Gut Microbiome Variation in Pulmonary TB Patients with Diabetes or HIV Comorbidities

doi:10.21203/rs.3.rs-1756773/v2

Download PDF

Article

Gut Microbiome Variation in Pulmonary TB Patients with Diabetes or HIV Comorbidities

https://doi.org/10.21203/rs.3.rs-1756773/v2

This work is licensed under a CC BY 4.0 License

Version 2

posted

You are reading this latest preprint version

Background: The gut microbiota is known to play critical role in shaping the host immunity, and metabolism and influences the onset and progression of both communicable and non-communicable diseases. This study assessed the gut microbiome of tuberculosis (TB) cases with diabetes mellitus (DM) or HIV comorbidities before anti-TB therapy and after the intensive phase anti-TB therapy.

Methods: Ninety cases comprising 60 TB-only, 23 TB-DM, 7 TB-HIV were recruited, among which 35 TB-only, 10 TB-DM, 5 TB-HIV were also sampled after 2 months of anti-TB treatment. Total gut microbiome was detected by 16S rRNA gene sequencing of DNA extracted from collected stool specimen. The taxonomic and functional diversity of the different groups were compared in addition to changes that could occur after 2 months antibiotics use.

Results: Compared to the healthy controls, the gut microbiome of all the TB cohorts was characterized by a significant decreased alpha diversity and significant compositional changes. All the three TB cohorts were enriched with inflammatory related microorganisms of the genera Escherichia-shigella, Streptococcus, Enterococcus and Erysipelatoclostridiumwith depletion in beneficial taxa of the genera Faecalibacterium, Bifidobacteriumand Clostridium. In pairwise comparison with the healthy controls, the TB-only cohort were enriched with Streptococcus and Erysipelatoclostridium, the TB-DM enriched with Bacteroides, and TB-HIV enriched with Escherichia-shigella, Dialister and Erysipelatoclostridium. After the intensive phase anti-TB therapy, there was general enrichment of the genera Erysipelotrichaceae_UCG 003, Veillonella and Fusobacterium.

Conclusion: Our findings show a dysbiotic gut microbiome and associated increase in the number of inflammation related microorganism in gut of TB individuals with or without comorbidity.

Funding: European and Developing Countries Clinical Trials Partnership (EDCTP) Senior Fellowship to Dorothy Yeboah-Manu (TMA-2017-GSF-1942)

Tuberculosis (TB), caused by the Mycobacterium tuberculosis complex (MTBC) is an ancient disease and the 13th cause of death globally [1]. Only about 5–10% of infected individuals progress to active TB disease in their lifetime; identified risk factors that may hasten progression to diseases [2] include malnutrition, excessive alcohol consumption, smoking, HIV- coinfection, and diabetes mellitus (DM) [3]. According to the 2021 global TB report, among the 10 million new infections recorded, 8.2% were coinfected with HIV whereas 16% were comorbid with DM [1].

The gut microbiome, described as the last organ of the human body due to specific biochemical interaction and systemic integration with the host, comprises all microbial community and their genes inhabitant in the gut [4,5]. Gut microbes perform immunomodulatory role by sending out signals that promote immune cell maturation, influencing infection risks and disease progression [6]. Short chain fatty acids (SCFA) produced by some of the normal flora of the gut [7] supports maintenance of intestinal barrier integrity and guard the host against infection and colorectal cancer [8–10]. The interaction between the gut microbes and the immune system is extremely homeostatic and carefully regulated such that in a disturbed and dysbiotic state the host immunity is negatively impacted [11].

The gut microbiota also influences distal organs such as the lungs through the gut-lung axis; early life gut depletion in Faecalibacterium, Lachnospira, and Rothia has been linked to asthma in humans [12]. Also, the gut microbiota has been shown to boost respiratory defenses through signaling granulocyte-macrophage colony-stimulating factor (GM-CSF), which accelerates pathogen clearance by alveolar macrophages via extracellular signal-regulated kinase signaling [13]. Gut dysbiosis due to infections and/or use of antimicrobials damages this gut related host response predisposing the host to illness [14]. Drug susceptible TB treatment includes narrow acting Isoniazid (H), Pyrazinamide (Z), Ethambutol (E) and broad-spectrum Rifampicin (R), (collectively termed (HZRE)), acts against a wide range of gram positive and negative organisms [15]. TB treatment is considered one of the longest antibiotic regimen globally taking a minimum of six months comprising an intensive 2-months (HRZE) phase and a continuous 4-months phase of H and R [16]. The interplay between TB and other comorbidities such as DM and HIV infection and their impact of the gut microbiome remains unclear, also the specific effects of multiple antimicrobials in both comorbid and non-comorbid.

In this study, we analyzed the variation in gut microbiome of TB patients with and without comorbidities of either HIV or DM before the start of anti-TB therapy and after the month-2 intensive phase of TB therapy. The taxonomic and functional diversity of gut microbiome of the analyzed groups were compared in addition to changes that could occur after 2 months antibiotic use in TB patients.

Ethics approval and consent to participate

The protocols for this study including consent forms and procedures for sample collection, packaging, transport as well as laboratory analysis were reviewed and approved by the institutional review board (IRB) of the Noguchi Memorial Institute for Medical Research (NMIMR), with federal-wide assurance number FWA00001824 and the Ethics Review Committee of the Korle-Bu Teaching Hospital. The study was conducted by strictly following the protocols approved by the above-mentioned regulatory bodies. Written or oral informed consents where appropriate were sought from all study participants before recruitment unto the study. All methods were performed in accordance with the relevant guidelines and regulations.

