Anterior gradient 2 induces resistance to sorafenib via endoplasmic reticulum stress regulation in hepatocellular carcinoma

doi:10.21203/rs.3.rs-1767394/v1

Download PDF

Article

Anterior gradient 2 induces resistance to sorafenib via endoplasmic reticulum stress regulation in hepatocellular carcinoma

https://doi.org/10.21203/rs.3.rs-1767394/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Hepatocellular carcinoma (HCC) accounts for almost 80% of all liver cancers and is the sixth most common cancer and the second most common cause of cancer-related death worldwide. The survival rate of sorafenib-treated advanced HCC patients is still unsatisfactory. Unfortunately, no useful biomarkers have been verified to predict sorafenib efficacy in HCC. We assessed a sorafenib resistance-related microarray dataset and found that anterior gradient 2 (AGR2) is highly associated with overall and recurrence-free survival and several clinical parameters in HCC. However, the mechanisms underlying the role of AGR2 in sorafenib resistance and HCC progression remain unknown. We found that sorafenib induces AGR2 secretion via posttranslational modification, and AGR2 plays a critical role in sorafenib-regulated cell viability and endoplasmic reticulum (ER) stress and induces apoptosis in sorafenib-sensitive cells. Sorafenib downregulated intracellular AGR2 and conversely induces AGR2 secretion, which suppresses its regulation of ER stress and cell survival in sorafenib-sensitive cells. In addition, AGR2 is highly intracellularly expressed in sorafenib-resistant cells, which supports ER homeostasis and cell survival. We suggest that AGR2 regulates ER stress to influence HCC progression and sorafenib resistance. This is the first report that AGR2 can modulate ER homeostasis via the IRE1α-XBP1 cascade to regulate HCC progression and sorafenib resistance. Elucidation of the predictive value of AGR2 and its molecular and cellular mechanisms in sorafenib resistance could provide additional opportunities for HCC treatment.

Hepatocellular carcinoma

Anterior gradient 2

Sorafenib

Resistance

Cancer progression

ER stress

Hepatocellular carcinoma (HCC) is the most common hepatic malignant tumor and the 2nd most common cause of cancer-related death worldwide [1]. Approximately 70% of patients are ineligible for curative therapy when they are diagnosed. Sorafenib is the first-line systemic therapy for advanced HCC to prolong survival [2]. Sorafenib is a multiple tyrosine kinase inhibitor (TKI) that inhibits numerous cell surface tyrosine kinases, such as vascular endothelial growth factor receptor (VEGFR)-1, VEGFR-2, VEGFR-3, platelet-derived growth factor receptor (PDGFR)-β and downstream associated serine/threonine kinases involved in the mitogen-activated protein kinase (MAPK) cascade [3, 4]. In vitro, sorafenib blocks cell proliferation and induces cell apoptosis in HCC cell lines and also inhibits tumor growth and inducing tumor cell apoptosis in vivo [5]. Sorafenib is effective in increasing the median survival time of HCC patients by approximately 3–5 months. However, several side effects are associated and usually followed by drug resistance [6]. Several mechanisms and pathways related to acquired resistance to sorafenib have also been identified; these include the epithelial-mesenchymal transition (EMT) mechanism, the activation of hypoxia-inducible pathways, the phosphatidylinositol-3-kinase (PI3K)/Akt pathway, and the Janus kinase-signal transducer and activator of transcription (JAK-STAT) pathway [6]. Moreover, JAK/STAT pathway-related molecules, such phospho-STAT3 and its downstream proapoptotic proteins Mcl-1 and cyclin D1, exhibit dysregulated expression in HCC cell lines with sorafenib resistance [7]. Previously, Liovet et al. reported that HCC cancer progression is enhanced after sorafenib treatment through paracrine secretion of hepatocyte growth factor by stromal cells stimulated by VEGFA [8]. Unfortunately, there are no useful markers to predict the efficiency of sorafenib targeted therapy in HCC thus far.

We retrieved two databases, including the sorafenib-resistant dataset for Huh7 cells by Regan-Fendt et al. (GSE94550, [9]) and the Roessler Liver microarray dataset from Oncomine (GSE14520, [10]) in this study. We utilized > 2-fold change as the criterion for selection of sorafenib-modulated molecules in sorafenib-resistant Huh7 cells compared to parental cells (GSE94550) and > 1.2-fold as the criterion for choosing oncogenes related to survival in the bottom 25% vs. the top 25% of HCC patients from the Roessler Liver microarray (GSE14520) to intersect the potential candidates for further study. Following the above analysis, the selected genes were validated and filtered more stringently and applied to evaluate highly significant molecules in this study. Interestingly, anterior gradient 2 (AGR2) was the major gene highly correlated with the survival rate and sorafenib resistance in liver cancer, but its associated mechanism and physiological significance have not been well elucidated. Therefore, AGR2 was selected for further study to investigate its molecular mechanism associated with sorafenib resistance and its physiological role in HCC.

