An extracellular Cu/Zn superoxide dismutase from Neocaridina denticulata sinensis: cDNA cloning, mRNA expression and characterizations of recombinant protein

doi:10.21203/rs.3.rs-1761839/v1

Download PDF

Research Article

An extracellular Cu/Zn superoxide dismutase from Neocaridina denticulata sinensis: cDNA cloning, mRNA expression and characterizations of recombinant protein

https://doi.org/10.21203/rs.3.rs-1761839/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 01 Sep, 2022

Read the published version in Fish & Shellfish Immunology →

Version 1

posted

You are reading this latest preprint version

Background: Neocaridina denticulata sinensis possesses characters of rapid growth, tenacious vitality, short growth cycle, transparent, and easy feeding. Therefore, it is gradually being developed into an animal model for basic research on decapod crustaceans. Superoxide dismutase (SOD) family, the first line of defense to eliminate ROS, can catalyze ROS into O₂ and H₂O₂. Particularly, Cu/Zn-SOD accounts for about 90% of total SOD, which play an important role in many creatures. Nevertheless, only a small number of related reports have cloned and characterized Cu/Zn-SOD in decapod crustaceans. Herein, a Cu/Zn superoxide dismutase (Cu/Zn-SOD), named as Nd-ecCu/Zn-SOD, was identified and characterized from N. denticulata sinensis.

Results: The full-length cDNA sequence of Nd-ecCu/Zn-SOD is 829 bp containing a 684 bp open reading frame, which encoded a protein of 227 amino acid residues with a typical Sod_Cu domain. The quantitative real-time PCR analysis showed that Nd-ecCu/Zn-SOD mRNA was expressed in all the tested tissues. Under challenge with copper, the mRNA expression of Nd-ecCu/Zn-SOD reached the maximum at 6 h, and decreased until 24 h. After 24 h of exposure, its expression was up-regulated significantly at 36 h. After then its expression sharply decreased with a comeback at 48 h. The expression of Nd-ecCu/Zn-SOD in gills challenged with Vibrio parahaemolyticus changed in a time-dependent manner. In addition, Nd-ecCu/Zn-SOD was recombinantly expressed using E. coli and the recombinant protein was purified as a single band on SDS-PAGE. The recombinant Nd-ecCu/Zn-SOD (rNd-ecCu/Zn-SOD) existed enzymatic activity under a wide range of temperature and pH. The exposure of metal ions was found that Zn²⁺, Mg²⁺, Ca²⁺, Ba²⁺, and Cu²⁺ could inhibit the enzymatic activity of rNd-ecCu/Zn-SOD, and Mn²⁺increased the enzymatic activity of rNd-ecCu/Zn-SOD.

Conclusions: the recombinant protein was sensitive to change of pH and addition of different metal ions, and the expression of Nd-ecCu/Zn-SOD challenged with V. parahaemolyticus and exposure of Cu²⁺changed in a time-dependent manner. The results indicated that Nd-ecCu/Zn-SOD might sever as a biomarker of environment pollution and plays an important role in immune reaction.

Neocaridina denticulata sinensis

extracellular Cu/Zn-SOD

enzymatic activity

Reactive oxygen species (ROS), including superoxide anion (O-2), hydrogen peroxide (H₂O₂) and hydroxyl radical (·OH), plays a dual role in organisms [1, 2]. It boasts a capability of preventing foreign objects from invading and act as signal molecules in a low level [3]. However, the accumulation of ROS brings about some severe damages, such as causing many diseases [4] and damaging to macromolecules [5].

Many factors cause organisms to produce ROS, such as low temperature [6, 7], pollutants [8], inflammation [9], respiration [10] and so on. There are some antioxidant systems that maintain dynamic balance of ROS in aquatic species. Superoxide dismutase (SOD) family, the first line of defense to eliminate ROS, can catalyze ROS into O₂ and H₂O₂ [11, 12]. Then, H₂O₂ is further catalyzed to H₂O and O₂ by peroxiredoxin, catalases and peroxidases [13].

SODs are divided into four different types, according to the metal ions bound [4, 7, 14, 15], namely, Cu/Zn-SOD, Mn-SOD, Fe-SOD, and Ni-SOD. Particularly, Cu/Zn-SOD accounts for about 90% of total SOD, which can be found in many creatures. Nevertheless, only a small number of related reports have cloned and characterized Cu/Zn-SOD in decapod crustaceans [2, 16]. Each subunit of Cu/Zn-SOD includes one Cu²⁺ and one Zn²⁺ binding sites. Namely, Cu²⁺ acts an important role in redox reactions and Zn²⁺ keeps the structural stability of the enzyme [15]. Cu/Zn-SOD is divided into extracellular Cu/Zn-SOD (ecCu/Zn-SOD) or intracellular Cu/Zn-SOD (icCu/Zn-SOD) depending on the existence N-terminal signal peptide [17].

Vibrio parahaemolyticus, a common pathogenic to crustaceans [2], can result in acute hepatopancreatic necrosis syndrome or early mortality syndrome [18], which leads to severely economic losses in the shrimp industry in China [19, 20]. Consequently, it is necessary to prevent and control invasion of V. parahaemolyticus. ROS is early response of host innate immunity, and it can be produced in reaction to microbial pathogens [21]. When pathogens invade, the host can generate a lot of ROSs to kill the invader [22]. It is reported that SOD could be regarded as an indicator of immune response to pathogens [19]. However, there was very limited information about molecular immune responses after shrimp were challenge with V. parahaemolyticus [19]. Gill is an important tissue in preventing the invasion of pathogen. In view of the above, gills of shrimp were selected as a typical tissue for illustration of temporal expression profiles of Nd-ecCu/Zn-SOD after challenge by V. parahaemolyticus.

