Expression of Glutamate Dehydrogenase Genes In Arabidopsis Thaliana Depends on The Redox State of Chloroplast Electron Transport Chain

doi:10.21203/rs.3.rs-176434/v1

PDF

Original Article

Expression of Glutamate Dehydrogenase Genes In Arabidopsis Thaliana Depends on The Redox State of Chloroplast Electron Transport Chain

https://doi.org/10.21203/rs.3.rs-176434/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Plant glutamate dehydrogenase is an enzyme interconverting L-glutamate and 2-oxoglutarate and providing a link between carbon and nitrogen metabolism. In Arabidopsis thaliana, this enzyme is encoded by three genes. Two of them, GDH1 and GDH2, provide most of the enzyme activity in plant leaves and roots. Expression of GDH1 and GDH2 genes is very low in the light and high in the dark. The molecular signals and mechanisms that provide the light-dependent GDH genes regulation remain unknown. Using photosynthetic electron transport inhibitors 3-(3.4-dichlorophenyl)-1.1-dimethylurea (DCMU) and 2.5-dibromo-3-methyl-6-isopropyl benzoquinone (DBMIB) we demonstrate that transcript levels of the GDH1 and GDH2 genes in Arabidopsis leaves change in accordance with a redox state of chloroplast electron transport chain: they are low when it is highly reduced and high when it is oxidized. Hydrogen peroxide or high light treatment did not result in decreasing of GDH1 or GDH2 expression, so reactive oxygen species cannot be the signals that reduce expression of these genes during dark-to-light shifts. There was no significant difference between the glucose content in the leaves of plants treated with DCMU and the plants treated with DBMIB, so glucose is not the only or the main factor that regulates expression of the studied genes. We presume that expression of Arabidopsis GDH1 and GDH2 genes depends on the chloroplast electron transport chain redox state. This regulatory mechanism could arise because of a need to avoid a competition for substrate between tetrapyrrole synthesis, glutathione synthesis and using of L-glutamate as an energy source during prolonged darkness.

Plant Physiology and Morphology

Plant Molecular Biology and Genetics

Arabidopsis thaliana

glutamate dehydrogenase

plastid-to-nucleus signaling

redox regulation

Light is one of the most important factors affecting development of a plant organism. Expression of 30 to 50% of plant genes changes when shifting from the dark to the light (Rasmusson and Escobar 2007). A significant proportion of light-dependent regulatory signals has a chloroplast origin. Chloroplast-to-nucleus signals regulate synthesis of photosynthetic electron transport chain components (Pfannschmidt et al. 2001; Borisova-Mubarakshina 2014), carotenoid biosynthesis (Chan et al. 2016), and expression of a number of antioxidant defense genes (Fey et al. 2005; Dietz et al. 2016). Although a large number of these signals are known, the molecular mechanisms of light-dependent regulation of gene expression remain unclear in many cases.

One of those cases is regulation of plant NAD-dependent glutamate dehydrogenase (GDH, EC 1.4.1.2) gene expression. This is a mitochondrial enzyme that catalyzes deamination of L-glutamate to 2-oxoglutarate (and the reverse reaction) and thus provides a link between carbon and nitrogen metabolism (Magadlela et al. 2019; Xiaochuang et al. 2020). GDH holoenzymes are hexamers consisting of two types of subunits, α and β, which are encoded in Arabidopsis thaliana by nuclear genes, respectively, GDH1 (AT5G18170) and GDH2 (AT5G07440). In addition, Arabidopsis has a GDH3 gene (AT3G03910) encoding a minor γ subunit. It does not form a part of the holoenzyme and does not make a large contribution to total GDH activity in Arabidopsis leaves, although it may perform some fine regulation of GDH activity in other tissues and organs (Fontaine et al. 2013; Marchi et al. 2013). Transcript levels of GDH1 and GDH2 genes are highly dependent on the light intensity: they are high in the dark and very low in the light (Turano et al. 1997; Lee et al. 2010).

2-Oxoglutarate formed by GDH activity can be metabolized in the TCA cycle to obtain ATP (Robinson et al. 1992; Labboun et al. 2009). Miyashita and Good (2008) demonstrated that Arabidopsis wild type plants survived extended darkness for longer than gdh1 and gdh2 knockout mutants. So, it was suggested that plant GDH can act as back-up in cases of carbohydrate starvation. When the glucose level is decreased, GDH1 and GDH2 genes are de-repressed, and de novo synthesized GDH enzyme allows the use of L-glutamate as a source of energy (Miyashita and Good 2008). This hypothesis is speculative and has been neither confirmed nor refuted experimentally. Soluble sugars do affect the expression of GDH genes. Transcript levels of GDH1 and GDH2 genes decreased 2–2.5 fold after treatment of 7-day-old Arabidopsis seedlings with a 3% glucose solution for 2–6 h (Li et al. 2006). However, GDH genes expression decreases by orders of magnitude when plants were transferred from the darkness to the light (Turano et al. 1997; Garnik et al. 2013). Such a decline could not be achieved by treatment with exogenous sugars. When studying the possible role of hexokinase 1 as a glucose sensor in the regulation of GDH1 and GDH2 genes expression, we also failed to achieve a significant decrease in expression of these genes by treating plants with exogenous sucrose (Garnik et al. 2014).

All the above suggests that the hypothesis of Miyashita and Good is not the only possible explanation for the light-dependent changes in the expression of GDH genes. In the present study, we show that expression of the GDH1 and GDH2 genes in Arabidopsis is regulated by redox signals of chloroplast origin that depend on the photosynthetic electron transport.