The AGR2 protein is part of the protein disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze thiol-disulfide interchange and protein folding reactions [11, 12]. AGR2 protein was first identified in the estrogen receptor-expressing MCF-7 breast cancer cell line, which is regulated by estrogen both in vitro and in vivo [13–15]. AGR2 can be detected in different types of cancer, and it is highly expressed in liver, breast, pancreas and bladder cancer tissues compared with healthy tissues [16]. Although AGR2 is an ER-resident protein, it is also localized in the nucleus [17], cytoplasm [18], mitochondria [19], cell surface [20], extracellular matrix [21], urine [22] and blood [21]. Recently, Delom et al. showed that AGR2, localized in the extracellular matrix, makes cancer cells more aggressive [23]. Moreover, AGR2 dysregulation has been implicated in disease processes such as cancer progression and drug resistance [24]. Arumugam et al. reported that recombinant AGR2 can enhance pancreatic ductal adenocarcinoma cell migration, invasion and proliferation through C4.4a cell surface receptor-mediated signaling [25]. siRNA-mediated AGR2 knockdown induces cell death, inhibits cell growth and arrests the cell cycle in breast cancer cells [26]. Similarly, AGR2 promotes cell growth and migration through the Akt signaling pathway in non-small-cell lung cancer; moreover, the phospho-Akt level is reduced after depletion of AGR2 [27]. EGFR signaling is triggered by high expression of AGR2, which is defined as an early initiating factor and serves as a potential target for the curative treatment of neoplastic and chronic pancreatic disease [28]. Based on the above evidence, we suggest that the expression of AGR2 might be a marker to predict the presence of drug resistance in individual patients.

AGR2 and ER stress

Previously, AGR2 was defined as a dominant factor in ER homeostasis [29]. Under ER stress, a series of adaptive mechanisms, such as unfolded protein response (UPR) signaling, are activated to cope with increased protein folding in the ER [30]. ER stress and UPR signaling activation result in the development and progression of human diseases, including cancer [30]. Moreover, AGR2 has been demonstrated to be modulated by the UPR, probably through the PERK, ATF6, and IRE1α arms of the UPR, which can regulate the ER-associated degradation machinery (ERAD), resulting in the induction of the cell’s ability to resolve ER stress [29]. Therefore, we suggest that AGR2 plays a critical role in the regulation of UPR signaling and ER stress.

In the present study, we found that AGR2 was highly correlated with overall and recurrence-free survival rates and several clinical parameters in liver cancer. AGR2 was more highly expressed in sorafenib-resistant cells than in sorafenib-sensitive cells, and AGR2 was downregulated by sorafenib in both cell lines. Sorafenib-resistant cells are more tolerant to sorafenib and exhibit a lower apoptosis rate than sorafenib-sensitive cells. Sorafenib-induced cell death in HCC can be reversed and induced with recombinant AGR2 and AGR2-silencing constructs, respectively.

The diverse regulatory mechanism involved in sorafenib-induced cell death in both sorafenib-sensitive and sorafenib-resistant cells may be mediated by the modulation of ER stress and X-box binding protein (XBP) 1 status. This is the first report to uncover the molecular mechanism implicated in drug resistance to sorafenib, and elucidation of the predictive role, molecular and cellular mechanisms of AGR2 related to sorafenib resistance can provide additional opportunities to establish complementary therapies for HCC.

Cell culture and treatments

The HepG2, Huh7, J7 and Hep3B human hepatoma cell lines were routinely cultured in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen, Grand Island, NY) supplemented with 10% fetal bovine serum (HyClone, Road Logan, UT). These hepatoma cells were stimulated with 0–10 µM sorafenib (Sigma–Aldrich, Burlington, MA).

Immunohistochemistry

The use of archived formalin-fixed, paraffin-embedded tissue blocks was approved by the Institutional Review Board of MacKay Memorial Hospital. Tissue slides from glioblastoma patients were evaluated by immunohistochemistry and hematoxylin/eosin staining using a polyclonal antibody against PON2 (LifeSpan BioSciences) through the avidin-biotin complex method, as described previously [31]. Immunoreactivity for PON2 was visualized using DAB/nickel substrate (Vector Laboratories, Burlingame, CA).

MTT assay

Cell viability was analyzed by the (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) (MTT) assay (Sigma–Aldrich, Burlington, MA). Cells (5 × 10³) were seeded on 96-well plates overnight. After treatment, 20 µl MTT reagent was added to each well for 3 h, and the absorbance at 570 nm was determined by a SpectraMax microplate reader.

Apoptosis assay

At the end of treatment, the cells were washed and resuspended in binding buffer (Annexin V PE Apoptosis Detection kit; BD Biosciences, East Rutherford, NJ). After incubation with annexin V-PE and propidium iodine (PI), binding buffer was added, and the cells were analyzed by fluorescence-activated cell sorting (FACScan, BD Biosciences). Data analysis was performed using Cell Quest software.