Neocaridina denticulata sinensis has the characteristics of rapid growth, tenacious vitality, short growth cycle, transparent carapace and body [23, 24], and easy feeding [25, 26]. Based on its these characterizations, it is gradually being developed into one of the most common organisms to study the freshwater environment [27, 28]. Recently, CuSO₄ is excessively used as chemical pesticides, which lead to Cu²⁺ amassment in crustacean creatures [29]. It is said that Cu²⁺ accumulation contributes to generation amounting of ROS [30]. Additionally, due to the habitat of benthic invertebrates, there are quickly responsive to changes of water surroundings [31]. Therefore, they can be used as biomarkers that indicate water pollution. In this study, N. denticulata sinensis was selected as a model to study the function of extracellular Cu/Zn-SOD of decapod crustaceans. The full-length cDNA sequence of extracellular Cu/Zn-SOD (Nd-ecCu/Zn-SOD) gene was obtained from the N. denticulata sinensis and the expression profile in different tissues and under Cu²⁺ exposure was clarified. In addition, the recombinant Nd-ecCu/Zn-SOD was prepared using E. coli system and the enzymatic characterization of the purified was furtherly studied.

Experimental animals

N. denticulata sinensis was purchased from a local aquaculture center in Anxin County, Baoding, Hebei Province. In this study, shrimp (1.5 ± 0.5 cm) were reared in recycling system in which had enough oxygen that kept shrimp normal to grow, under the temperature 25 ± 1 °C. Shrimp were fed with commercial diet twice one day.

The different tissues of shrimp were collected with sterile scissors and tweezers. The intestines, muscles, gonads, gills, stomachs, hearts, eyestalks and hepatopancreases of N. denticulata sinensis were collected respectively. The tissues were frozen with liquid nitrogen and stored at - 80 °C. Under exposure of 2.5 μmol/L of Cu²⁺ in different times (0 h, 6 h, 12 h, 24 h, 36 h, 48 h, 72 h) of hepatopancreases were also collected and stored at - 80 °C until use. V. parahaemolyticus, gifted by Dr. Qingli Zhang from Yellow Sea Fisheries Research Institute, CAFS, was cultured in LB broth at 28 °C for 12 h. The culture medium was discarded by centrifugation, and density of V. parahaemolyticus was resuspended in PBS to 1×10⁶ CFU/mL. Then, 5 μL of diluted V. parahaemolyticus suspension was injected to healthy N. denticulata sinensis. At 0 h, equal volume PBS was also injected to shrimp as the blank control group. At 0 h, 6 h, 12 h, 24 h, 36 h, 24 h, and 72 h post-infection, gills were collected. All of these sample were immediately put into liquid nitrogen for RNA extraction.

Gene cloning

Total RNA was extracted with RNAiso Plus (TaKaRa, Dalian) according to the manufacture’s protocol from N. denticulata sinensis and the integrity of the RNA was performed usage a NanoDrop 2000c (Thermo Scientific, USA). Then, it was reversed into cDNA with HiScript^® III 1st Strand cDNA Synthesis Kit (+gDNA wiper) (Vazyme, Nanjing) following the manufacture’s instruction.

Based on our transcriptomic and genomic data analysis of N. denticulata sinensis, the PCR primers were designed (Table 1) to clone Nd-ecCu/Zn-SOD gene. PCR reaction system: 10× Buffer 2 μL, dNTPs 1.6 μL, rTaq 0.2 μL (TaKaRa Taq^TM, 5 U/μL), the cDNA 1 μL, 0.4 μL Nd-ecCu/Zn-SOD-F₀/R (10 mM) and adding ddH₂O to 20 μL. The nested PCR for Nd-ecCu/Zn-SOD was implemented according to the program of 6 cycles of 95 °C for 3 min, 95 °C for 20 s, 61 °C for 20 s and 72 °C for 2 min. And then program of 20 cycles of 95 °C for 20 s, 55 °C for 20 s and 72 °C for 2 min, following by an extension of 72 °C for 5 min. The product was diluted 100 times as a template, and primers Nd-ecCu/Zn-SOD-F/R₂ were used for the next procedure.

Nested PCR amplification products were analyzed by electrophoresis with 1% (w/v) agarose gel electrophoresis. The target band were cut and recovered with DNA Gel/PCR Purification Miniprep Kit (BIOMIGA^®, Hangzhou), according to the manufacture’s instruction. Then, the products were ligated to pMD19-T vector (TaKaRa, Dalian) at 16 °C for 30 min. The product (pMD19-Nd-ecCu/Zn-SOD) was transformed into E. coli DH 5α competent cells and cultured overnight at 37 °C on LB plate containing 100 μg/mL ampicillin. DNA sequencing was performed by Beijing Liuhe Huada Genomics Technology Co., Ltd.

Bioinformatics analysis of Nd-ecCu/Zn-SOD

The nucleotide sequence and deduced amino acid sequence of Nd-ecCu/Zn-SOD were analyzed via online website BLAST. Theoretical isoelectric point (pI) and molecular weight (MW) were predicted through the online website ExPASy. Other characterizations, such as outlier homologues and homologues of known structure, PFAM domain, signal peptides and internal repeats, were predicted through online tool SMART. The homologous sequences were downloaded from NCBI website. Spatial structure visualized through Swiss-model and then phylogenetic tree was built through MEGA 11.0 [32].