Plant material and experimental conditions

Seeds of Arabidopsis thaliana (L.) Heynh (ecotype Col-0) were obtained from the Arabidopsis Biological Resource Center (The Ohio State University, Columbus, Ohio, USA). Seeds were sterilized in 70% (v/v) ethanol with 0.05% (v/v) Triton X-100, rinsed thrice with sterile water and placed on solid medium in Petri plates along the diameter of the plate. The 0.5X Murashige and Skoog growth medium (Sigma-Aldrich, USA) with 0.8% Phytagel (Sigma-Aldrich) was used. After a stratification at + 4 °С for 3 days, the plates were mounted vertically and seedlings were grown for 14 days at 23 °С, a light intensity of 120 µmol * m^− 2 * s^− 1, and 16 h : 8 h light : dark photoperiod. Fluorescent lamps Philips TL-D 36W / 54–765, color temperature 6200K, were used as a light source (white light). In experiments with photosynthetic electron transport inhibitors, all seedlings were kept in the dark for 18 h before the start of treatment. 3- (3.4-dichlorophenyl)-1.1-dimethylurea (DCMU), 2.5-dibromo-3-methyl-6-isopropyl benzoquinone (DBMIB) and hydrogen peroxide treatments were performed by spraying seedlings (leaves and roots) with solutions containing: DCMU (Sigma-Aldrich) − 10 µM, DBMIB (Sigma-Aldrich) − 100 µM, H₂O₂ − 10 mM. All solutions contained 0.01% Triton X-100. Deionized water containing appropriate concentrations of solvents and Triton X-100 was used as a mock treatment. After spraying with DCMU, DBMIB or hydrogen peroxide, the plants were incubated either in the dark or at 120 µmol * m^− 2 * s^− 1 for 2 and 4 h, and then 8 seedlings from each group were taken for total RNA isolation. Each experiment was repeated three times at least.

Superoxide radical assay

The superoxide radical (O₂^–) in the leaves of 14-day-old plants was evaluated qualitatively by staining with nitro blue tetrazolium (Tarasenko et al. 2012). Before the start of experiment, plants were kept in the dark for 18 h. The detached leaves were infiltrated with 1 mg/ml solution of nitro blue tetrazolium (Thermo Scientific, USA) in 10 mM KH₂PO₄, pH 7.8, or with the same solution containing DCMU (10 µM) or DBMIB (100 µM). Then the leaves were kept in the dark or in the light (120 µmol * m^–2 * s^–1) for 1 h, washed free from chlorophyll in 70% ethanol at 80 °С and photographed.

RNA extraction and Real-Time PCR (RT-PCR)

Total RNA was extracted from rosette leaves using TRI-Reagent (Ambion, USA) according to the manufacturer's protocol. A sample of 400 ng of total RNA pretreated with DNase I (Thermo Scientific) was used for cDNA synthesis. The synthesis was performed using random hexamer primers (Thermo Scientific) and RevertAid H Minus M-MuLV reverse transcriptase (Thermo Scientific) according to the manufacturer's protocol. The RT-PCR was performed using a SYBR Select Master Mix (Applied Biosystems, USA) and C1000 Thermal Cycler CFX96 Real-Time PCR Detection System (Bio-Rad, USA) according to the following protocol: heating to 50°C, 2 min, one denaturation cycle (95°C, 3 min), 36 amplification cycles (95°C, 20 s − 60°C, 30 s − 72°C, 30 s). The YLS8 gene was used as a reference (Hong et al., 2010). The following primers were used: YLS8 (At5g08290) – L: AGGTGCTTGCGTCTGTTGCT, R: TGTCCTTGAGAGCCCAGTTGAT; GDH1 (At5g18170) – L: CAGGGCAGCGTTTTGTCATCCA, R: CGATACCATCCTTGTTCTTGATTGCT; GDH2 (At5g07440) – L: CGCTCTTGGTGGTGTCCTGAA, R: CTCCTCCTGCGTTTGCGTAGA; BAP1 (At3g61190) – L: GCGTGTTCGTCCCAAGCG, R: GCGTTGATACAGACCCCAAACC; NOD1 (At5g64870) – L: ACGAGAAGCAGAAGCAAGCG, R: GGTAAGTCCCCTGAGCATCGG.

Glucose assay

Glucose assay was carried out by an enzymatic method using the Glucose (HK) Assay Kit (Sigma-Aldrich). Arabidopsis leaves (300 mg fresh weight) were homogenized in liquid nitrogen with a mortar and pestle. 600 µl of double-distilled water was added, and the samples incubated for 30 min at 80°C and centrifuged for 10 min at 15000 g. The supernatant was used to assay glucose levels according to the manufacturer's protocol, and the SmartSpec Plus spectrophotometer (Bio-Rad, USA) was used to measure the absorbance of the solutions at 340 nm. The glucose concentration in the supernatant was determined by the formula:

glucose concentration, mg/mL = (ΔA*TV*F*180.2) / (6.22*d*SV*1000),

where ΔA is the difference in absorbance of the sample and the comparison solution; TV is the total sample volume, mL; F is the dilution factor; 180.2 - molar mass of glucose, g/mol; SV is the volume of supernatant in the sample, mL; 6.22 is the millimolar extinction coefficient for NADH at 340 nm; d is the optical path length (= 1 cm); 1000 - conversion coefficient µg to mg. The final result was expressed in mg glucose per gram of fresh weight of Arabidopsis tissue.

