, Timothy B, Mao X (1999) Popgene, version 1.32; the user-friendly shareware for population genetic analysis. Molecular Biology and Biotechnology. University of Alberta, Alberta.
Yu Y (2010) Screening of SSR from P. yezoensis and P. haitanensis and their applications on analysis of genetic polymorphism. MSc Thesis, Ocean University of China, China 58 pp.
Zhang BL, Yan XH, Huang LB (2011) Evaluation of an improved strain of Porphyra yezoensis Ueda (Bangiales, Rhodophyta) with high-temperature tolerance. Journal of Applied Phycology 23: 841–847.
Zhang DR, Zheng BF (1962) The Chinese porphyras and their ceographical distribution. Oceanologia Et Limnologia Sinica 4: 183–188
Zhang J, Liu T, Rui FP (2018) Development of EST-SSR markers derived from transcriptome of Saccharina japonica and their application in genetic diversity analysis. Journal of Applied Phycology 30: 2101–2109.
Zhao SJ (2014) Ecology of marine algae. Ocean Press, Beijing.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Genetic impact of Neopyropia yezoensis cultivation on wild populations: a case study on the typical laver culture areas in China by SSR analysis

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

1.1 Materials

1.2 Genomic DNA Extraction

1.3 Screening of microsatellite primers

1.4 Data analysis and statistics

Results

2.1 Characteristics and polymorphisms of microsatellite markers

2.2 Genetic diversity analysis of Neopyropia yezoensis populations

2.3 Gene exchange between cultivated and wild populations

Discussion

3.1 Polymorphism of the microsatellite loci

3.2 Genetic diversity of wild N. yezoensis resource in China

3.3 Genetic diversity of cultivated N. yezoensis resource in China

3.4 Comparison of diversity between cultivated and wild populations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1