Quantitative real-time PCR (qRT-PCR) analysis of Nd-ecCu/Zn-SOD mRNA expression

Total RNA was extracted from the above collective samples using RNAiso Plus according to the manufacture’s protocol. The quality of total RNA was detected by using agarose gel electrophoresis. Immediately, the total RNA was reverse transcription with HiScript^® II Q Select RT SuperMIX for qPCR Kit (+gDNA wiper) (Vazyme, Nanjing) following the manufacture’s instruction into cDNA for qRT-PCR. qRT-PCR was used to analyze the distribution of Nd-ecCu/Zn-SOD in different tissues and the expression in different time periods after copper ion stimulation using CFX96^TM real-time PCR system (Bio-Rad, USA). 18s rRNA was used as an internal reference gene. The reaction system of qRT-PCR was 10 μL volume including 5 μL 2× Universal SYBR Green Fast qPCR Mix (ABclonal^®Technology, Wuhan), 0.2 μL RT-Nd-ecCu/Zn-SOD-F/R (10 mM) (Table 1), and 0.5 μL cDNA. The qRT-PCR were performed according to the procedure of 1 cycle of 95 °C for 3 min; 39 cycles of 95 °C for 10 s, 56 °C for 10 s and 72 °C for 20 s. To ensure the result of reliability, the procedure was set to check the melting cure following: 68 °C for 5s, taking data every increasing 0.5 °C until 95 °C.

The primers efficiency and cycle threshold (C_T) values were calculated, and expression levels were analyzed using the comparative CT (2^−ΔΔCT) method [33].

Construction of recombinant expression plasmid pCT7-CHISP6H-Nd-ecCu/Zn-SOD and induced expression

Based on our previously constructed secretory vector pCT7-CHISP6H [34], a pair of primers pCT7-CHISP6H-Nd-ecCu/Zn-SOD-F/R (Table 1) was designed for PCR amplification and sequencing plasmid pMD19-Nd-ecCu/Zn-SOD was used as the template. The products were recovered and ligated into pCT7-CHISP6H using ABclonal MultiF Seamless Assembly Mix (ABclonal^®Technology, Wuhan) at 50 °C for 30 min. The ligated product (pCT7-CHISP6H-Nd-ecCu/Zn-SOD) was transformed into E. coli DH 5α competent cells to obtain the positive clones.

A pair of primers pCT7-CHISP6H-P-F/R (Table 1) was designed to delete the sequence encoding signal peptide on the sequencing pCT7-CHISP6H-Nd-ecCu/Zn-SOD. The PCR reaction system contains: 10 μL Prime STAR Max (TaKaRa, Dalian), 0.4 μL primers pCT7-CHISP6H-P-F/R (10 mM), 1 μL template (5 ng/mL), and adding ddH₂O to 20 μL. The products were recovered and then self-recycled using ligase at 16 °C for 1 h. The ligated product was transformed into E. coli DH 5α competent cells and cultured overnight at 37 °C on LB plate containing 100 μg/mL ampicillin. DNA sequencing was performed after PCR examination being positive clones.

Then, pCT7-CHISP6H-Nd-ecCu/Zn-SOD was transformed into E. coli BL 21 (DE3) competent cells, and then cultivated in 5 mL LB liquid medium containing 100 μg/mL ampicillin at 37 °C, until the cell concentration reached OD 600 nm of 0.6-0.8. The bacteria were induced expression for 6 h by adding IPTG with a final concentration of 200 μg/mL. During this six-hour period, sampling is taken every 2 h for 15% (w/v) SDS-PAGE analysis and stained with Coomassie brilliant blue R 250. The SDS-PAGE figure was obtained using software Quantity One (Bio-Rad, USA).

Purification of the recombinant Nd-ecCu/Zn-SOD (rNd-ecCu/Zn-SOD) and its enzymatic activity assay

Five-microliter seed solution was cultivated overnight, and then transferred into 100 mL of LB medium containing 100 μg/mL ampicillin to cultivate. As OD reached 0.6-0.8, IPTG was added to induce expression at 37 °C. Induced for 6 h, the culture was centrifuged to collect the bacterial sludge for 30 min under 4 °C, 7000 r/min. The collective bacterial sludge was suspended in PBS (containing 0.15 M NaCl and 10% (w/v) glycerol, pH 7.4) and broken via ultrasonic cell crusher (SCIENTZ, Ningbo). The supernatant was purified by Ni²⁺ affinity chromatography and its enzymatic activity was determined using Cu/Zn-SOD assay kit from Nanjing Jian Cheng Bioengineering Institute. According to the manufacture’s protocol, one unit (U) of activity was defined as amount of SOD that inhibited 50% in per mL of reaction solution by absorbance at 550 nm.

Test of stable temperature and pH of rNd-ecCu/Zn-SOD

The enzyme solution was incubated at different temperatures (from 30 °C to 85 °C) for 1 h, with 3 parallel samples for each temperature gradient, and then relative enzymatic activity was determined using copper-zinc superoxide dismutase (Cu/Zn-SOD) assay kit.

An equivalent volume of the enzyme solution was incubated at different pH (from pH 3.0 to 9.0) for 30 min at 25 °C, with 3 parallel samples for each temperature gradient, and then relative enzymatic activity was determined. The different pH buffers systems included citric acid-sodium citrate buffer (pH 4.0 and 5.0), sodium phosphate buffer (pH 6.0, 7.0, 8.0) and Tris-HCl buffer (pH 9.0).