Statistical analysis

The experiments were repeated three times or more. Leaves from 8 to 12 Arabidopsis plants were pooled into each sample. All experimental data were statistically analyzed using Student's t-Tests. Mean values ± standard deviation of the mean (SD) were calculated from the results of at least three replicates, and significant differences relative to controls are presented at * P < 0.05.

To study dynamics of changes in GDH1 and GDH2 expression during the light shifts, 14-day-old Arabidopsis plants were adapted to 120 µmol * m^–2 * s^–1 of the white light for at least 18 hours, then placed in the dark, and leaf samples were taken every 2 h. Similarly, plants adapted to the dark were transferred to the white light (120 µmol * m^–2 * s^–1) and leaf samples were taken after 0.5, 1, 2, 4 and 6 h. Decrease in GDH1 and GDH2 expression after the dark-to-light shift occurred rapidly. Within the first 2 h, transcript levels of the both genes reached low values and then decreased slightly (Fig. 1a). In contrast, the increase in the transcript levels after the light-to-dark shift developed slowly and did not reach a plateau during the 8 h incubation. Based on these data, in further experiments, we carried out adaptation of plants to the darkness before the start of experiments for at least 18 h.

To study dependence of GDH1 and GDH2 expression on light intensity, 14-day-old plants grown at 120 µmol * m^–2 * s^–1 of white light were adapted to experimental light conditions (0; 2.5; 5; 25; 40; 95 µmol * m^–2 * s^–1) for two days. Time of continuous light exposition before sampling was 4 h. For both genes, higher expression values were observed at low and very low light intensity. At 25 µmol * m^–2 * s^–1 and higher, expression of both genes was less than 20% of the transcript levels in the dark. With a further increase in light intensity, the expression levels continued to decrease slowly (Fig. 1c). Thus, expression of both genes is very sensitive to light and decreases significantly even at the low light.

Due to the structural features of chloroplast electron transport chain (C-ETC), it is possible to block electron transfer using DCMU at the level of the Q_A-Q_B sites in the reaction center of PSII, or using DBMIB at the level of the Q₀ site of the cytochrome b₆/f complex. Under the moderate light conditions, a more oxidized state of plastoquinone pool is achieved if DCMU is applied, and a more reduced state in the case of DBMIB (Wang et al., 2016). To study the effect of C-ETC redox state on the expression of GDH1 and GDH2, we treated in vivo 14-day-old Arabidopsis plants by DCMU or DBMIB and exposed them to 120 µmol * m^–2 * s^–1 of white light for 4 h (Fig. 2a). The transcript levels after DCMU treatment were significantly higher than in control plants: 8-fold for GDH1 gene and 25-fold for GDH2 (Fig. 2b). After DBMIB treatment the transcript levels were slightly higher than in control plants, but significantly lower than after DCMU treatment.

In addition to the C-ETC redox state change, photosynthesis inhibitors can lead to changes in a glucose content as well as reactive oxygen species (ROS) generation. We analyzed glucose and O₂^- content in DCMU- and DBMIB-treated plants. After the treatment with both DCMU and DBMIB, the glucose level was significantly lower than in control plants (Fig. 2d). The O₂^- content in Arabidopsis leaves was significantly higher in the light than in the dark. After the DCMU treatment in the light, the O₂^- content was low, comparable to that in the dark. After the DBMIB treatment in the light, the O₂^- content was comparable with that in the control plants in the light (Fig. 2c).

One of the approaches to stimulate ROS generation in plants is high light exposure. In Arabidopsis, light intensities of more than 300 µmol * m^− 2 * s^− 1 result in elevated ROS generation and photooxidative stress (Boyes et al. 2001). In the next experiments we studied an effect of a high light on the GDH1 and GDH2 expression. 14-day-old plants grown as described earlier and adapted to 120 µmol * m^− 2 * s^− 1 of the white light were exposed to 900 µmol * m^− 2 * s^− 1 of the white light for 15 minutes, then RNA was isolated from the leaves immediately. GDH1 and GDH2 expression as well as ¹O₂-responsive genes BAP1 (At3g61190) and NOD1 (At5g64870) (Saini et al., 2011) were evaluated. Induction of the BAP1 and NOD1 confirmed that the selected conditions led to a significant ROS generation (Fig. 3a). GDH1 and GDH2 transcript levels increased significantly after a 15-minute exposure under the high light (Fig. 3a).

We also studied an effect of exogenous hydrogen peroxide on the GDH genes expression. Arabidopsis plants were treated with hydrogen peroxide in two variants: in the dark and at 120 µmol * m^–2 * s^–1 of the white light. The initial GDH1 transcript levels in the control plants adapted to the dark or the light differed very markedly (Fig. 3b). In the dark, treatment with H₂O₂ led to a slight increase in GDH1 transcript content 2 and 4 h after the start of the treatment, and to a more pronounced GDH2 expression increase (Fig. 3c). In the light, treatment with 10 mM H₂O₂ did not lead to any significant changes in GDH1 expression, while GDH2 transcripts content increased 2 h after the start of treatment and remained at the same level after 4 h (Fig. 3d).