Quantitative RT–PCR

The cDNA template was prepared, and the quantitative PCR mixture contained 500 nM forward and reverse primers and 1× SYBR Green reaction mix (Applied Biosystems, Waltham, MA). SYBR Green fluorescence was determined by the ABI PRISM 7500 detection system (Applied Biosystems). AGR2 Forward- 5' GAGCCAAAAAGGACACAAAGGA 3', Reverse − 5' TGAGTTGGTCACCCCAACCT 3'; 18SrRNA Forward − 5' GCAGCTCACCTACCTGGAGAAATA 3', Reverse − 5' TGCGTGTGTGGGTCTTTGAA 3'.

Western blotting

Total protein was fractionated by 8–12% SDS–PAGE, transferred to an immobilon polyvinylidene difluoride membrane (Amersham Biosciences, Amersham, UK), and hybridized with one of the specific primary antibodies against AGR2 (GeneTex, Hsinchu, Taiwan), ATF6 (GeneTex), p-IRE1α (GeneTex), IRE1α (Cell Signaling Technology, Danvers, MA), p-PERK (GeneTex), PERK (Cell Signaling Technology) and β-actin (GeneTex) overnight at 4°C. Subsequently, the membrane was probed with the appropriate HRP-conjugated secondary antibodies for 1 h at room temperature. Finally, immune complexes were visualized using the chemiluminescence method with an ECL detection kit (Merck, Darmstadt, Germany).

Establishment of AGR2-silenced cells

Small hairpin (sh) RNA and small interfering (si) RNA targeting AGR2 were purchased from Academia Sinica and Thermo Fisher Scientific. HepG2 and Huh7 cells were transfected with siRNA and/or shRNA targeting AGR2 with Lipofectamine 2000 Reagent (Invitrogen). After transfection, the expression of AGR2 was determined using RT–PCR and Western blotting.

Establishment of sorafenib-resistant HCC cells

Hepatoma cells, including HepG2 or Huh7 cells, were cultured in medium containing increasing concentrations of sorafenib in the range of 0.5–7 µM over a period of 6 months. After successful establishment, sorafenib-resistant HepG2 (SR-HepG2) and Huh7 (SR-Huh7) cells were maintained with medium containing 7 µM sorafenib.

Preparation of conditioned medium (CM)

The CM were collected and centrifuged at 2000 x g for 5 min to eliminate intact cells, followed by concentration using spinning columns with a 3-kDa molecular weight cutoff (Amicon Ultra, Millipore), and stored at -80⁰ °C for subsequent experiments.

Statistical analysis

The correlations between AGR2 level (Roessler liver array, 39-△Ct) and clinicopathological indicators were assessed using the Wilcoxon rank sum test. Data are presented as the mean ± SD. Recurrence-free survival (RFS) and OS (OS) were calculated using the Kaplan–Meier method, and the log-rank test was used to assess the differences between groups. A Cox proportional hazards regression model was used to measure the independence of different factors. Cox regression was performed via forward stepwise analysis, and only the prognostic variables that were significant in the univariate analysis were included in the model. All values are reported as the mean ± SD. Two-way ANOVA, Student’s t, chi-square, or Fisher’s exact tests were applied to evaluate experimental differences in groups. p values less than 0.05 were considered to indicate statistical significance.

AGR2 is clinically relevant in HCC

We retrieved two datasets, including the sorafenib-resistant dataset for Huh7 cells (GSE94550, [9]) and the Roessler Liver microarray dataset (GSE14520, [10]), and utilized > 2-fold change as the criterion for selection of sorafenib-modulated molecules in sorafenib-resistant Huh7 cells compared to parental cells (GSE94550) and > 1.2-fold as the criterion for choosing oncogenes related to survival in the bottom 25% vs. the top 25% of HCC patients from the Roessler Liver microarray dataset (GSE14520) to intersect the potential candidates for further study. According to the above analysis, the selected genes were validated and filtered more stringently and applied to evaluate highly significant molecules. After retrieving these datasets, 545 upregulated genes (sorafenib resistance vs. control > 2-fold) and 609 downregulated genes (sorafenib resistance vs. control < 2-fold) were identified in the sorafenib-resistant database in hepatoma Huh7 cells (GSE94550). In the Roessler Liver microarray (GSE14520), we used > 1.2-fold as the criterion for choosing oncogenes related to survival in the bottom 25% vs. the top 25% of HCC patients, and only 12 dysregulated genes were identified (Fig. 1A). Furthermore, we found that there were 4 potential candidates identified in the two intersecting microarray datasets, including neurotensin (NTS), AGR2, alpha-fetoprotein (AFP) and meprin A, alpha (MEP1A) (Fig. 1A, B). Previously, the AGR2 protein was demonstrated to be a part of the PDI family of ER proteins that mediate the formation of disulfide bonds and catalyze protein folding [32]. Moreover, AGR2 is highly expressed in numerous cancer types, including liver cancer [16]. Hrstka et al. showed that AGR2 expression can be used as a marker to predict poor prognosis in breast cancer via clinical studies [15]. Hence, we suggest that AGR2 may be a potential candidate target in sorafenib-treated HCC. Interestingly, AGR2 is the major gene highly correlated with the survival rate and sorafenib resistance in liver cancer; however, the relationship between AGR2 and sorafenib treatment in HCC has not been demonstrated. Therefore, AGR2 was selected for further study to investigate its molecular mechanism associated with sorafenib resistance and its physiological role in HCC.