Effect of the different metal ions on the enzymatic activity of rNd-ecCu/Zn-SOD

The different metal ions included KCl, ZnCl₂, MgCl₂, CaCl₂, BaCl₂, CuCl₂, and MnCl₂. An equivalent volume of the enzyme solution was incubated with the different metal ions at the final concentration of 20 mM for 30 min at 25 °C. Three parallels were set and then relative enzymatic activity was determined using copper-zinc superoxide dismutase (Cu/Zn-SOD) assay kit.

Statistical analysis

The statistical data were expressed as the mean ± SD (N=3). A one-way analysis of variance (ANOVA) and Duncan’s multiple tests were used for data analysis in gene expression and relative activity. The data for this study were processed by Graphpad Prism software (Version 9.0.2, San Diego, USA) [35].

Characteristics of Nd-ecCu/Zn-SOD gene and its deduced amino acid in N. denticulata sinensis

Based on the transcriptomic and genomic data of N. denticulata sinensis, the full-length cDNA sequence of Nd-ecCu/Zn-SOD was obtained (GenBank accession number: OM678462). As shown in Fig.1, the complete nucleotide sequence of Nd-ecCu/Zn-SOD was 829 bp, including 24 bp 5′-UTR, 684 bp open reading frame (ORF), and 121 bp 3′-UTR. The ORF encodes a protein of 227 amino acid residues with predicted pI 6.09 and MW 23829.86 Da. The deduced protein contained 142 aa of Sod_Cu domain predicted by SMART. There was 20 aa of signal peptides at the N-terminal (Fig. 1). Compared with the genomic data (not published), the target gene contains 3 exons and 2 introns (Fig. 2). All intron-exon boundaries were consistent with the consensus splicing junctions GT-AG rule [36].

The Swiss-model suggested that the protein was a homodimer, and each subunit with 8 β-sheets and one α-helix boasts one Cu²⁺ (His 121, His 123, His 138 and His 195) binding site as well as one Zn²⁺(His 138, His 146, His 155 and Asp 158) (Fig. 3). There were two Cu/Zn-SOD family conservational motifs, ¹⁵⁴RHVGDLGNIFAD¹⁶⁵ and ²¹²TGNAGGRVGCGVIG²²⁵, by multiple sequence alignments of Cu/Zn-SOD in crustaceans (Fig. 4). The phylogenetic analysis indicated that Nd-ecCu/Zn-SOD was embedded in the branch of Rimicaris exoculate belonging to extracellular Cu/Zn-SOD (Fig. 5).

Analysis of Nd-ecCu/Zn-SOD mRNA expression of different tissues distribution

The results of qRT-PCR showed that the mRNA expression level of Nd-ecCu/Zn-SOD were found in all tissues tested including intestine, muscle, gonad, egg, gill, stomach, heart, eyestalk and hepatopancreas. The result demonstrated that Nd-ecCu/Zn-SOD mRNA was constitutive expression in N. denticulata sinensis. The mRNA expression was the highest in gill, stomach, muscle, which was no significant difference (p > 0.05) (Fig. 6). However, the mRNA expression was the lowest in hepatopancreas, heart, eyestalk and there was no significant difference among them (p > 0.05) (Fig. 6).

Analysis of Nd-ecCu/Zn-SOD mRNA expression under exposure of Cu²⁺

Hepatopancreas is the main organ for storing or detoxifying metal ions in crustaceans. After the shrimp being exposed to Cu²⁺, the highest expression of Nd-ecCu/Zn-SOD mRNA was performed at 6 h post-exposure, and then its expression was down-regulated significantly at 24 h post-exposure. After 24 h of exposure, its expression was up-regulated significantly till 36 h (p < 0.05). After then, its expression sharply decreased with a comeback at 48 h, which was no significant difference compared with 0 h (p > 0.05) (Fig. 7).

Effects of V. parahaemolyticus challenge on Nd-ecCu/Zn-SOD mRNA expression

Based on the tissue distribution of Nd-ecCu/Zn-SOD mRNA, gill was selected as a typical tissue for illustration of expression profiles of Nd-ecCu/Zn-SOD after challenge by V. parahaemolyticus. The expression profiles of Nd-ecCu/Zn-SOD showed a change from 0 to 72 h after V. parahaemolyticus challenge (Fig. 8). The Nd-ecCu/Zn-SOD gene expression was continuously down-regulated till 12 h post-challenge, which compared with 0h. However, the Nd-ecCu/Zn-SOD gene expression was up-regulated at 24 h post-challenge to approximately 1.8-fold (p < 0.05) higher than that of the control group. Then its expression fluctuated after 48 h and had a comeback to the normal level at 72 h post-challenge (p > 0.05).

Purification of rNd-ecCu/Zn-SOD and detection of enzymatic acidity

On the SDS-PAGE gel, the target protein band appeared to about 23 kDa compared with the protein marker. After that, the recombinant protein was purified to single band on SDS-PAGE gel using Ni²⁺-NTA (Fig. 9, the raw figure shown in Supplementary Figure 1). The figure quantity of export mode was 100. Determined by the kit, its enzymatic activity was 38.94 U/mL. Through the above steps, it was preliminarily determined that the obtained recombinant protein was Nd-ecCu/Zn-SOD.

Enzymatic characterizations of rNd-ecCu/Zn-SOD

The stability of temperature assay indicated that the relative enzymatic activity of rNd-ecCu/Zn-SOD was increased at the beginning, and then the relative activity was decreased. At last, it rarely had relative activity, which was almost close to 0. The highest relative activity was about 150% at 45 °C. At 80 °C, it hardly existed relative activity. Incubated from 35 °C to 60 °C, rNd-ecCu/Zn-SOD kept high relative activity. However, incubated at 60 °C to 70 °C, its relative activity was sharply decreased (Fig. 10A).