GDH1 and GDH2 expression depends on the intensity and duration of the light exposure

It is well known that GDH1 and GDH2 expression increases in the dark and decreases in the light (Turano et al. 1997; Lee at al. 2010), but dynamics of the expression changes during the light shifts has not been studied so far. In our experiments, the transcript levels of these genes in the dark are dozens more than in the light (Fig. 1, Fig. 3b). The decrease in GDH1 and GDH2 expression during the dark-to-light shift occurs more quickly than the increase during the light-to-dark shift (Fig. 1a, 1b). Comparison of the transcript content in plant leaves adapted to different light intensity provided the greatest differences in the range from 0 to 25 µmol * m^− 2 * s^− 1 of the white light, i.e. at the low light. It suggests that a regulatory mechanism providing light dependent changes in the GDH1 and GDH2 expression is highly sensitive to light.

Earlier, we have demonstrated that functionally active chloroplasts are necessary for the light-dependent repression of GDH1 and GDH2 genes in Arabidopsis (Garnik et al. 2013). It means that the light-dependent regulation of GDH1 and GDH2 genes is mediated not by cytoplasm photoreceptors, but by plastid-to-nucleus signals.

DCMU treatment results in a higher expression of GDH1 and GDH2 in the light

Among a number of currently known plastid-to-nucleus signals, redox signals respond most quickly to the light intensity changes. This group includes signals mediated by singlet oxygen and Executer1 / Executer2 proteins; signals mediated by hydrogen peroxide generated in C-ETC; unknown signals associated with changes in the plastoquinone pool redox state (Dietz et al. 2016). Our attention was drawn to the latter regulatory path, since it is known that the pathway associated with Executer1 / Executer2 chloroplast-to-nucleus proteins is activated mainly under high light and photooxidative stress (Kim and Apel 2013), and hydrogen peroxide generation is closely associated with the plastoquinone pool redox state (Mubarakshina and Ivanov 2010). To manipulate with a plastoquinone pool redox state in plant leaves in vivo, we used the classical electron transfer inhibitors, DCMU and DBMIB.

DCMU treatment in the light led to the 8-fold higher transcript content for GDH1 and 25-fold higher for GDH2 (Fig. 2b). This can be interpreted as a participation of plastoquinone-derived redox signals in the regulation of GDH gene expression. This assumption is in a good agreement with a high sensitivity of the expression of the studied genes to differences in the light intensity under the low light conditions (Fig. 1c).

The redox state of the plastoquinone pool is important for the regulation of gene expression in the plastid (Pfannschmidt et al. 1999), as well as in the nucleus (Pfannschmidt et al. 2001). It is still not completely understood how such regulation is ensured in the cases where it is not mediated by ROS, but to date it has been observed for genes encoding the C-ETC subunits, the large Rubisco subunit (Pfannschmidt et al. 1999; 2001), chlorophyll-binding proteins of light-harvesting complexes (Borisova-Mubarakshina et al. 2014), flavonoid biosynthesis enzymes (Akhtar et al. 2010), and some antioxidant enzymes (Slesak et al. 2003; Yabuta et al. 2004; Garnik et al. 2016).

It was demonstrated using microarray technology that there are many more plastoquinone redox state-dependent genes. According to Adamiec et al., expression of 50 Arabidopsis genes (among 663 genes differentially expressed depending on the light intensity) returned to the dark levels after the DCMU treatment (Adamiec et al. 2008). A number of studies have shown participation of plastoquinone redox signals in responses of Arabidopsis transcript levels to stresses associated with high light and cold (Kopriva and Rennenberg 2004; Lepetit et al. 2013; Bode et al. 2016), as well as in regulation of stomata closure (Wang et al. 2016). Thus, even processes not directly related to photosynthesis may depend on the plastoquinone pool redox state.

Changes in the expression of the GDH1 and GDH2 genes under the DBMIB treatment may be the result of its effect on mitochondrial ETC redox state

If we consider the redox state of the plastoquinone pool as the main factor influencing the expression of the GDH1 and GDH2 genes during light shifts, then we would expect that a DBMIB treatment will lead to an even greater decrease in their expression. However, the expression of the GDH1 and GDH2 genes under the DBMIB treatment was slightly higher than in the leaves of the untreated plants (Fig. 2b). The absence of a reduction can be explained by the rather high light intensity and, respectively, the low expression level of the studied genes in the control plants in the light.

On the other hand, it is known that in mitochondria DBMIB can bind to the bc1 complex and inhibit the ubiquinol-cytochrome reductase activity, which leads to a reduced redox state of the mitochondrial ubiquinone pool (Surkov and Konstantinov 1980; Degli Esposti et al. 1984). We have shown previously that over-reduction of the ubiquinone pool by antimycin A treatment leads to induction of GDH2 gene in Arabidopsis heterotrophic cell culture (Tarasenko et al. 2009). It is possible that DBMIB at the used concentration exerted an inhibitory effect on the mitochondrial ETC, which masked the effect of the plastoquinone pool redox state on the expression of the studied genes.

The lower glucose level in the plants treated with DCMU or DBMIB does not correlate with the changes in the GDH1 and GDH2 genes expression

The change in the plastoquinone pool redox state is not the only factor that can affect genes expression in the presence of DCMU or DBMIB. Each of these inhibitors blocks the light stage of photosynthesis and can lead to a decrease in glucose level in the cell. According to the Miyashita and Good hypothesis it is the level of soluble carbohydrates that is the main regulator of the glutamate dehydrogenase genes expression (Miyashita and Good 2008). Therefore, we estimated the glucose content in the leaves of the same plants in which the transcripts of GDH genes were determined.