Study participants and sample collection

Gene Xpert MTB-RIF (Cepheid, USA) and chest X-ray confirmed pulmonary TB patients from a tertiary facility and a Regional Hospital in Ghana were recruited for the study. Demographic and clinical data including age, sex, history of TB, TB bacterial load, alcohol and cigarette use, previous medication and other underlining conditions were recorded using a structured questionnaire. Healthy close household contacts for healthy controls (HC) included non-active TB, non-HIV infected, and non-diabetic adults from the same household of the cases. TB confirmed participants were screened at baseline for diabetes (fasting blood sugar above 7mmol/L and HbA1c confirmatory test above 6%) and HIV ((positive rapid First Response HIV1-2.0 card test, Premier Medical Cooperation Limited, India) & positive confirmatory OraQuick rapid test (OraSure Technologies, USA)) after which stool samples were collected following standard procedures [17]. A second sample was collected 2 months after the intensive phase of anti-TB therapy (follow-up) from the case participants, whereas a one-time point sample was collected from the HC. At month 2 follow-up, sputum conversion was examined by microscopy. Only pulmonary TB patients above 18 years were enrolled in this study. Extrapulmonary TB cases and treatment defaulters were excluded from the study.

Amplification and 16SrRNA Gene Sequencing

Fresh stool samples (2.0 ml/aliquot) were frozen and stored at -80^oC prior to extraction. Microbial DNA from fecal samples was extracted using QIAGEN DNeasy PowerLyzer Power Soil kit (QIAGEN, USA) per manufacturer’s instructions. The captured DNA was then washed and eluted from the membrane and stored at 4^OC for downstream analysis.

The V3 and V4 region of the bacterial 16S ribosomal RNA (rRNA) gene was amplified by PCR using the primers (16S rRNA_V3. V4-F 5’- ACACGACGCTCTTCCGATCT CCTACGGNGGWG -3’ and V3. V4-R 5’- GACGTGTGCTCTTCCGATCT GACTACHVGGTATCTAATCC -3’). PCR reactions were performed using RocheÒ (Roche Sequencing Solutions, USA). Amplicons with the desired 450bp size after gel electrophoresis were purified and sequenced by the Illumina Miseq [18]. Using MiSeq reagents V3 & V4, 16S library preparation was performed based on Nextera XT DNA library Preparation kits (Illumina Inc, Hayward, CA, USA) [18]. Amplification of variable region 3 & 4 (V3&V4) of the 16S rRNA, barcoding, and pulling of amplicons were performed per manufacturer’s instructions [19].

Data Analysis

The Quantitative Insights into Microbial Ecology 2 (QIIME 2 version 2021.8) [20] was used to quality filter, denoise and analyze the sequences. Demultiplexed paired-end sequence reads were denoised with DADA2 into amplicon sequence variants (ASV). Samples with < 10,000 total reads were excluded from downstream analyses. Feature table and feature data summaries were generated to determine the sequence distribution per sample as well as a-diversity (abundance of ASV within a sample) and b-diversity (microbial composition between samples) analysis of the samples. Taxonomic classifications were performed using Naïve Bayesian classifier [21] against the SILVA database release 138 [22] trimmed to the V3-V4 region of the 16S rRNA gene.

Differentially abundant taxa were identified using the linear discriminant analysis (LDA) effect size (LEfSe) [23,24]. To study the predictive functions of the gut microbiome, Phylogenetic Investigation of Communities by Reconstruction of Unobserved States (PICRUSt) [25] was used to determine the predictive microbial metagenome functional abundance from 16S rRNA sequences. Subsequently predicted functional abundance were analyzed with ANOVA-like Differential Expression tool for high throughput sequencing data version 2 (ALDEx2) [26] to determine differentially abundant functional pathways. For all differential abundance analyses, rare features were removed by, as previously described (ANCOM II) [27].

Statistical analysis was performed using R 3.6.0 packages and GraphPad Prism version 9.1.1. For categorical variable comparison between groups, Fisher exact test was used and Wilcoxon rank-sum test or Kruskal Wallis test used for continuous variable. Multiple test correction was performed with Benjamini, Krieger and Yekutieli FDR correction. Statistical significance was determined at a p value less than 0.05.

Clinical characteristics of Participants

Ninety participants made up of 60 TB-only, 23 TB-DM, 7 TB-HIV and 10 healthy controls were recruited into the study, while month-2 samples were collected from only 50 (35 TB-only, 10 TB-DM and 5 TB-HIV) of the primary cases (Figure 1). Seven of the cases died by 2 months after diagnosis with remaining lost to follow-up. The median age of all recruited participants was 42 years (IQR, 28.5-54.5) which was same as that for males, while the median age for females was 43.5 (Table 1). Out of the total baseline cases 83.3% experienced weight loss, 70% had night sweats and chest pain, and 65.5% had extreme cough (Supplementary Table 1).

Table 1

Biographical and Clinical data of participants

Parameter

Number of Patients

Male

Female

Median age

43.5

Diabetics

HIV positive

18 (78.3%)

5 (71.4%)

5 (21.7%)

2 (28.6%)

Total Primary cases

TB – Only

TB – Diabetes

TB – HIV

70 (77.8%)

47 (78.3%)

18 (78.3%)

5 (71.4%)

20 (22.2%)

13 (21.7%)

5 (21.7%)

2 (28.6%)

Follow-up cases

TB – Only

TB – Diabetes

TB – HIV

Deceased

38 (76%)

27 (77.1%)

8 (80%)

3 (60%)

4 (57%)

12 (24%)

8 (22.9%)

2 (20%)

2 (40%)

3 (43%)

Bacterial load (GeneXpert)

High

Medium

Low

40 (72.7%)

13 (76.5%)

17 (94.4%)

15 (27.3%)

4 (23.5%)

1 (5.6%)

Healthy controls

3 (30%)

7 (70%)

Overview of the gut microbiome composition of Study Participant.

In both cases and healthy controls, Firmicutes was the most abundant phylum. Among the healthy controls, Firmicutes (76.4%) was driven mostly by the class Clostridia, and families Lachinospiraceae (21%) and Ruminococcaceae (16%) (Supplementary figure 1, Supplementary Table 2). The most abundant genera in the controls were Faecalibacterium (6%), and Subdoligranulum (3.6%) of the Ruminococcaceae family, Blautia (4.8%), and Agathobacter (4%) of the family Lachinospiraceae, Bifidobacterium (4.2%) of the Actinobacteriota phylum and Bifidobacteriaceae family (Figure 2a/Supplementary Table 2).