The stability of pH assay showed that the relative activity of rNd-ecCu/Zn-SOD reached the peak at pH 5.0. By contrast, its relative activity was lowest at pH 6.0. The relative activity of rNd-ecCu/Zn-SOD was significant difference at pH from 4.0 to 9.0 (Fig. 10B).

The effects of metal ions on the relative activity of rNd-ecCu/Zn-SOD suggested that its relative activity was prompted when the rNd-ecCu/Zn-SOD was incubated at Mn²⁺, yet other metal ions inhibited its relative activity. The relative activity of rNd-ecCu/Zn-SOD was significant difference after the addition of different metal ions, while the inhibitory effect of Zn²⁺orCu²⁺ addition was much stronger than other metal ions (Table 2).

As we known, invertebrates do not possess specific immunity [37], so they have to depend on innate immune system to prevent invaders [22]. When aquatic organisms are exposed to stressful environment, their bodies generate amounting ROS against it. Although ROS are beneficial for host against stress, overmuch ROS contribute to some damages like damage of DNA, proteins, lipid peroxidation and some diseases [5, 38, 39]. SOD family is the first line to resist oxidative [40], which plays an important role to remove ROS for invertebrates. Cu/Zn-SOD has accepted extensive attentions due to ability of eliminating inordinate ROS in many aquatic organisms such as Meretrix meretrix [41], Tigriopus japonicus [36], Psychropotes longicauda [15], Cyanea capilata [42] and so on. However, there is no any report about extracellular Cu/Zn-SOD in N. denticulata sinensis.

Nd-ecCu/Zn-SOD was cloned from N. denticulata sinensis and the recombinant protein was identified using Cu/Zn-SOD assay kit. The predictive result of Swiss-model showed that Nd-ecCu/Zn-SOD belonged to a homodimer with 8 β-sheets, which was similar to that of previous reports [14, 43, 44]. Multiple sequences alignments found that Cu²⁺ binding sites (His 121, His 123, His 138 and His 195) as well as Zn²⁺ binding sites (His 138, His 146, His 155 and Asp 158) were highly conservational among Cu/Zn-SOD for crustaceans, which demonstrated to ensure the protein normal function.

The result of qRT-PCR of tissues distribution showed that Nd-ecCu/Zn-SOD expression was the highest in gill, stomach, muscle. As we known, gill of the aquatic animals directly interacts with external surroundings and form the first line against stress from environment. Gills of aquatic animals are organs of respiratory, and thus ROS was generated in gills [45]. Consequently, we suspected that N. denticulata sinensis act as biomarker to detect the change of water environment. It is said that hepatopancreas of crustaceans are places of immune molecules synthesis, and, at same time, hepatopancreas of crustaceans also are main tissues to store or degrade metal ions [22, 46]. Herein, the result of qRT-PCR of different times of hepatopancreas under exposure of Cu²⁺ indicated that expression of Nd-ecCu/Zn-SOD mRNA was up-regulated significantly to eliminate ROS during short period and after that it was rapidly decreased, which indicated that Nd-ecCu/Zn-SOD might play an important role in immune response.

V. parahaemolyticus was chosen as the infectious bacteria to research the temporal expression of Nd-ecCu/Zn-SOD. The result showed that a significant time-dependent expression pattern was found after V. parahaemolyticus infection. In crustaceans, pathogens in the hemolymph are mainly absorbed by the gills which produce physiological changes or induce injury to this organ more than other organs [20, 47]. Therefore, Nd-ecCu/Zn-SOD in gills can server as biomarker of vibriosis challenge.

The enzymatic characteristics of rNd-ecCu/Zn-SOD were also performed, which indicated that the recombinant protein existed relative activity in extensive pH and temperatures. Prediction of Nd-ecCu/Zn-SOD showed that its pI was 6.09 which illustrated why the lowest relative enzymatic activity was shown at 6.0. When recombinant protein was incubated in solution of pI, it was precipitated. When recombinant protein was incubated in different solution of pI, it expressed significant difference (p < 0.05), which indicated that rNd-ecCu/Zn-SOD was susceptible to pH values. Similarly, rNd-ecCu/Zn-SOD was susceptible to different metal ions, but its relative enzymatic activity was increased in additive Mn²⁺ solution. rNd-ecCu/Zn-SOD was sensitive to change of pH and addition of different metal ions, which provided a potential capability as biomarkers. It expressed significant difference prepared in Cu²⁺ and Zn²⁺ solution compared with others. Although Cu²⁺ and Zn²⁺ are essential elements to rNd-ecCu/Zn-SOD, they could be harmful if their concentration overloaded [30, 48, 49].

In conclusion, extracellular Cu/Zn-SOD was first cloned and identified from N. denticulata sinensis. The recombinant protein was sensitive to change of pH and addition of different metal ions, and the expression of Nd-ecCu/Zn-SOD challenged with V. parahaemolyticus and exposure of Cu²⁺changed in a time-dependent manner. The results indicated that Nd-ecCu/Zn-SOD in N. denticulata sinensis might sever as a biomarker of environment pollution and plays an important role in immune reaction. At the same time, the study provided a new insight whit an animal model for decapod crustaceans.