After the treatment with DCMU or DBMIB, the glucose content in the leaves of plants become significantly lower than in the control. There was no significant difference between the glucose content in the leaves of plants treated with DCMU and the plants treated with DBMIB (Fig. 2d). Therefore, if in this experiment the transcripts levels depended mainly on the glucose content in the leaves, then the same increase in the GDH1 and GDH2 expression should be expected both after DCMU or DBMIB treatments. However, we observed the significantly higher transcripts levels after the DCMU treatment (Fig. 2b). It suggests that glucose is not the only and not the main factor that regulates the expression of the studied genes.

ROS generation cannot be a factor leading to a decrease in the GDH1 and GDH2 genes expression

ROS mediated signaling pathways take part in regulation of a huge number of plant genes (Dietz et al. 2016). The plastoquinone pool is one of the main ROS generation sites in the light, so treatment with photosynthesis inhibitors significantly changes ROS level in plant cells, and it could be the reason for the observed GDH1 and GDH2 expression changes. The first ROS resulting from the leakage of electrons from a reduced or over-reduced plastoquinone pool is the singlet oxygen, which turns then into the superoxide radical O₂⁻ and the hydrogen peroxide H₂O₂ (Mubarakshina and Ivanov 2010).

We evaluated changes in the O₂⁻ content in Arabidopsis leaves after the DCMU or DBMIB treatment. In the presence of DBMIB, it was as high as in the light control. In the presence of DCMU in the light, it was much lower, comparable to the content in the dark (Fig. 2d). So, the lower level of superoxide radical corresponds to the higher level of GDH1 and GDH2 expression.

However, both our own results and the literature data clearly show that ROS can only increase the expression of glutamate dehydrogenase genes but not lower it (Scopelitis et al. 2006). In our experiments, when plants were exposed to 900 µmol * m^− 2 * s^− 1 of the white light, which is excessive for Arabidopsis and leads to photooxidative stress, the levels of GDH1 and GDH2 transcripts did not decrease, but increased (Fig. 3a). The treatment of plants with exogenous hydrogen peroxide also did not lead to a decrease in these genes expression neither at the initially high (in the dark), nor at the initially low (in the light) transcripts levels (Figs. 3c, 3d). This is in a good agreement with reports of increased expression of plant glutamate dehydrogenase during abiotic stresses. An increase in the GDH activity or in the expression of its genes during hypoxia-reoxygenation (Tsai et al. 2016), drought (Sun et al. 2013), temperature stresses (Goel and Singh 2015), and salt stress (Terce-Laforgue et al. 2015) was shown. Thus, ROS have an inducing effect on the GDH genes expression and cannot be the reason for a decrease in their expression during the dark-to-light shifts.

Physiological significance of the light-dependent regulation of the GDH1 and GDH2 genes expression

Turano et al. (1997) showed that the higher or lower GDH1 and GDH2 transcripts levels correlated with the higher or lower GDH enzyme activity, respectively. Thus, fluctuations in the transcript levels have a physiological significance.

We have here demonstrated that some chloroplast signals arising from changes in the C-ETC redox state can participate in the regulation of the Arabidopsis thaliana GDH1 and GDH2 genes expression. We believe that this regulation depends on the redox state of the plastoquinone pool, but is not mediated by ROS.

In the majority of the proven cases of gene expression regulation mediated by the plastoquinone pool redox state, the observed expression changes are aimed at adapting of the photosynthetic apparatus to changing light conditions, or at providing antioxidant protection. GDH, however, is a mitochondrial enzyme that is not directly related either to photosynthesis nor to other processes occurring in chloroplasts. However, the substrate of this enzyme, L-glutamate, also serves as a substrate for the biosynthesis of chlorophylls and heme groups of cytochromes belonging to the C-ETC (Tanaka et al. 2011).

L-glutamate is also necessary for synthesis of glutathione, which is necessary to provide antioxidant protection (Noctor et al. 2012). In plants, biosynthesis of both tetrapyrroles and glutathione is associated with chloroplasts and activated in the light (Tanaka et al. 2011; Noctor et al. 2012; Heyneke et al. 2013). Among the three metabolic pathways that use L-glutamate as the primary substrate (2-oxoglutarate formation; chlorophyll biosynthesis; glutathione biosynthesis), the second and the third are of a great importance in the light. On the other hand, the possibility of using L-glutamate in the TCA cycle after converting it to 2-oxoglutarate is important in cases of a long-term absence of photosynthesis (e.g. overnight).

We think that the physiological purpose of the light-dependent regulation of the GDH1 and GDH2 genes expression is to avoid a competition for the substrate between GDH (deamination of L-glutamate to 2-oxoglutarate), glutamyl-t-RNA synthetase (the first reaction of the tetrapyrroles biosynthesis path) and γ-glutamylcysteine synthetase (the first reaction of the glutathione biosynthesis path). In the light, expression of GDH genes is rapidly repressed, and L-glutamate can be used for biosynthesis of chlorophyll, heme and glutathione, which are more necessary at that time. After hours of absence of light, it becomes more necessary to use L-glutamate as a source of energy, that is ensured by increasing the expression of the GDH genes. The redox state of the C-ETC and the plastoquinone pool as a highly sensitive C-ETC component are ideal candidates to be the main regulators of light-dependent expression of the GDH genes.

Our hypothesis does not contradict the Miyashita and Good hypotheses about the participation of sugars in the light-dependent GDH regulation. However, Miyashita and Good suggested that the soluble sugars content should be the main regulatory factor for GDH genes expression changes, but we believe that the redox state of the plastoquinone pool is the factor playing the key role. Sugar accumulation as a GDH genes expression regulatory factor acts in the same direction as the plastoquinone pool reduction, but apparently makes a smaller contribution to their light-dependent repression.