Among all the three TB cohorts, abundance in the Firmicutes was driven by genera Streptococcus (>5%), and Enterococcus (>5.3%) of the class Bacilli whilst abundance in the Proteobacteria phylum was driven by Escherichia-Shigella (>8.7%) and Klebsiella (> 19%) genera of the class Gammaproteobacteria and family Enterobacteriaceae (Figure 2b/Supplementary Table 2). Comparison of the 20 most abundant genera revealed great disparity among the TB cohorts and the healthy controls with the genera Clostridia UCG-014, Romboutsia, Oscillospiraceae-UCG-002, Ruminococcaceae-CAG-352, Dorea, Collinsella, Holdermanella, and Lachnospiraceae torques depleted in all the TB cohorts compared to the healthy controls (Figure 2a).

Diversity of gut microbiome among the TB cohorts and healthy controls

Analysis of richness using observed features to determine the number of features present within the microbial community showed significantly lower richness (P < 0.01) in all TB cohorts (TB-only, TB-DM, TB-HIV) at baseline than the healthy controls (Figure 3a). The Shannon index and Faith phylogenetic diversity showed significant reduction (P < 0.01) in alpha diversity in all three baseline study TB cohorts compared to the healthy controls (Figure 3b, 3c).

Assessment of b-diversity by weighted Unifrac revealed significant differences (P < 0.0001) between TB groups and controls (Figure 3d). Further corroborated by gut microbiome compositional segregation as shown in Principal coordinates of analysis (PCoA) of weighted Unifrac distances (Figure 3e). Among the healthy controls there was no significant difference in diversity and abundance between the males and females using both alpha and beta diversities.

We observed a trend of decreasing alpha diversity after 2 months of HRZE intervention in TB-DM and TB-HIV patient groups compared to baseline respectively, though no significance was detected (Figure 4a, 4b). Also, Beta diversity analysis showed no significant observable distinction in microbial composition between the groups (Figure 4c).

Gut microbiome composition of specific TB cohorts

In the TB-only cohort, the class Bacilli (26.92%) of the phylum Firmicutes was significantly abundant, and this was driven by the order Lactobacillales (17.4%), family Stretococcaceae and genus Streptococcus (9.5%) (Figure 5a). In addition, the genera Erysipelatoclostridium and Gamella of class Bacilli was also abundant (Figure 5a, 5b, Supplementary Figure 2). Among the TB-DM cohort compared to the healthy controls, the family Bacteriodaceae and genus Bacteriodes (7.5%) was significantly abundant in addition to the genera Erysipelatoclostridium and Lachnoclostridium of the firmicutes phylum (Figure 6a, 6b). In the TB-HIV cohort, there was significant abundance of the phylum Proteobacteria (28.9%) driven by the class Gammaproteobacteria (28.1%), family Enterobacteriaceae and genus Escherichia-Shigella (8.7%), and Klebsiella (19.1%) (Figure 7, Supplementary table 2). Also abundant was the Butyriccoccus, Clostridium sensu stricto and Romboutsia genera (Supplementary Figure 2).

Difference in microbial composition after intensive phase anti-TB therapy

Comparison of all the three TB cohorts before the start of TB therapy and after the 2-months intensive phase anti-TB therapy identified abundance of the phylum Fusobacteriota driven by the genera Fusobacterium of the family Fusobacteriaceae (Figure 8). In addition, the genera Veillonella and Erysipelotrichaceae_UCG 003 were significantly enriched after HRZE intervention (Figure 8). However, within group follow-up analysis did not reveal any significant changes in gut microbial taxa.

Gut microbial functional prediction in TB cohorts and healthy controls

Functional profiling was performed on baseline 16S rRNA sequences using PICRUSt2. A total of 4479 genes with 1350 enzyme classification numbers were predicted and mapped into 252 metabolic pathways. Discriminating functional features were detected by ALDEx2. No functional feature was detected to be significantly enriched or depleted when all TB patients were compared to controls (Supplementary Figure 4). However, when stratified by comorbidity groups, 37 KEGG ortholog features and 1 MetaCyc features were detected to be differentially abundant in TB-DM patients compared to controls (Supplementary Figure 3). Enriched KEGG features included features mapped methylmalonyl-coA-mutase, phosphoribosyl,1-2 cyclic phosphate phosphodiesterase, tRNA(fMet)-specific endonuclease Vap C, NADP-dependent-alcohol dehydrogenase (Figure 9). Metabolic function involved in isopropanol biosynthesis was detected to be significantly depleted in TB-DM patients.

The human gut microbiome is critical for the development of the host immune system and tissue homeostasis [28]. Aside the numerous beneficial roles of the microbiome within an individual, its role in the development of metabolic and infectious diseases in an altered (dysbiotic) state has been documented [29]. In this study we explored the gut microbiome dynamics in TB patients with or without HIV or diabetes comorbidities before and after intensive phase anti-TB therapy. We found that the microbiome of the TB patients was enriched with inflammatory related microbial organisms with a general increase in these organisms after at 2 months HRZE intervention.

Several studies have reported a decreased gut microbiome diversity in TB patients [30–33], similar to findings in our study which shows a significantly lower gut microbial diversity in TB patients before HRZE intervention compared to healthy controls (Figure 3a, 3b, 3c). This reduced alpha diversity persisted after 2 months of HRZE intervention especially in the comorbid cases (Figure 4a, 4b). This could be indicative that in addition to TB, compositional shifts could be occurring in a TB-comorbidity specific manner.