N. denticulate sinensis: Neocaridina denticulate sinensis

V. parahaemolyticus: Vibrio parahaemolyticus

Cu/Zn-SOD: Cu/Zn superoxide dismutase

ecCu/Zn-SOD: extracellular Cu/Zn-SOD

icCu/Zn-SOD: intracellular Cu/Zn-SOD

Nd-ecCu/Zn-SOD: Neocaridina denticulate sinensis extracellular Cu/Zn superoxide dismutase gene

rNd-ecCu/Zn-SOD: recombinant Nd-ecCu/Zn-SOD

ROS: reactive oxygen species

ORF: open reading frame

E. coli: Escherichia coli

qRT-PCR: quantitative real-time PCR

CT: cycle threshold

pI: isoelectric point

MW: molecular weight

IPTG: isopropyl β-D-1-thiogalactopyranoside

Ethics approval and consent to participate

Not applicable.

Consent for publication

All authors have consented to publishing this work.

Availability of data and materials

Raw sequence data are available under GenBank (GenBank accession number: OM678462).

Other species sequence data are available under NCBI (https://www.ncbi.nlm.nih.gov/).

Competing interests

All author declare that they have no conflict of interest.

Funding

This work was supported by the National Natural Science Foundation of China (Grant Nos. 32172954, 41876196, 31872613), Key Research and Development Project of Hebei Province (22323201D), Science and Technology Project of Hebei Education Department (ZD2022093), and Hangzhou Qianjiang Special Expert for Prof. Jiquan Zhang.

Author contributions

Dandan Feng: Methodology, Investigation, Writing – original draft. Xi Gao: Investigation. Weihua Kong: Investigation. Yujie Liu: Investigation. Kefan Xing: Investigation Yuying Sun: Conceptualization, Writing – review & editing, Funding acquisition. Jiquan Zhang: Conceptualization, Writing – review & editing, Supervision, Funding acquisition.

Acknowledgments

We are grateful to Dr. Qingli Zhang gifted V. parahaemolyticus.