Interestingly, glucose accumulation in the light itself can lead to a partial plastoquinone pool reduction due to a slowdown in the NADPH oxidation in the Calvin cycle (Ma et al. 2008). In this case, the decrease in the GDH genes expression in the presence of exogenous sucrose or glucose in the light can be explained not only by their direct regulatory action, but also by the glucose-dependent change in the plastoquinone redox state.

We have previously demonstrated that the expression of the GDH2 gene is induced under the over-reduced state of the mitochondrial ubiquinone pool in a heterotrophic culture of Arabidopsis cells, and this induction was independent of ROS production (Tarasenko et al. 2009). There are many parallels in the structure and functioning of the respiratory and photosynthetic ETCs, and it is even more interesting that the reduction of the ubiquinone pool leads to the induction of GDH genes, and the reduction of the plastoquinone pool leads to their repression. It cannot be excluded that these are manifestations of the same regulatory mechanism mediated by redox signals emanating from the two largest quinone pools of a plant cell.

COMPLIANCE WITH ETHICAL STANDARDS

Conflict of Interest

The authors have no relevant financial or non-financial interests to disclose.

Human and Animal Rights

This research did not involve experiments with human or animal participants.

Informed Consent

Informed consent was obtained from all individual participants included in the study. Additional informed consent was obtained from all individual participants for whom identifying information is included in this article.

Author contributions

Conceptualization, Methodology, Writing - original draft preparation: Elena Yu. Garnik; Investigation, Validation, Data curation: Vadim I. Belkov; Resourses, Writing - reviewing and editing: Vladislav I. Tarasenko; Project administration: Yury M. Konstantinov. All authors discussed the results and approved the final manuscript.

Acknowledgements

This work was financially supported by the RAS project VI.56.1.3. Equipment of the Bioanalitika Center for Collective Use, Siberian Institute of Plant Physiology and Biochemistry, Siberian Branch of the Russian Academy of Sciences, Irkutsk, was used in this study. We would like to thank Prof. Ian Maх Moller for his critical reading of this manuscript and his valuable comments helping to improve it.