The clinical significance of AGR2 expression in the Roessler Liver database (GSE14520) and our collected cohort was analyzed (Fig. 1C-F). Patients with lower expression (last 40%) of AGR2 had a better OS rate (log-rank P < 0.05; AGR2 high (top 40%): standard error, 2.738; 95% CI, 36.196–46.927; AGR2 low (last 40%): standard error, 2.432; 95% CI, 45.322–54.857) and RFS rate (log-rank P < 0.05; AGR2 high (top 40%): standard error, 2.766; 95% CI, 27.398–38.243; AGR2 low (last 40%): standard error, 2.645; 95% CI, 36.365–46.734) (Fig. 1C and D). The Roessler Liver microarray dataset (GSE14520) provides detailed clinical information; therefore, the correlation between AGR2 and various clinical parameters was analyzed statistically to define the role of sorafenib-regulated AGR2 in HCC progression (Tables 1–3). High AGR2 expression was significantly correlated with high AFP and ALT levels, a high predicted risk metastasis signature score (Fig. 1E, F and G), large main tumor size and more advanced pathological stages of HCC (Fig. 1H and I). A high AGR2 level in HCC was correlated with a high serum AFP level (P = 0.002) (Table 1). Univariate analysis showed that male sex (P = 0.009), tumor size (P = 0.045), CLIP score (P = 0.002), BCLC staging (P < 0.001), AJCC stage (P < 0.001), and high AGR2 level (P = 0.003) were significant predictors of worse RFS (Table 2). Multivariate analysis showed that male sex (P = 0.023, HR = 2.124, CI = 1.112–4.058), BCLC staging (P = 0.021, HR = 1.653, CI = 1.077–2.535), AJCC staging (P = 0.019, HR = 1.607, CI = 1.083–2.386) and a high AGR2 level (P = 0.010, HR = 1.572, CI = 1.112–2.224) were independently associated with RFS (Table 2). For OS, univariate analysis showed that cirrhosis (P = 0.023), AFP level (P = 0.011), tumor size (P = 0.001), CLIP score (P < 0.001), BCLC staging (P < 0.001), AJCC stage (P < 0.001), and high AGR2 level (P = 0.002) were significant predictors of worse OS (Table 3). Multivariate analysis showed that cirrhosis (P = 0.034, HR = 4.563, CI = 1.122–18.555), BCLC staging (P < 0.001, HR = 2.928, CI = 1.908–4.494), and a high AGR2 level (P = 0.008, HR = 1.735, CI = 1.154–2.609) were independently associated with OS (Table 3).

Table 1

**Association of AGR2 level (Roessler liver array) with clinicopathologic indicators of hepatocellular carcinoma**
Factors	Group	AGR2 (mean ± SE)	P
Age	< 60 years	4.3208 ± 0.1474	0.900
	≥ 60 years	4.3935 ± 0.3107
Sex	Male	4.3334 ± 0.1422	0.926
	Female	4.3525 ± 0.3850
Cirrhosis	Absent	3.6259 ± 0.3076	1.162
	Present	4.3963 ± 0.1415
Serum AFP	< 300	3.8669 ± 0.1446	0.002*
(ng/ml)	≥ 300	4.8537 ± 0.2261
Tumor size	< 5 cm	4.1165 ± 0.1462	0.055
	≥ 5 cm	4.7315 ± 0.2591
CLIP	0–1	4.2594 ± 0.1429	0.420
	≥ 2	4.6445 ± 0.3413
BCLC	0–1	4.1908 ± 1.9342	0.094
	≥ 2	4.8530 ± 2.4513
AJCC stage	I	4.1535 ± 1.8291	0.381
	≥II	4.4955 ± 2.2573
* P < 0.05. CLIP, Cancer of the Liver Italian Program score; BCLC, Barcelona Clinic Liver Cancer staging; AJCC, American Joint Committee on Cancer 2017; AFP, alpha-fetoprotein.

Table 2

**Prognostic significance of clinicopathologic indicators and AGR2 for recurrence-free survival in the Roessler liver array.**
	RFS univariate
Factor	Group	HR	95% CI	P	HR	95% CI	P
Age	< 60/≥60 years	0.952	0.628–1.443	0.817
Sex	Female/Male	2.359	1.238–4.493	0.009*	2.124	1.112–4.058	0.023*
Cirrhosis	-/+	2.003	0.936–4.287	0.074
Serum AFP	< 300/≥300 ng/ml	1.314	0.937–1.842	0.113
Tumor size	< 5/≥5 cm	1.424	1.008–2.012	0.045*			NS
CLIP	0–1/≥2	1.872	1.267–2.766	0.002*			NS
BCLC	0–1/≥2	2.432	1.670–3.543	< 0.001*	1.653	1.077–2.535	0.021*
AJCC stage	I / ≥II	2.063	1.405–3.029	< 0.001*	1.607	1.083–2.386	0.019*
AGR2	Low/High	1.691	1.202–2.378	0.003*	1.572	1.112–2.224	0.010*
^*P < 0.05. RFS, recurrence-free survival; CLIP, Cancer of the Liver Italian Program score; BCLC, Barcelona Clinic Liver Cancer staging; AJCC, American Joint Committee on Cancer 2017; AFP, alpha-fetoprotein.