Kong X, Qiao D, Zhao X, Wang L, Zhang J, Liu D, Zhang H: The molecular characterizations of Cu/ZnSOD and MnSOD and its responses of mRNA expression and enzyme activity to Aeromonas hydrophila or lipopolysaccharide challenge in Qihe crucian carp Carassius auratus. Fish Shellfish Immunol 2017, 67:429-440.
Du J, Zhu H, Ye M, Ma Y: Macrobrachium rosenbergii Cu/Zn superoxide dismutase (Cu/Zn SOD) expressed in Saccharomyces cerevisiae and evaluation of the immune function to Vibrio parahaemolyticus. Fish Shellfish Immunol 2019, 90:363-375.
Ma K, Cui J, Ye J, Hu X, Ma G, Yang X: Pyrroloquinoline quinone from Gluconobacter oxydans fermentation broth enhances superoxide anion-scavenging capacity of Cu/Zn-SOD. Food Chem 2017, 230:291-294.
Li Y, Yan L, Kong X, Chen J, Zhang H: Cloning, expression, and characterization of a novel superoxide dismutase from deep-sea sea cucumber. Int J Biol Macromol 2020, 163:1875-1883.
Tian L, Li J, Huang C, Zhang D, Xu Y, Yang X, Song J, Wang D, Qiu N, Short DPG et al: Cu/Zn superoxide dismutase (VdSOD1) mediates reactive oxygen species detoxification and modulates virulence in Verticillium dahliae. Mol Plant Pathol 2021, 22(9):1092-1108.
Xikeranmu Z, Abdunasir M, Ma J, Tusong K, Liu X: Characterization of two copper/zinc superoxide dismutases (Cu/Zn-SODs) from the desert beetle Microdera punctipennis and their activities in protecting E. coli cells against cold. Cryobiology 2019, 87:15-27.
Chatzidimitriou E, Bisaccia P, Corra F, Bonato M, Irato P, Manuto L, Toppo S, Bakiu R, Santovito G: Copper/Zinc superoxide dismutase from the crocodile icefish Chionodraco hamatus: Antioxidant defense at constant sub-zero temperature. Antioxidants (Basel) 2020, 9(4).
Huang D, Wang S, Chen H: Effects of the endocrine disrupter chemicals chlordane and lindane on the male green neon shrimp (Neocaridina denticulata). Chemosphere 2004, 57(11):1621-1627.
Mittal M, Siddiqui M, Tran K, Reddy S, Malik A: Reactive oxygen species in inflammation and tissue injury. Antioxid Redox Sign 2014, 20(7):1126-1167.
Hardeland R: Melatonin and the electron transport chain. Cell Mol Life Sci 2017, 74(21):3883-3896.
Paravani E, Odetti L, Simoniello M, Poletta G: Molecular analysis and bioinformatic characterization of cooper, zinc-superoxide dismutase (Cu/Zn-sod) gene of Caiman latirostris. Mol Biol Rep 2020, 47(11):8849-8857.
Olson K, Gao Y, Arif F, Arora K, Patel S, DeLeon E, Sutton T, Feelisch M, Cortese-Krott M, Straub K: Metabolism of hydrogen sulfide (H₂S) and production of reactive sulfur species (RSS) by superoxide dismutase. Redox Biol 2018, 15:74-85.
Zeinali F, Homaei A, Kamrani E, Patel S: Use of Cu/Zn-superoxide dismutase tool for biomonitoring marine environment pollution in the Persian Gulf and the Gulf of Oman. Ecotoxicol Environ Saf 2018, 151:236-241.
Gao X, He C, Liu H, Li H, Zhu D, Cai S, Xia Y, Wang Y, Yu Z: Intracellular Cu/Zn superoxide dismutase (Cu/Zn-SOD) from hard clam Meretrix meretrix: Its cDNA cloning, mRNA expression and enzyme activity. Mol Biol Rep 2012, 39(12):10713-10722.
Lian S, Zhao L, Xun X, Lou J, Li M, Li X, Wang S, Zhang L, Hu X, Bao Z: Genome-wide identification and characterization of SODs in Zhikong scallop reveals gene expansion and regulation divergence after toxic Dinoflagellate exposure. Mar Drugs 2019, 17(12).
Liu X, Zhang X, Ma J, Shi X: Integrated system for combined optical coherence tomography-raman spectroscopy of Neocaridina denticulate sinensis. J Ocean U China 2021, 20(1):94-100.
Li C, Sun H, Chen A, Ning X, Wu H, Qin S, Xue Q, Zhao J: Identification and characterization of an intracellular Cu, Zn-superoxide dismutase (icCu/Zn-SOD) gene from clam Venerupis philippinarum. Fish Shellfish Immunol 2010, 28(3):499-503.
Liang F, Sun C, Li S, Hou T, Li C: Therapeutic effect and immune mechanism of chitosan-gentamicin conjugate on Pacific white shrimp (Litopenaeus vannamei) infected with Vibrio parahaemolyticus. Carbohydr Polym 2021, 269:118334.
Pang H, Wang G, Zhou S, Wang J, Zhao J, Hoare R, Monaghan S, Wang Z, Sun C: Survival and immune response of white shrimp Litopenaeus vannamei following single and concurrent infections with WSSV and Vibrio parahaemolyticus. Fish Shellfish Immunol 2019, 92:712-718.
Duan Y, Zhang J, Dong H, Wang Y, Liu Q, Li H: Oxidative stress response of the black tiger shrimp Penaeus monodon to Vibrio parahaemolyticus challenge. Fish Shellfish Immunol 2015, 46(2):354-365.
El-Malah S, Yang Z, Hu M, Li Q, Pan Z, Jiao X: Vibrio parahaemolyticus strengthens their virulence through modulation of cellular reactive oxygen species in vitro. Front Cell Infect Microbiol 2014, 4:168.
Xing K, Liu Y, Yan C, Zhou Y, Sun Y, Su N, Yang F, Xie S, Zhang J: Transcriptome analysis of Neocaridina denticulate sinensis under copper exposure. Gene 2021, 764.
Tang CH, Chen WY, Wu CC, Lu E, Shih WY, Chen JW, Tsai JW: Ecosystem metabolism regulates seasonal bioaccumulation of metals in atyid shrimp (Neocaridina denticulata) in a tropical brackish wetland. Aquat Toxicol 2020, 225:105522.
Cheung M, Yip H, Nong W, Law P, Chu K, Kwan H, Hui J: Rapid change of microbiota diversity in the gut but not the hepatopancreas during gonadal development of the new shrimp model Neocaridina denticulata. Mar Biotechnol (NY) 2015, 17(6):811-819.
Suzuki T, Kanou Y: Two distinct arginine kinases in Neocaridina denticulate: Psychrophilic and mesophilic enzymes. Int J Biol Macromol 2014, 67:433-438.
Mykles DL, Hui JH: Neocaridina denticulata: A decapod crustacean model for functional genomics. Integr Comp Biol 2015, 55(5):891-897.
Huang D, Chen H, Wu J, Wang S: Reproduction obstacles for the female green neon shrimp (Neocaridina denticulata) after exposure to chlordane and lindane. Chemosphere 2006, 64(1):11-16.
Huang C, Chu P, Wu Y, Chan W, Wang Y: Identification of functional SSR markers in freshwater ornamental shrimps Neocaridina denticulata using transcriptome sequencing. Mar Biotechnol (NY) 2020, 22(6):772-785.
Zhao D, Zhang X, Liu D, Ru S: Cu accumulation, detoxification and tolerance in the red swamp crayfish Procambarus clarkii. Ecotoxicol Environ Saf 2019, 175:201-207.
Xie J, He X, Fang H, Liao S, Liu Y, Tian L, Niu J: Identification of heme oxygenase-1 from golden pompano (Trachinotus ovatus) and response of Nrf2/HO-1 signaling pathway to copper-induced oxidative stress. Chemosphere 2020, 253:126654.
Gu B, Liang W, Yang T, Hu Z, Shen H: Metallothionein, hemocyte status and superoxide dismutase/aspartate aminotransferase activity are sensitive biomarkers of cadmium stress in Onchidium reevesii. Aquat Toxicol 2019, 215.
Tamura K, Stecher G, Kumar S: MEGA11: Molecular evolutionary genetics analysis version 11. Mol Biol Evol 2021, 38(7):3022-3027.
Hu M, Shen Y, Xu X, Yu H, Zhang M, Dang Y, Li J: Identification, characterization and immunological analysis of Ras related C3 botulinum toxin substrate 1 (Rac1) from grass carp Ctenopharyngodon idella. Dev Comp Immunol 2016, 54(1):20-31.
Sun Y, Zhang J, Wang S: Heterologous expression and efficient secretion of chitosanase from Microbacterium sp. in Escherichia coli. Indian J Microbiol 2015, 55(2):194-199.
Sun K, Li M, Song Y, Tang J, Liu R: Organism and molecular-level responses of superoxide dismutase interaction with 2-pentanone. Chemosphere 2022, 286(Pt 2):131707.
Kim B, Rhee J, Park G, Lee J, Lee Y, Lee J: Cu/Zn- and Mn-superoxide dismutase (SOD) from the copepod Tigriopus japonicus: Molecular cloning and expression in response to environmental pollutants. Chemosphere 2011, 84(10):1467-1475.
Liao Y, Liu K, Ren T, Zhang Z, Ma Z, Dan SF, Lan Z, Lu M, Fang H, Zhang Y et al: The characterization, expression and activity analysis of three superoxide dismutases in Eriocheir hepuensis under azadirachtin stress. Fish Shellfish Immunol 2021, 117:228-239.
Liu W, Wu J, Ji X, Ma Y, Liu L, Zong X, Yang H, Dai J, Chen X, Xue W: Advanced biomimetic nanoreactor for specifically killing tumor cells through multi-enzyme cascade. Theranostics 2020, 10(14):6245-6260.
Ji HS, Bang SG, Ahn MA, Kim G, Kim E, Eom SH, Hyun TK: Molecular cloning and functional characterization of heat stress-responsive superoxide dismutases in Garlic (Allium sativum L.). Antioxidants (Basel) 2021, 10(5).
Xiu M, Li Z, Chen D, Chen S, Curbo M, Wu H, Tong Y, Tan S, Zhang X: Interrelationships between BDNF, superoxide dismutase, and cognitive impairment in drug-naive first-episode patients with schizophrenia. Schizophr Bull 2020, 46(6):1498-1510.
Lu X, Wang C, Liu B: The role of Cu/Zn-SOD and Mn-SOD in the immune response to oxidative stress and pathogen challenge in the clam Meretrix meretrix. Fish Shellfish Immunol 2015, 42(1):58-65.
Wang B, Liu G, Wang C, Ruan Z, Wang Q, Wang B, Qiu L, Zou S, Zhang X, Zhang L: Molecular cloning and functional characterization of a Cu/Zn superoxide dismutase from jellyfish Cyanea capillata. Int J Biol Macromol 2020, 144:1-8.
Li R, Zhou X, Liu D, Feng W: Enhancing the activity and stability of Mn-superoxide dismutase by one-by-one ligation to catalase. Free Radic Biol Med 2018, 129:138-145.
Zheng W, Zou H, Lv S, Lin Y, Wang M, Yan F, Sheng Y, Song Y, Chen J, Zheng K: The effect of nano-TiO2 photocatalysis on the antioxidant activities of Cu, Zn-SOD at physiological pH. J Photochem Photobiol B 2017, 174:251-260.
Santovito G, Marino S, Sattin G, Cappellini R, Bubacco L, Beltramini M: Cloning and characterization of cytoplasmic carbonic anhydrase from gills of four Antarctic fish: Insights into the evolution of fish carbonic anhydrase and cold adaptation. Polar Biology 2012, 35(10):1587-1600.
Ahearn G, Mandal P, Mandal A: Mechanisms of heavy-metal sequestration and detoxification in crustaceans: A review. J Comp Physiol B 2004, 174(6):439-452.
Mohankumar K, Ramasamy P: White spot syndrome virus infection decreases the activity of antioxidant enzymes in Fenneropenaeus indicus. Virus Res 2006, 115(1):69-75.
Santovito G, Boldrin F, Irato P: Metal and metallothionein distribution in different tissues of the Mediterranean clam Venerupis philippinarum during copper treatment and detoxification. Comp Biochem Physiol C Toxicol Pharmacol 2015, 174-175:46-53.
Si L, Wang C, Guo S, Zheng J, Xia H: The lagged effects of environmentally relevant zinc on non-specific immunity in zebrafish. Chemosphere 2019, 214:85-93.