Adamiec M, Drath M, Jackowski G (2008) Redox state of plastoquionone pool regulates expression of Arabidopsis thaliana genes in response to elevated irradiance. Acta Biochim Pol 55(1):161–173
Akhtar TA, Lees HA, Lampi MA, Enstone D, Brain RA, Greenberg BM (2010) Photosynthetic redox imbalance influences flavonoid biosynthesis in Lemna gibbapce. Plant Cell Envir 33:1205–1219. https://doi.org/10.1111/j.1365-3040.2010.02140.x
Bode R, Ivanov AG, Huner NPA (2016) Global transcriptome analyses provide evidence that chloroplast redox state contributes to intracellular as well as long-distance signalling in response to stress and acclimation in Arabidopsis. Photosynth Res 128:287–312. https://doi.org/10.1007/s11120-016-0245-y
Borisova-Mubarakshina MM, Vetoshkina DV, Rudenko NN, Shirshikova GN, Fedorchuk TP, Naydov IA, Ivanov BN (2014) The size of the light harvesting antenna of higher plant photosystem II is regulated by illumination intensity through transcription of antenna protein genes. Biochemistry 79(6):520–523. https://doi.org/10.1134/S0006297914060042
Boyes DC, Zayed AM, Ascenzi R, McCaskill AJ, Hoffman NE, Davis KR, Görlach J (2001) Growth stage-based phenotypic analysis of Arabidopsis: a model for high throughput functional genomics in plants. Plant Cell 13:1499–1510. https://doi.org/10.1105/tpc.010011
Chan KX, Phua SY, Crisp P, McQuinn R, Pogson BJ (2016) Learning the languages of the chloroplast: retrograde signaling and beyond. Annu Rev Plant Biol 67:25–53. https://doi.org/10.1146/annurev-arplant-043015-111854
Degli Esposti M, Rotilio G, Lenaz G (1984) Effects of dibromothymoquinone on the structure and function of the mitochondrial bc1 complex. Biochim Biophys Acta 767(1):10–20. https://doi.org/10.1016/0005-2728(84)90074-4
Dietz K-J, Turkan I, Krieger-Liszkay A (2016) Redox- and reactive oxygen species-dependent signaling into and out of the photosynthesizing chloroplast. Plant Physiol 171(3):1541–1550. https://doi.org/10.1104/pp.16.00375
Fey V, Wagner R, Brautigam K, Wirtz M, Hell R, Dietzmann A, Leister D, Oelmuller R, Pfannschmidt T (2005) Retrograde plastid redox signals in the expression of nuclear genes for chloroplast proteins of Arabidopsis thaliana. J Bio Chem 280(7):5318–5328. https://doi.org/10.1074/jbc.M406358200
Fontaine J-X, Terce-Laforgue T, Bouton S, Pageau K, Lea PJ, Dubois F, Hirel B (2013) Futher insights into the isoenzyme composition and activity of glutamate dehydrogenase in Arabidopsis thaliana. Plant Sign Behav 3:e23329. https://doi.org/10.4161/psb.23329
Garnik EYu, Belkov VI, Tarasenko VI, Korzun MA, Konstantinov YuM (2016) Glutathione reductase gene expression depends on chloroplast signals in Arabidopsis thaliana. Biochemistry 81(4):364–372. https://doi.org/10.1134/S0006297916040064
Garnik EYu, Belkov VI, Tarasenko VI, Potapova TV, Korzun MA, Konstantinov Yu M (2013) The expression of Arabidopsis glutamate dehydrogenase gene GDH2 is induced under the influence of tetrapyrrole synthesis inhibitor norflurazon. J Stress Physiol Biochem 9(4):299–309
Garnik EYu, Belkov VI, Tarasenko VI, Konstantinov YuM (2014) The role of sugar-related regulation in the light-dependent alterations of Arabidopsis glutamate dehydrogenase genes expression. J Stress Physiol Biochem 10(4):67–76
Goel P, Singh AK (2015) Abiotic stresses downregulate key genes involved in nitrogen uptake and assimilation in Brassica juncea L. PLoS One 10(11):e0143645. https://doi.org/10.1371/journal.pone.0143645
Heyneke E, Luschin-Ebengreuth N, Krajcer I, Wolkinger V, Müller M, Zechmann B (2013) Dynamic compartment specific changes in glutathione and ascorbate levels in Arabidopsis plants exposed to different light intensities. BMC Plant Biol 13:104. https://doi.org/10.1186/1471-2229-13-104
Hong SM, Bahn SC, Lyu A, Jung HS, Ahn JH (2010) Identification and testing of superior reference genes for a starting pool of transcript normalization in Arabidopsis. Plant Cell Physiol 51:1694–1706. https://doi.org/10.1093/pcp/pcq128
Kim C, Apel K (2013) Singlet oxygen-mediated signaling in plants: moving from flu to wild type reveals an increasing complexity. Photosynth Res 116(2–3):445–464. https://doi.org/10.1007/s11120-013-9876-4
Kopriva S, Rennenberg H (2004) Control of sulphate assimilation and glutathione synthesis: interaction with N and C metabolism. J Exp Bot 55(404):1831–1842. https://doi.org/10.1093/jxb/erh203
Labboun S, Tercé-Laforgue T, Roscher A, Bedu M, Restivo FM, Velanis ChN, Skopelitis DS, Moshou PN, Roubelakis-Angelakis KA, Suzuki A, Hirel B (2009) Resolving the role of plant glutamate dehydrogenase. I. In vivo real time nuclear magnetic resonance spectroscopy experiments. Plant Cell Physiol 50(10):1761–1773. https://doi.org/10.1093/pcp/pcp118
Lee ChP, Eubel H, Millar AH (2010) Diurnal changes in mitochondrial function reveal daily optimization of light and dark respiratory metabolism in Arabidopsis. Mol Cell Proteomics 9(10):2125–2139. https://doi.org/10.1074/mcp.M110.001214
Lepetit B, Sturm S, Rogato A, Gruber A, Sachse M, Falciatore A, Lavaud J (2013) High light acclimation in the secondary plastids containing diatom Phaeodactylum tricornutum is triggered by the redox state of the plastoquinone pool. Plant Physiol 161(2):853–865. https://doi.org/10.1104/pp.112.207811
Li Yu, Lee KK, Walsh S, Smith C, Hadingham S, Sorefan K, Cawley G, Bevan MW (2006) Establishing glucose- and ABA-regulated transcription networks in Arabidopsis by microarray analysis and promoter classification using a Relevance VectorMachine. Genome Res 16(3):414–427. https://doi.org/10.1101/gr.4237406
Ma W, Deng Y, Mi H (2008) Redox of plastoquinone pool regulates the expression and activity of NADPH dehydrogenase supercomplex in Synechocystis sp. strain PCC 6803. Curr Microbiol 56:189–193. https://doi.org/10.1007/s00284-007-9056-x
Magadlela A, Morcillo RJL, Kleinert A, Venter M, Steenkamp E, Valentine A (2019) Glutamate dehydrogenase is essential in the acclimation of Virgilia divaricata, a legume indigenous to the nutrient-poor Mediterranean-type ecosystems of the Cape Fynbos. J Plant Physiol 243:e153053. https://doi.org/10.1016/j.jplph.2019.153053