Table 3

**Prognostic significance of clinicopathologic indicators and AGR2 for overall survival in the Roessler liver array.**
	RFS univariate
Factor	Group	HR	95% CI	P	HR	95% CI	P
Age	< 60/≥60 years	0.990	0.972–1.008	0.990
Sex	Female/Male	1.858	0.901–3.833	0.094
Cirrhosis	-/+	5.093	1.255–20.671	0.023*	4.563	1.122–18.555	0.034*
Serum AFP	< 300/≥300 ng/ml	1.686	1.126–2.527	0.011*
Tumor size	< 5/≥5 cm	1.960	1.309–2.933	0.001*
CLIP	0–1/≥2	2.811	1.832–4.313	< 0.001*
BCLC	0–1/≥2	3.176	2.081–4.846	< 0.001*	2.928	1.908–4.494	< 0.001*
AJCC stage	I / ≥II	2.278	1.483-3.500	< 0.001*
AGR2	Low/high	1.919	1.282–2.873	0.002*	1.735	1.154–2.609	0.008*
^*P < 0.05. OS, overall survival; CLIP, Cancer of the Liver Italian Program score; BCLC, Barcelona Clinic Liver Cancer staging; AJCC, American Joint Committee on Cancer 2017; AFP, alpha-fetoprotein.

Moreover, our HCC specimen cohort was also analyzed. We utilized qRT–PCR to examine the levels of AGR2, and a median level of 15.3 (39-△Ct) was defined as the cutoff to divide the HCC specimens into high and low expression of AGR2. Similar results were observed; high levels of AGR2 were related to significantly worse OS and RFS rates (Fig. 1J and K). Furthermore, the correlation between AGR2 expression and various clinical parameters from our collected cohort was also analyzed (Table 4–6). A higher AGR2 level in HCC was observed in female patients (P = 0.007) (Table 4). A high AGR2 level (39-△Ct ≥ 10.8) in HCC was significantly associated with worse OS (P = 0.016) (Fig. 1J) and RFS (P = 0.045) (Fig. 1K). Univariate analysis showed that cirrhosis (P = 0.022), AFP level (P = 0.033), vascular invasion (P = 0.003), AJCC stage (P = 0.003), and high AGR2 level (P = 0.047) were significant predictors of worse RFS (Table 5). Multivariate analysis showed that cirrhosis (P = 0.023, HR = 1.600, CI = 1.067–2.401), vascular invasion (P = 0.005, HR = 1.825, CI = 1.198–2.780), and a high AGR2 level (P = 0.043, HR = 1.662, CI = 1.017–2.716) were independently associated with RFS (Table 5). For OS, univariate analysis showed that cirrhosis (P = 0.020), AFP level (P = 0.012), vascular invasion (P < 0.001), AJCC stage (P = 0.007), and high AGR2 level (P = 0.018) were significant predictors of worse OS (Table 6). Multivariate analysis showed that cirrhosis (P = 0.017, HR = 1.655, CI = 1.093–2.505), vascular invasion (P = 0.001, HR = 2.200, CI = 1.392–3.476), and a high AGR2 level (P = 0.015, HR = 1.945, CI = 1.138–3.324) were independently associated with OS (Table 6).

Table 4

**Association of AGR2 expression with clinicopathologic indicators of hepatocellular carcinoma**
Factors	Group	AGR2 (mean ± SE)	P
Age	< 60 years	15.8713 ± 0.7077	0.659
	≥ 60 years	16.2616 ± 0.4603
Sex	Male	15.4998 ± 0.4755	0.007*
	Female	17.6959 ± 0.5801
Hepatitis viral	Absent	15.9186 ± 0.6085	0.812
infection	Present	16.2114 ± 0.4827
Cirrhosis	Absent	16.1498 ± 0.4687	0.989
	Present	16.0949 ± 0.6798
Serum AFP	< 200	15.8232 ± 0.5254	0.403
(ng/ml)	≥ 200	16.5543 ± 0.5651
Tumor	W	14.4390 ± 1.5358	0.240
differentiation	M-P	16.2353 ± 0.3985
Tumor size	< 5 cm	15.7190 ± 0.5735	0.482
	≥ 5 cm	16.3917 ± 0.5167
Vascular	Absent	15.5317 ± 0.6740	0.198
invasion	Present	16.5114 ± 0.4624
AJCC stage	I	15.3584 ± 0.8662	0.241
	≥II	16.3968 ± 0.4242
* P < 0.05. Tumor differentiation by WHO; AJCC, American Joint Committee on Cancer 2017; AFP, alpha-fetoprotein.