Firmicutes are known to be a predominant phylum in the human gut [34–36]. Likewise in this study, the most abundant phylum in both healthy controls (76.3%) and all TB patients (> 65.8%) was the phylum Firmicutes (Supplementary Figure 1). Several bacteria groups belonging to Firmicutes have the ability to utilize carbohydrates through anerobic fiber fermentation to produce short-chain fatty acids (SCFAs), such as acetates, propionate, and butyrate. These exerts immunomodulatory effects including anti-inflammatory and regulation of gut’s pH to improve the availability of calcium [37–39]. Consistent with their beneficial role in the human gut, we detected an abundance of Firmicutes driven mostly by the genera Clostridium, Faecalibacterium, Blautia and Agathobacter in the gut of the healthy individuals (Figure 2a, Supplementary Table 2). Additionally, other genera such as Romboutsia, CAG-352, Subdoligranulum, and Dialister (Figure 2a) were also among the top 20 abundant genera in the healthy individuals. Several bacteria groups belonging to the Ruminococcaceae and Lachnospiraceae families (Figure 2a) which includes major human butyrate producing gut bacterial species [39] were conspicuously low in TB patients. However, there was an abundance in other Firmicutes of the genera Streptococcus, Enterococcus, Bacteriodes and Erysipelatoclostridium in all the TB patients (Figure 1a, 1b).

In the TB-DM cohort, the genus Bacteroides was significantly abundant (Figure 6), comparable to studies which reported a positive association of Bacteroides with diabetic individuals [40–42]. The Bacteroides genera are beneficial for glucose metabolism as well as regulating the expression of tight junction genes in the colon to reduce gut permeability [42,43]. In the TB-Only cohort, the Streptococcus and Erysipelatoclostridium (Figure 5) which have been associated with high inflammatory conditions [44,45], was abundant while in the TB-HIV in addition to Erysipelatoclostridium, Escherchia-Shigella, Dialister and Corynebacterium were abundant (Figure 7). Even though most of these bacteria are beneficial in maintaining a healthy gut microbiome, their association with inflammatory conditions could pose some health risk when it is overly abundant in the gut [44].

Contradictory to other studies in Africa which reported reduced abundance in the Actinobacteriota phylum [46–48], interestingly, in this study, we observed an abundance in the Actinobacteriota phylum (9.5%) in the healthy individuals, making it the second most abundant phylum in healthy individuals in this study (Supplementary figure 1). The abundance of Actinobacteriota was driven mainly by the Bifidobacterium genera (Figure 1a, Supplementary table 2) which has been shown to be among the first microbes to colonize the human gut and very beneficial in gut homeostasis and digestion of fiber to produce SCFAs [49]. Contrarily, in all the TB cohorts, Actinobacteria was significantly decreased compared to the controls (Supplementary Figure 1).

Similar to other studies which associated Prevotella with high fiber-carbohydrate diet mostly in rural areas in sub-Saharan [50,51], we observed an abundance in the genera Prevotella as the dominant group of phylum Bacteriodota in healthy individuals. Among the TB cohorts, Prevotella was more abundant in the TB-DM cohorts (3.4%) (Supplementary table 2) allowing for some association with studies that recorded enrichment of this genera in metabolic disorders such as type 2 diabetes [52,53]. Also, in addition to Prevotella, in the TB-DM cohort, the Bacteriodes which has been reported to be positively associated with diabetes [54,55], was significantly differentially abundant in the TB-DM cohort (Figure 6).

Irrespective of the overall decrease in microorganism of the Firmicutes, Bacteroidetes and Actinobacteria phyla in all TB cohorts compared to healthy individuals, an enrichment of diverse commensal bacteria of the phylum Proteobacteria containing potential pathogenic bacteria and inflammatory related organisms and other pathobionts was observed. Specifically, the genera Escherichia- Shigella, documented to be abundant in a Ghanaian cohort [51], as well as other African populations [47,56]. Interestingly, in this study, Escherichia- Shigella was not detected as a predominant bacteria in the gut of healthy individuals (Figure 1a, 1b, Supplementary Figure 1). This may be attributable to difference in population dynamics including socioeconomic status and dietary habits; the participants in the present study were from urban communities in Accra, the capital city of Ghana, compared to participants from “peri-urban” communities in the previous study [51]. Also, a study in Korea, reported an abundance of the Proteobacteria phylum in type 2 diabetes individuals [57] but no such association was found in this study. We however observed a high abundance of Proteobacteria in TB-HIV individuals (Supplementary table 2) driven mostly by the Escherichia- Shigella family. This genera have been associated with high inflammatory activities as seen in tuberculosis allowing for proliferation of inflammatory-related microorganisms [58] which may not cause disease itself but rather serve to increase susceptibility to intestinal inflammation [45]. Additionally, abundances of Protobacteria have been associated with translocation and inflammation of HIV infected individuals [59].

Intensive phase anti-TB therapy comprises drugs with specific TB targets (HZE) and a broad-spectrum antibiotics (R) [60]. Broad spectrum antibiotics such as RIF, which are active against the majority of bacterial pathogens, could be responsible for the antibiotic associated perturbations [61].

After HRZE treatment, there was higher abundance of bacteria groups in all the follow-up groups, especially in the TB-HIV cohort (Figure 4b). There was an overall enrichment in the genera Veillonella, Erysipelatoclostridium, and Fusobacterium at follow-up compared to the baseline (Figure 8), similar to findings from a study reporting abundance of Erysipelatoclostridium in a United States population after HRZE treatment [62]. The genera Erysipelatoclostridium and Fusobacterium are known to be abundant during inflammatory and immune reducing conditions as in TB patients as well as in HIV infection and diabetes [63,64]. While Erysipelatoclostridium possess the ability to flourish during broad-spectrum antibiotic treatment [65], Fusobacterium produces chemical signals that can induce apoptosis in monocytes and macrophages through activation of free fatty acid receptors [66,67], which is also observed in gut mucosa of colorectal cancer patients [68]. Even though the significance of HRZE induced taxonomic perturbations is not well-understood majority of these bacteria have been associated with immune-inducing phenotypes relevant for TB immunity [62].