Marchi L, Degola F, Polverini E, Terce-Laforgque T, Dubois F, Restivo FM (2013) Glutamate dehydrogenase isoenzyme 3 (GDH3) of Arabidopsis thaliana is regulated by a combined effect of nitrogen and cytokinin. Plant Physiol Biochem 73:368–374. https://doi.org/10.1016/j.plaphy.2013.10.019
Miyashita Y, Good AG (2008) NAD(H)-dependent glutamate dehydrogenase is essential for the survival of Arabidopsis thaliana during dark induced carbon starvation. J Exp Botany 59(3):667–680. https://doi.org/10.1093/jxb/erm340
Mubarakshina MM, Ivanov BN (2010) The production and scavenging of reactive oxygen species in the plastoquinone pool of chloroplast thylakoid membranes. Physiol Plant 140(2):103–110. https://doi.org/10.1111/j.1399-3054.2010.01391.x
Noctor G, Mhamdi A, Chaouch S, Han Y, Neukermans J, Marquez-Garcia B, Queval G, Foyer CH (2012) Glutathione in plants: an integrated overview. Plant Cell Environ 35(2):454–484. https://doi.org/10.1111/j.1365-3040.2011.02400.x
Pfannschmidt T, Nilsson A, Allen JF (1999) Photosynthetic control of chloroplast gene expression. Nature 397:625–628. https://doi.org/10.1038/17624
Pfannschmidt T, Shcutze K, Brost M, Oelmuller R (2001) A novel mechanism of nuclear photosynthesis gene regulation by redox signals from the chloroplast during photosystem stoichiometry adjustment. J Biol Chem 276(39):36125–36130. https://doi.org/10.1074/jbc.m105701200
Rasmusson AG, Escobar MA (2007) Light and diurnal regulation of plant respiratory gene expression. Physiol Plant 129(1):57–67. https://doi.org/10.1111/j.1399-3054.2006.00797.x
Robinson SA, Stewart GR, Phillips R (1992) Regulation of glutamate dehydrogenase activity in relation to carbon imitation and protein catabolism in carrot cell suspension cultures. Plant Physiol 98:1190–1195. https://doi.org/10.1104/pp.98.3.1190
Saini G, Meskauskeine R, Pijacka W, Roszak P, Sjogren LL, Clarke AK, Straus M, Apel K (2011) «happy on norflurazon» (hon) mutations implicate perturbance of plastid homeostasis with activating stress acclimatization and changing nuclear gene expression in norflurazon-treated seedlings. Plant J 65(5):690–702. https://doi.org/10.1111/j.1365-313X.2010.04454.x
Skopelitis DS, Paranychianakis NV, Paschalidis KA, Pliakonis ED, Delis ID, Yakoumakis DI, Kouvarakis A, Papadakis AK, Stephanou EG, Roubelakis-Angelakis CA (2006) Abiotic stress generates ROS that signal expression of anionic glutamate dehydrogenases to form glutamate for proline synthesis in tobacco and grapevine. Plant Cell 18(10):2767–2781. https://doi.org/10.1105/tpc.105.038323
Slesak I, Karpinska B, Surówka E, Miszalski Z, Karpinski S (2003) Redox changes in the chloroplast and hydrogen peroxide are essential for regulation of C3–CAM transition and photooxidative stress responses in the facultative CAM plant Mesembryanthemum crystallinum L. Plant Cell Physiol 44(6):573–581. https://doi.org/10.1093/pcp/pcg073
Sun M, Gao Z, Zhao W, Deng L, Deng Y, Zhao H, Ren A, Li G, Yang Z (2013) Effect of subsoiling in fallow period on soil water storage and grain protein accumulation of dryland wheat and its regulatory effect by nitrogen application. PLoS One 8(10):e75191. https://doi.org/10.1371/journal.pone.0075191
Surkov SA, Konstantinov A (1980) Dibromothymoquinone interaction with the CoQ-cytochrome b locus of the mitochondrial respiratory chain. FEBS Lett 109(2):283–288. https://doi.org/10.1016/0014-5793(80)81106-9
Tanaka R, Kobayashi K, Masuda T (2011) Tetrapyrrole metabolism in Arabidopsis thaliana. Arabidopsis Book 9:e0145. https://doi.org/10.1199/tab.0145
Tarasenko VI, Garnik EYu, Shmakov VN, Konstantinov YuM (2009) Induction of Arabidopsis GDH2 gene expression during changes in redox state of the mitochondrial respiratory chain. Biochemistry 74(1):47–53. https://doi.org/10.1134/s0006297909010076
Terce-Laforgue T, Clement G, Marchi L, Restivo FM, Lea PJ, Hirel B (2015) Resolving the role of plant NAD-glutamate dehydrogenase: III. Overexpressing individually or simultaneously the two enzyme subunits under salt stress induces changes in the leaf metabolic profile and increases plant biomass production. Plant Cell Physiol 56(10):1918–1929. https://doi.org/10.1093/pcp/pcv114
Tsai KJ, Lin CY, Ting CY, Shih MC (2016) Ethylene-regulated glutamate dehydrogenase fine-tunes metabolism during anoxia-reoxygenation. Plant Physiol 172(3):1548–1562. https://doi.org/10.1104/pp.16.00985
Turano F, Thakkar S, Fang T, Weisemann J (1997) Characterization and expression of NAD(H)- dependent glutamate dehydrogenase genes in Arabidopsis. Plant Physiol 113(3):1329–1341. https://doi.org/10.1104/pp.113.4.1329
Wang W-H, He E-M, Chen J, Guo Y, Chen J, Liu X, Zheng H-L (2016) The reduced state of the plastoquinone pool is required for chloroplast-mediated stomatal closure in response to calcium stimulation. Plant J 86(2):132–144. https://doi.org/10.1111/tpj.13154
Xiaochuang C, Meiyan W, Chunquan Zh C, Zh J, Zh L, Zh, Lianghuan W, Qianyu J (2020) Glutamate dehydrogenase mediated amino acid metabolism after ammonium uptake enhances rice growth under aeration condition. Plant Cell Rep 39(3):363–379. https://doi.org/10.1007/s00299-019-02496-w
Yabuta Y, Maruta T, Yoshimura K, Ishikawa T, Shigeoka S (2004) Two distinct redox signaling pathways for cytosolic APX induction under photooxidative stress. Plant Cell Physiol 45(11):1586–1594. https://doi.org/10.1093/pcp/pch181

PDF

Reviews received at journal
31 Jan, 2021
Reviewers invited by journal
31 Jan, 2021
First submitted to journal
20 Jan, 2021

You are reading this latest preprint version

Expression of Glutamate Dehydrogenase Genes In Arabidopsis Thaliana Depends on The Redox State of Chloroplast Electron Transport Chain

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Plant material and experimental conditions

Superoxide radical assay

RNA extraction and Real-Time PCR (RT-PCR)

Glucose assay

Statistical analysis

Results

Discussion

Declarations

Informed Consent

Author contributions

Acknowledgements

References

Status:

Version 1