Table 5

**Prognostic significance of clinicopathologic indicators and AGR2 for recurrence-free survival in the clinical cohort.**
	RFS univariate
Factor	Group	HR	95% CI	P	HR	95% CI	P
Age	< 60/≥60 years	1.079	(0.713–1.632)	0.720
Sex	Male/female	1.059	(0.672–1.670)	0.804
Viral infection				0.248
	No/B	1.667	(0.977–2.844)	0.061
	No / C	1.274	(0.739–2.915)	0.384
	No / B + C	1.647	(0.835–3.262)	0.152
Cirrhosis	-/+	1.602	(1.069–2.401)	0.022*	1.600	(1.067–2.401)	0.023*
Serum AFP	< 200/≥200 ng/ml	1.548	(1.037–2.312)	0.033*			NS
Differentiation	W/M-P	3.053	(0.964–9.670)	0.058
Tumor size	< 5/≥5 cm	1.161	(0.764–1.765)	0.484
Vascular invasion	-/+	1.899	(1.248–2.890)	0.003*	1.825	(1.198–2.780)	0.005*
AJCC stage	I / ≥II	2.100	(1.282–3.440)	0.003*			NS
AGR2	Low/high	1.638	(1.006–2.670)	0.047*	1.662	(1.017–2.716)	0.043*
^*P < 0.05. DFS, disease-free survival; Tumor differentiation according to WHO system; AFP, alpha-fetoprotein; AJCC, American Joint Committee on Cancer 2017

Table 6

**Prognostic significance of clinicopathologic indicators and AGR2 for overall survival in the clinical cohort.**
	OS univariate
Factor	Group	HR	95% CI	P	HR	95% CI	P
Age	< 60/≥60 years	0.975	(0.638–1.490)	0.907
Sex	Male/female	1.407	(0.906–2.186)	0.936
Viral infection				0.281
	No/B	1.546	(0.890–2.685)	0.122
	No / C	1.014	(0.573–1.794)	0.962
	No / B + C	1.433	(0.704–2.916)	0.322
Cirrhosis	-/+	1.632	(1.080–2.466)	0.020*	1.655	(1.093–2.505)	0.017*
Serum AFP	< 200/≥200 ng/ml	1.692	(1.122–2.551)	0.012*			NS
Differentiation	W/M-P	1.330	(0.851–2.079)	0.210
Tumor size	< 5/≥5 cm	1.101	(0.720–1.683)	0.658
Vascular invasion	-/+	2.302	(1.458–3.635)	< 0.001*	2.200	(1.392–3.476)	0.001*
AJCC stage	I/≥II	2.076	(1.224–3.521)	0.007*			NS
AGR2	Low/high	1.894	(1.114–3.221)	0.018*	1.945	(1.138–3.324)	0.015*
^*P < 0.05. OS, overall survival; Tumor differentiation according to WHO system; AFP, alpha-fetoprotein; AJCC, American Joint Committee on Cancer 2017

Moreover, immunohistochemical staining was utilized to examine the expression of AGR2 in HCC tissues, and the results indicated that AGR2 was highly expressed in tumor tissues compared to normal tissues (Fig. 1L, M). Collectively, based on the evidence, we found that patients with lower expression of AGR2 have a better OS rate; hence, we suggest that AGR2 might play an oncogenic role in HCC progression and thus might be a useful prognostic marker for HCC progression.

Sorafenib decreases cell viability and increases cell apoptosis

First, to determine the effect of sorafenib on cell viability, the HCC cell lines were treated with various doses of sorafenib (5–10 µM, 24–48 h). Cell viability was significantly decreased with sorafenib treatment in a dose-dependent manner in J7, Hep3B, HepG2 and Huh7 cells according to the MTT assay (Fig. 2A-D). Moreover, flow cytometry was utilized to determine whether sorafenib influences HCC cell apoptosis. HepG2 and Huh7 cells were stimulated with 5 and 10 µM sorafenib for 24 h. Cell apoptosis was slightly induced with 5 µM sorafenib; however, the increase in the apoptosis rate compared with that in the control reached approximately 25% after 10 µM sorafenib stimulation in both HepG2 and Huh7 cells (Fig. 2E-H). Based on the results, we found that sorafenib can modulate HCC cell viability and apoptosis abilities; subsequently, we evaluated whether AGR2 is involved in the sorafenib-regulated phenotypes.