Contrary, to previous reports which identified vitamin B12 deficiency as a serious problem in diabetics [69–71] due to a negative relationship with metformin, this was not observed in our study population. We found significant abundance of methylmalonyl-CoA mutase in the gut of TB-DM patients compared to controls. This enzyme is involved in Vitamin B12 synthesis, and degradation of amino acids, short-chain fatty acids and cholesterol [72]. Thus, the abundance of this enzyme and MTB’s capacity for de novo biosynthesis of vitamin B12 [73], resulting in reports of elevated B12 vitamin in TB patients [74], could account for our observation. The abundance of methylmalonyl-CoA mutase in only TB-DM group is intriguing and could be the body’s homeostasis activity [75]. Also, a significant abundance of organisms involved in isopropanol biosynthesis in the TB-DM cohort was intriguing, since the metabolite produced is known to inhibit growth of Mycobacterium tuberculosis. However, this abundance was only detected in TB-DM cohort and not in the other TB groups. Additionally, an increase of L-rhamnose mutarotase which is involved in the L-rhamnose metabolism pathway for carbohydrate metabolism [76], and very crucial in the diabetes control [77], was abundant in the TB-DM cohorts.

This study describes a profound gut dysbiosis in TB patients with or without diabetes or HIV comorbidities compared to the healthy controls. Several opportunistic pathogens of the bacteria groups including Escherichia-shigella, Streptococcus and Enterococcus were enriched in all TB cohorts, whereas beneficial bacteria groups such as SCFA-producing bacteria were depleted. Notably, there was significant alteration in microbial population in TB-DM individuals driven mainly by Bacteriodes, Blautia and Escherichia-shigella. Further studies focused at understanding the long-term changes in the gut microbiome of comorbid groups during the entire TB treatment, and its potential impact on the treatment outcome will provide further insight on the role of gut microbiome on progression of TB.

Ethics approval and Consent to participate

Consent for publication

All authors have reviewed and given their consent for publication of this manuscript

Availability of data and materials

All the analyzed and/or generated data in this study are included in this article and its supplementary information files. The V3/V4 sequence data have been submitted to the NCBI Sequence Read Archive (SRA) with study ID PRJNA876282 (http://www.ncbi.nlm.nih.gov/bioproject/876282) for easy access by the scientific community. All other protocols and algorithms used for this study are available upon written request to the corresponding author.

Competing interests

None declared

Funding

Dorothy Yeboah-Manu is a GSK-EDCTP Senior Fellow (TMA.2017.GSF.1942-TB-DM). Dorothy Yeboah-Manu acknowledge support from the EU- EDCTP funded PANDORA-ID-NET. Isaac Darko Otchere is ecipient of the Crick African Network African Career Accelerator award [CAN/C00008/1]

Authors' contributions

PM: Formal analysis, investigation, writing - review and editing

PKP: Formal analysis, review and editing

DON: Formal analysis, investigation, review and editing

AAB: Sample collection, review and editing

PA: Investigation, review, and editing

INKL: Sample collection, Investigation, review, and editing

CNG: Investigation, review, and editing

EA: Sample collection, Investigation, review, and editing

AAP: Supervision, methodology, writing - review and editing

IDO: Supervision, methodology, formal analysis, writing - review and editing

SYA: Investigation, review, and editing

DYM: Conceptualization, data curation, provision of resources, supervision, methodology, review, and editing

Acknowledgements

The authors express their gratitude to all laboratory staff of the Chest and Diabetic Clinics of the Korle-Bu Teaching hospital from where samples were collected. In addition, we appreciate the study participants for their consent to be part of this study. We acknowledge the Bacteriology Department of the Noguchi Memorial Institute for medical Research for the laboratory space and equipment provided for this study. We also acknowledge the European and Developing Countries Clinical Trials Partnership (EDCTP)-GSK Senior Fellowship to Dorothy Yeboah-Manu (TMA-2017-GSF-1942) which supported this study.