Table 1

Primers used in this study

Primers	Sequences (5′ - 3′)	Sequence information
Nd-ecCu/Zn-SOD-F₀	AGGATTGGAGGAACGTAAGGATGA	Nested PCR
Nd-ecCu/Zn-SOD-F	ATGATGTCGGTTCTAAGGTATGC	Nested PCR
Nd-ecCu/Zn-SOD-R	CTACGCGTAACCAATAACTCCACA	Nested PCR
Nd-ecCu/Zn-SOD-R₂	CTACGCGTAACCAATAACTCCACATCCGACGCGTC	Nested PCR
RT-Nd-ecCu/Zn-SOD-F	TGCTGCCAATGGTGGAAGAA	Real-time PCR
RT-Nd-ecCu/Zn-SOD-R	GCTGGATAAAGGATGAGGTT	Real-time PCR
pCT7-CHISP6H-Nd-ecCu/Zn-SOD-F	TCCGCCCACCATCACCATCACCATGGACATCCTGCAGAGGGTGGC	Removing signal peptide
pCT7-CHISP6H-Nd-ecCu/Zn-SOD-R	TCCGTAGACAGAGCACTACGCGTAACCAATAACTCCACA	Removing signal peptide
pCT7-CHISP6H-P-F	GCCCACCATCACCATCACCAT	Removing signal peptide
pCT7-CHISP6H-P-R	TAAGAAGGAGATATACATATG	Removing signal peptide

Table 2

Effect of different metal ions on the relative activity of rNd-ecCu/Zn-SOD

Metal ions (20 mM)	N	Relative activity (%)
K⁺	3	100 ± 0^b
Zn²⁺	3	84.93 ± 0.79^f
Mg²⁺	3	98.61 ± 0.62^c
Ca²⁺	3	83.33 ± 0.53^g
Ba²⁺	3	94.74 ± 0.32^d
Cu²⁺	3	93.72 ± 0.64^e
Mn²⁺	3	102.74 ± 0.3^a

No competing interests reported.

SupplementaryFigure.docx

Download PDF

Journal Publication

published 01 Sep, 2022

Read the published version in Fish & Shellfish Immunology →

Version 1

posted

You are reading this latest preprint version

An extracellular Cu/Zn superoxide dismutase from Neocaridina denticulata sinensis: cDNA cloning, mRNA expression and characterizations of recombinant protein

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Conclusions

Abbreviations

Declarations

References

Tables

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1