Sorafenib induces AGR2 secretion instead of transcriptional regulation

After we retrieved the dataset (GSE94550), AGR2 was induced in sorafenib-resistant Huh7 cells compared to parental cells (Fig. 1A). To further examine whether sorafenib could regulate AGR2 expression in HCC, RT–PCR and Western blotting were utilized in parental HCC cell lines treated with sorafenib. First, we found that the RNA level of AGR2 was not altered by sorafenib in J7, HepG2, Huh7 and Hep3B cells (Fig. 2I-L). However, the protein level of AGR2 in the cell lysate was unexpectedly decreased after sorafenib stimulation in these cells in a dose-dependent manner, as shown by Western blotting (Fig. 2M-P). Based on these contradictory results, sorafenib regulated the RNA and protein levels of AGR2 in parental HCC cells. Moreover, several reports have shown that AGR2 is an ER-resident protein that is also localized in the extracellular matrix, blood and urine[21, 22]. Therefore, we collected CM with 5 and 10 µM sorafenib treatments for 24 h. As expected, AGR2 was detected and induced by sorafenib in CM from Hep3B cells (Fig. 2Q, R). Based on the evidence, we suggest that sorafenib regulates AGR2 through posttranslational modification, not transcriptional regulation, in parental HCC cells.

Agr2 Plays A Role In Cell Viability And Apoptosis

To analyze the roles of AGR2 in HCC progression, we established AGR2-silenced Hep3B, HepG2 and Huh7 cells (Fig. 3A(a), B(a), C(a)), and cell viability was determined using the MTT assay. Cell viability was significantly decreased after AGR2 silencing, and the effect was more obvious when combined with sorafenib treatment (Fig. 3A(b), B(b), C(b)). The evidence suggests that AGR2 plays a role in promoting cancer progression. Additionally, we investigated whether AGR2 has effects on cell apoptosis. Flow cytometry analysis was utilized to demonstrate that sorafenib can induce significant cell apoptosis of approximately 10% compared with the control, which was more conspicuous after AGR2 silencing in the presence of sorafenib compared to the control (siNC) in Hep3B, HepG2 and Huh7 cells (Fig. 3D, E, F). Quantitative results shown in panels 3D(b), E(b), F(b). However, we found that AGR2 can be secreted into CM and detected by Western blotting (CM, Fig. 2Q, R). Previously, Fessart et al. reported that extracellular AGR2 is defined as an extracellular matrix pro-oncogenic regulator and makes cancer cells more aggressive [21]. Hence, we evaluated whether the addition of recombinant AGR2 protein regulates cell viability and apoptosis. Flow cytometry analysis indicated that 10 µM sorafenib can induce cell apoptosis up to 30–40% at 24 h in both HepG2 and Huh7 cells; however, the phenomenon can be reversed with 60 ng/ml recombinant AGR2 (rAGR2) (Fig. 3G, H). Based on the evidence, we suggest that AGR2 secreted into CM with sorafenib stimulation plays an oncogenic role in HCC cancer progression.

Sorafenib Induces Er Stress In Hcc

We have determined the functions and regulatory mechanisms of AGR2 by sorafenib. Based on a literature search, AGR2 has been demonstrated to be upregulated upon ER stress, and ER stress-related molecules such as protein kinase R (PKR)-like endoplasmic reticulum kinase (PERK), inositol-requiring enzyme 1 (IRE1) and activating transcription factor 6 (ATF6) are dysregulated in many types of cancers [16]. Therefore, the relationship between sorafenib and ER-related factors was determined. Among these molecules, we found that phospho-IRE1α (p-IRE1α) was upregulated with 10 µM sorafenib treatment in HepG2 and Huh7 cells using Western blotting (Fig. 4A). Moreover, X-box binding protein 1 (XBP1) has been reported as a unique transcription factor modulating gene expression for ERAD and promoting protein folding[33]. In the UPR, IRE1α is activated via oligomerization and autophosphorylation, followed by the activation of its endoribonuclease to cleave and splice XBP1. The activated IRE1α endoribonuclease can remove 26 nucleotides from the intron of XBP1, leading XBP1 from preform XBP1 (XBP1u: unspliced) into activated XBP1 (XBP1 s: spliced) [34]. Therefore, RT–PCR was used to detect the status of the IRE-1 downstream factor XBP1. We found that XBP1 was spliced from inactive XBP1u to active XBP1s after stimulation with sorafenib for 24 and 48 h in HepG2 and Huh7 cells by RT–PCR (Fig. 4B, C). Subsequently, we wanted to verify whether AGR2 could play a role in the process from inactive XBP1u to active XBP1 s. As expected, the sorafenib-induced XBP1s levels were more robust in HepG2 and Huh7 cells (Fig. 4D). In contrast, we further verified whether added recombinant AGR2 (rAGR2) could modulate the splicing of inactive XBP1u to activate XBP1s. Similarly, the levels of XBP1s induced by 10 µM sorafenib were reduced after stimulation with 60 ng/ml rAGR2 in HepG2 and Huh7 cells (Fig. 4E). Collectively, the evidence indicated that sorafenib induced HCC ER stress via the IRE1α-XBP1 cascade through AGR2 regulation.