WHO. Global TB Report. 2021 [cited 2022 Jan 21]; ;: https://www.who.int/news-room/fact-sheets/detail/tuberculosis
Flynn JL, Chan J. Tuberculosis: Latency and Reactivation. Infection and Immunity . American Society for Microbiology (ASM); 2001 [cited 2021 Dec 17];69:4195. ;: /pmc/articles/PMC98451/
Narasimhan P, Wood J, Macintyre CR, Mathai D. Risk factors for tuberculosis. Pulmonary Medicine. Hindawi Publishing Corporation; 2013. ;: /pmc/articles/PMC3583136/
Dumas A, Corral D, Colom A, Levillain F, Peixoto A, Hudrisier D, et al. The Host Microbiota Contributes to Early Protection Against Lung Colonization by Mycobacterium tuberculosis. Front Immunol; 2018; https://pubmed.ncbi.nlm.nih.gov/30487801/
Kim M, Benayoun BA. The microbiome: An emerging key player in aging and longevity. Translational Medicine of Aging. Elsevier; 2020;4:103–16.
Hu Y, Yang Q, Liu B, Dong J, Sun L, Zhu Y, et al. Gut microbiota associated with pulmonary tuberculosis and dysbiosis caused by anti-tuberculosis drugs. Journal of Infection . W.B. Saunders Ltd; 2019; https://doi.org/10.1016/j.jinf.2018.08.006
Makki K, Deehan EC, Walter J, B€ Ackhed F. Cell Host & Microbe The Impact of Dietary Fiber on Gut Microbiota in Host Health and Disease. Cell Host and Microbe. 2018; https://doi.org/10.1016/j.chom.2018.05.012
Peng L, Li ZR, Green RS, Holzman IR, Lin J. Butyrate Enhances the Intestinal Barrier by Facilitating Tight Junction Assembly via Activation of AMP-Activated Protein Kinase in Caco-2 Cell Monolayers. The Journal of Nutrition. Oxford Academic; 2009; https://academic.oup.com/jn/article/139/9/1619/4670520
Lewis K, Lutgendorff F, Phan V, Söderholm JD, Sherman PM, McKay DM. Enhanced translocation of bacteria across metabolically stressed epithelia is reduced by butyrate†. Inflammatory Bowel Diseases. Oxford Academic; 2010; https://academic.oup.com/ibdjournal/article/16/7/1138/4628425
den Besten G, van Eunen K, Groen AK, Venema K, Reijngoud DJ, Bakker BM. The role of short-chain fatty acids in the interplay between diet, gut microbiota, and host energy metabolism. Journal of Lipid Research. American Society for Biochemistry and Molecular Biology; 2013; /pmc/articles/PMC3735932/
Honda K, Littman DR. The microbiota in adaptive immune homeostasis and disease. Nature; 2016; https://pubmed.ncbi.nlm.nih.gov/27383982/
Barcik W, Boutin RCT, Sokolowska M, Finlay BB. The Role of Lung and Gut Microbiota in the Pathology of Asthma. Immunity. Elsevier; 2020; /pmc/articles/PMC7128389/
Brown RL, Sequeira RP, Clarke TB. The microbiota protects against respiratory infection via GM-CSF signaling. Nat Commun; 2017; https://pubmed.ncbi.nlm.nih.gov/29142211/
Sood U, Bajaj A, Kumar R, Khurana S, Kalia VC. Infection and Microbiome: Impact of Tuberculosis on Human Gut Microbiome of Indian Cohort. Indian J Microbiol; 2018; https://pubmed.ncbi.nlm.nih.gov/29434408/
Diallo D, Somboro AM, Diabate S, Baya B, Kone A, Sarro YS, et al. Antituberculosis Therapy and Gut Microbiota: Review of Potential Host Microbiota Directed-Therapies. Frontiers in Cellular and Infection Microbiology; 2021; /pmc/articles/PMC8688706/
CDC. Treatment for TB Disease; 2016; https://www.cdc.gov/tb/topic/treatment/tbdisease.htm
Thomas V, Clark J, Doré J. Fecal microbiota analysis: an overview of sample collection methods and sequencing strategies. Future Microbiol . Future Microbiol; 2015 [cited 2022 Feb 6];10:1485–504. ;: https://pubmed.ncbi.nlm.nih.gov/26347019/
Illumina. 16 S Metagenomic sequencing Library preparation; https://web.uri.edu/gsc/files/16s-metagenomic-library-prep-guide-15044223-b.pdf
de Muinck EJ, Trosvik P, Gilfillan GD, Hov JR, Sundaram AYM. A novel ultra high-throughput 16S rRNA gene amplicon sequencing library preparation method for the Illumina HiSeq platform. Microbiome; 2017; https://pubmed.ncbi.nlm.nih.gov/28683838/
Bolyen E, Rideout JR, Dillon MR, Bokulich NA, Abnet CC, Al-Ghalith GA, et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat Biotechnol; 2019; https://pubmed.ncbi.nlm.nih.gov/31341288/
Ziemski M, Wisanwanichthan T, Bokulich NA, Kaehler BD. Beating Naive Bayes at Taxonomic Classification of 16S rRNA Gene Sequences. Frontiers in Microbiology. Frontiers Media S.A.; 2021.
McLaren MR. Silva SSU taxonomic training data formatted for DADA2 (Silva version 138). 2020; https://zenodo.org/record/3986799
Mandal S, Treuren W van, White RA, Eggesbø M, Knight R, Peddada SD. Analysis of composition of microbiomes: a novel method for studying microbial composition. Microbial Ecology in Health and Disease . Taylor & Francis; 2015; /pmc/articles/PMC4450248/
Segata N, Izard J, Waldron L, Gevers D, Miropolsky L, Garrett WS, et al. Metagenomic biomarker discovery and explanation. Genome Biol . Genome Biol; 2011; https://pubmed.ncbi.nlm.nih.gov/21702898/
Langille MGI, Zaneveld J, Caporaso JG, McDonald D, Knights D, Reyes JA, et al. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nat Biotechnol; 2013; https://pubmed.ncbi.nlm.nih.gov/23975157/
Fernandes AD, Macklaim JM, Linn TG, Reid G, Gloor GB. ANOVA-Like Differential Expression (ALDEx) Analysis for Mixed Population RNA-Seq. PLOS ONE . Public Library of Science; 2013; https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0067019
Lin H, Peddada S das. Analysis of compositions of microbiomes with bias correction. Nature Communications 2020; https://www.nature.com/articles/s41467-020-17041-7
Chunxi L, Haiyue L, Yanxia L, Jianbing P, Jin S. The Gut Microbiota and Respiratory Diseases: New Evidence. Journal of Immunology Research. Hindawi Limited; 2020; /pmc/articles/PMC7415116/
Guinane CM, Cotter PD. Role of the gut microbiota in health and chronic gastrointestinal disease: understanding a hidden metabolic organ. Therapeutic Advances in Gastroenterology. SAGE Publications; 2013; /pmc/articles/PMC3667473/
Cao D, Liu W, Lyu N, Li B, Song W, Yang Y, et al. Gut Mycobiota Dysbiosis in Pulmonary Tuberculosis Patients Undergoing Anti-Tuberculosis Treatment. Microbiology Spectrum. American Society for Microbiology; https://journals.asm.org/doi/full/10.1128/spectrum.00615-21
Hu Y, Feng Y, Wu J, Liu F, Zhang Z, Hao Y, et al. The gut microbiome signatures discriminate healthy from pulmonary tuberculosis patients. Frontiers in Cellular and Infection Microbiology; 2019.
Luo M, Liu Y, Wu P, Luo DX, Sun Q, Zheng H, et al. Alternation of gut microbiota in patients with pulmonary tuberculosis. Frontiers in Physiology; 2017.
Wang S, Yang L, Hu H, Lv L, Ji Z, Zhao Y, et al. Characteristic gut microbiota and metabolic changes in patients with pulmonary tuberculosis. Microbial Biotechnology; 2022; https://onlinelibrary.wiley.com/doi/full/10.1111/1751-7915.13761
Arumugam M, Raes J, Pelletier E, Paslier D le, Yamada T, Mende DR, et al. Enterotypes of the human gut microbiome. Nature . Nature; 2011; https://pubmed.ncbi.nlm.nih.gov/21508958/
Qin J, Li R, Raes J, Arumugam M, Burgdorf KS, Manichanh C, et al. A human gut microbial gene catalogue established by metagenomic sequencing. Nature; 2010; https://pubmed.ncbi.nlm.nih.gov/20203603/
Morton ER, Lynch J, Froment A, Lafosse S, Heyer E, Przeworski M, et al. Variation in Rural African Gut Microbiota Is Strongly Correlated with Colonization by Entamoeba and Subsistence. PLOS Genetics; 2015; https://journals.plos.org/plosgenetics/article?id=10.1371/journal.pgen.1005658
Broekaert WF, Courtin CM, Verbeke K, van de Wiele T, Verstraete W, Delcour JA. Prebiotic and other health-related effects of cereal-derived arabinoxylans, arabinoxylan-oligosaccharides, and xylooligosaccharides. Crit Rev Food Sci Nutr 2011; https://pubmed.ncbi.nlm.nih.gov/21328111/
Teitelbaum JE, Walker WA. Nutritional impact of pre- and probiotics as protective gastrointestinal organisms. Annu Rev Nutr; 2002; https://pubmed.ncbi.nlm.nih.gov/12055340/
Venegas DP, de La Fuente MK, Landskron G, González MJ, Quera R, Dijkstra G, et al. Short chain fatty acids (SCFAs)mediated gut epithelial and immune regulation and its relevance for inflammatory bowel diseases. Frontiers in Immunology; 2019.
Sircana A, Framarin L, Leone N, Berrutti M, Castellino F, Parente R, et al. Altered Gut Microbiota in Type 2 Diabetes: Just a Coincidence? . Current Diabetes Reports; 2018; https://pubmed.ncbi.nlm.nih.gov/30215149/
Sharma S, Tripathi P. Gut microbiome and type 2 diabetes: where we are and where to go? . Journal of Nutritional Biochemistry. Elsevier Inc.; 2019 [cited 2021 Mar 26]. p. 101–8. ;: https://doi.org/10.1016/j.jnutbio.2018.10.003
Gurung M, Li Z, You H, Rodrigues R, Jump DB, Morgun A, et al. Role of gut microbiota in type 2 diabetes pathophysiology . EbioMedicine; 2020; https://doi.org/10.1016/j.ebiom.2019.11.051
Yoshida N, Emoto T, Yamashita T, Watanabe H, Hayashi T, Tabata T, et al. Bacteroides vulgatus and Bacteroides dorei Reduce Gut Microbial Lipopolysaccharide Production and Inhibit Atherosclerosis. Circulation; 2018; https://pubmed.ncbi.nlm.nih.gov/30571343/
Wang J, Chen W-D, Wang Y-D. The Relationship Between Gut Microbiota and Inflammatory Diseases: The Role of Macrophages. Frontiers in Microbiology; 2020.
Zeng MY, Inohara N, Nuñez G. Mechanisms of inflammation-driven bacterial dysbiosis in the gut. Mucosal Immunol; 2017 https://pubmed.ncbi.nlm.nih.gov/27554295/
Costea PI, Hildebrand F, Manimozhiyan A, Bäckhed F, Blaser MJ, Bushman FD, et al. Enterotypes in the landscape of gut microbial community composition. Nat Microbiol;2018 https://pubmed.ncbi.nlm.nih.gov/29255284/
de Filippo C, di Paola M, Ramazzotti M, Albanese D, Pieraccini G, Banci E, et al. Diet, environments, and gut microbiota. A preliminary investigation in children living in rural and Urban Burkina Faso and Italy. Frontiers in Microbiology; 2017
Zoetendal EG, Rajilić-Stojanović M, de Vos WM. High-throughput diversity and functionality analysis of the gastrointestinal tract microbiota. Gut; 2008; https://pubmed.ncbi.nlm.nih.gov/18941009/
O’Callaghan A, van Sinderen D. Bifidobacteria and Their Role as Members of the Human Gut Microbiota. Frontiers in Microbiology; 2016; /pmc/articles/PMC4908950/
de Filippo C, Cavalieri D, di Paola M, Ramazzotti M, Poullet JB, Massart S, et al. Impact of diet in shaping gut microbiota revealed by a comparative study in children from Europe and rural Africa. Proc Natl Acad Sci U S A; 2010; https://pubmed.ncbi.nlm.nih.gov/20679230/
Parbie PK, Mizutani T, Ishizaka A, Kawana-Tachikawa A, Runtuwene LR, Seki S, et al. Fecal Microbiome Composition in Healthy Adults in Ghana. Jpn J Infect Dis; 2021; https://pubmed.ncbi.nlm.nih.gov/32611986/
Ding X, Zhou J, Chai Y, Yan Z, Liu X, Dong Y, et al. A metagenomic study of the gut microbiome in PTB’S disease. Microbes and Infection. Elsevier Masson; 2022.
Precup G, Vodnar DC. Gut Prevotella as a possible biomarker of diet and its eubiotic versus dysbiotic roles: a comprehensive literature review. Br J Nutr; 2019; https://pubmed.ncbi.nlm.nih.gov/30924428/
Murphy R, Tsai P, Jüllig M, Liu A, Plank L, Booth M. Differential Changes in Gut Microbiota After Gastric Bypass and Sleeve Gastrectomy Bariatric Surgery Vary According to Diabetes Remission. Obes Surg; 2017; https://pubmed.ncbi.nlm.nih.gov/27738970/
Wu H, Esteve E, Tremaroli V, Khan MT, Caesar R, Mannerås-Holm L, et al. Metformin alters the gut microbiome of individuals with treatment-naive type 2 diabetes, contributing to the therapeutic effects of the drug. Nat Med; 2017; https://pubmed.ncbi.nlm.nih.gov/28530702/
Mancabelli L, Milani C, Lugli GA, Turroni F, Ferrario C, van Sinderen D, et al. Meta-analysis of the human gut microbiome from urbanized and pre-agricultural populations. Environ Microbiol; 2017; https://pubmed.ncbi.nlm.nih.gov/28198087/
Shin NR, Whon TW, Bae JW. Proteobacteria: Microbial signature of dysbiosis in gut microbiota. Trends in Biotechnology. Elsevier Ltd; 2015; http://www.cell.com/article/S0167779915001390/fulltext
Eribo OA, du Plessis N, Ozturk M, Guler R, Walzl G, Chegou NN. The gut microbiome in tuberculosis susceptibility and treatment response: guilty or not guilty? Cellular and Molecular Life Sciences; 2020 /pmc/articles/PMC7162824/
Parbie PK, Mizutani T, Ishizaka A, Kawana-Tachikawa A, Runtuwene LR, Seki S, et al. Dysbiotic Fecal Microbiome in HIV-1 Infected Individuals in Ghana. Frontiers in Cellular and Infection Microbiology; 2021; /pmc/articles/PMC8168436/
Jnawali HN, Ryoo S. First– and Second–Line Drugs and Drug Resistance. Tuberculosis - Current Issues in Diagnosis and Management . IntechOpen; 2013; https://www.intechopen.com/chapters/43723
Dethlefsen L, Relman DA. Incomplete recovery and individualized responses of the human distal gut microbiota to repeated antibiotic perturbation. Proc Natl Acad Sci U S A . National Academy of Sciences; 2011; /pmc/articles/PMC3063582/
Wipperman MF, Fitzgerald DW, Antoine M, Juste J, Taur Y, Namasivayam S, et al. Antibiotic treatment for Tuberculosis induces a profound dysbiosis of the microbiome that persists long after therapy is completed. 2017; www.nature.com/scientificreports/
Etna MP, Giacomini E, Severa M, Coccia EM. Pro- and anti-inflammatory cytokines in tuberculosis: A two-edged sword in TB pathogenesis. Seminars in Immunology. Academic Press; 2014.
Neuhaus J, Jacobs DR, Baker J v., Calmy A, Duprez D, Rosa A la, et al. Markers of Inflammation, Coagulation, and Renal Function Are Elevated in Adults with HIV Infection. The Journal of Infectious Diseases; 2010 https://academic.oup.com/jid/article/201/12/1788/794283
Dinh DM, Volpe GE, Duffalo C, Bhalchandra S, Tai AK, Kane A v, et al. Intestinal Microbiota, Microbial Translocation, and Systemic Inflammation in Chronic HIV Infection. 2014; http://qiime.org
Lee SC, Chua LL, Yap SH, Khang TF, Leng CY, Raja Azwa RI, et al. Enrichment of gut-derived Fusobacterium is associated with suboptimal immune recovery in HIV-infected individuals. Scientific Reports 2018 8:1 . Nature Publishing Group; 2018 [cited 2022 Apr 8];8:1–10. ;: https://www.nature.com/articles/s41598-018-32585-x
Gu X, Song L, Li L, Liu T, Zhang M, Li Z, et al. Fusobacterium nucleatum Causes Microbial Dysbiosis and Exacerbates Visceral Hypersensitivity in a Colonization-Independent Manner. Frontiers in Microbiology. Frontiers; 2020.
Kelly D, Yang L, Pei Z. Gut Microbiota, Fusobacteria, and Colorectal Cancer. Diseases . Multidisciplinary Digital Publishing Institute (MDPI); 2018; /pmc/articles/PMC6313651/
Kibirige D, Mwebaze R. Vitamin B12 deficiency among patients with diabetes mellitus: is routine screening and supplementation justified? J Diabetes Metab Disord; 2013; https://pubmed.ncbi.nlm.nih.gov/23651730/
Liu KW, Dai LK, Jean W. Metformin-related vitamin B12 deficiency. Age and Ageing; 2006
Pflipsen MC, Oh RC, Saguil A, Seehusen DA, Topolski R. The prevalence of vitamin B12 deficiency in patients with type 2 diabetes: A cross-sectional study. Journal of the American Board of Family Medicine. 2009;22:528–34.
Blum M, Chang HY, Chuguransky S, Grego T, Kandasaamy S, Mitchell A, et al. The InterPro protein families and domains database: 20 years on. Nucleic Acids Research. Oxford University Press; 2021.
Gopinath K, Moosa A, Mizrahi V, Warner DF. Vitamin B(12) metabolism in Mycobacterium tuberculosis. Future Microbiol; 2013; https://pubmed.ncbi.nlm.nih.gov/24199800/
Gebremicael G, Alemayehu M, Sileshi M, Geto Z, Gebreegziabxier A, Tefera H, et al. The serum concentration of vitamin B12 as a biomarker of therapeutic response in tuberculosis patients with and without human immunodeficiency virus (HIV) infection. International Journal of General Medicine; 2019 /pmc/articles/PMC6759284/
Takahashi Y, Takayama S, Itou T, Owada K, Omori Y. Effect of glycemic control on vitamin B12 metabolism in diabetes mellitus. Diabetes Res Clin Pract; 1994; https://pubmed.ncbi.nlm.nih.gov/7835207/
Ryu KS, Kim JI, Cho SJ, Park D, Park C, Cheong HK, et al. Structural insights into the monosaccharide specificity of Escherichia coli rhamnose mutarotase. Journal of Molecular Biology. Academic Press; 2005.
Solis-Herrera C, Triplitt C, Cersosimo E, DeFronzo RA. Pathogenesis of Type 2 Diabetes Mellitus. MDText.com, Inc.; 2021; https://www.ncbi.nlm.nih.gov/books/NBK279115/

No competing interests reported.

Supplementarydata.docx

Download PDF

Version 2

posted

You are reading this latest preprint version

Gut Microbiome Variation in Pulmonary TB Patients with Diabetes or HIV Comorbidities

Status:

Version 2

Abstract

Figures

Introduction (Background)

Methods

Results

Discussion

Conclusion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 2