AGR2 possesses diverse roles

To determine whether AGR2 plays a diverse role in resistant sublines compared to sorafenib-sensitive HCC cells, HepG2 sorafenib-resistant (HepG2-SR) and Huh7 sorafenib-resistant (Huh7-SR) cells were established (Fig. 5A, B). We applied 7 µM sorafenib to the culture medium to generate sorafenib-resistant cell lines for the following experiments. We found that cell viability was decreased by approximately 50% after sorafenib treatment (7 µM) in parental HepG2 and Huh7 cells (indicated as PC) using the MTT assay; however, sorafenib only reduced cell viability 10 ~ 20% in resistant cells (indicated as SR) (Fig. 5A, B). The evidence indicated that these SR cell lines are protected against sorafenib challenge. We found that AGR2 was related to resistance and upregulated by sorafenib in the GSE94550 dataset (Fig. 1A, B). Therefore, we wanted to verify whether the regulation could be observed in our sorafenib-resistant cells. Expectedly, AGR2 was highly expressed intracellularly in sorafenib-resistant HepG2 and Huh7 cells compared with parental cells (Fig. 5C). We also found that sorafenib reduced intracellular AGR2 levels in HepG2-SR and Huh7-SR cells (Fig. 5D), and the tendency was similar to that of sorafenib-regulated AGR2 in HepG2-PCs and Huh7-PCs (Fig. 2M-P). Moreover, we also found that sorafenib can induce AGR2 secretion in CM in HepG2-SR and Huh7-SR cells compared with controls. The effect was stronger in resistant cells than in parental cells (Fig. 5E). Collectively, the evidence indicated that AGR2 induction in both the cell lysate and CM of sorafenib-resistant cells was more robust than that in parental cells in the presence and absence of sorafenib. This evidence might indicate why SR cells are protected against sorafenib.

Sorafenib-resistant cells modulate ER stress and reduce cell apoptosis

To determine whether sorafenib-resistant cells can resist the effect of sorafenib-induced cell apoptosis, flow cytometry analysis was utilized to demonstrate that cell apoptosis was induced after stimulation with various doses of sorafenib for 24 h in HepG2 (Fig. 6A, B) and Huh7 (Fig. 6C, D) parental cells. The ratio of cells undergoing sorafenib-induced apoptosis reached approximately 30% among parental cells; however, the effect was not observed in sorafenib-resistant cells (Fig. 6A-D). Based on the evidence, we suggest that these resistant cells are protected against sorafenib toxicity, which prolongs cancer cell viability. Furthermore, we wanted to analyze whether AGR2 plays a vital role in inducing HCC resistance to sorafenib. Therefore, we silenced AGR2 in HepG2 SR and Huh7 SR cells and performed an apoptosis assay. The evidence indicated that sorafenib can induce cell apoptosis, but the effect was more robust after AGR2 knockdown (Fig. 6E-H). According to these findings, we speculated that AGR2 plays a critical role in inducing sorafenib resistance in HCC.

We found that the ER stress-related molecule p-IRE1α was induced with sorafenib treatment; subsequently, we determined whether p-IRE1α regulation could occur in sorafenib-resistant cells. The levels of p-IRE1α were decreased after sorafenib stimulation in sorafenib-resistant (SR) HepG2 and Huh7 cells, and the effect was inconsistent in parental cells (PC) by Western blot (Fig. 7A, B). Moreover, we found that the sorafenib-induced changes in the levels of spliced XBP1 (XBP1s), a downstream factor of IRE1α, were abolished or attenuated in HepG2-SR and Huh7-SR cells according to RT–PCR, and this was not observed in parental HepG2 and Huh7 cells (Fig. 7C).

Furthermore, we evaluated whether the effect could be mediated by AGR2 in sorafenib-resistant cells. The data indicated that the expression of XBP1s was induced after silencing AGR2 expression and was more elevated after stimulation with sorafenib (Fig. 7D). The evidence implied that AGR2 is more essential under cell stress conditions. Collectively, the contradictory evidence in sorafenib-sensitive and -resistant cells may imply that cells can resist sorafenib toxicity by modulating ER stress-related molecules to decrease cellular ER stress.

Based on the evidence, we proposed that sorafenib reduces cell viability and induces cell apoptosis via downregulation of AGR2 in the cell lysate and increased secretion in CM, which induces ER stress via upregulation of p-IRE1α and spliced XBP1 in HCC. However, the phenomenon of sorafenib-induced apoptosis was abolished in sorafenib-resistant cells, and this effect may occur through increased AGR2 expression in cell lysates and downregulation of p-IRE1α and spliced XBP1. Overall, AGR2 might modulate ER stress to protect cells from sorafenib toxicity and extend cell survival (Fig. 8).

In the present study, we found that AGR2 is significantly correlated with OS, RFS, and various clinical parameters, including AFP, ALT, predicted risk metastasis signature score, tumor size, and pathological stage. We utilized sorafenib-sensitive and sorafenib-resistant cells to determine the roles of AGR2 in cancer progression and drug resistance in HCC. We suggest that AGR2 plays diverse roles and mechanisms in these two models to influence HCC progression and sorafenib resistance. Functionally, AGR2 knockdown reduces cell viability and induces cell apoptosis with sorafenib treatment in parental HCC cell lines. Moreover, the phenomenon of sorafenib-induced cell apoptosis in sorafenib-sensitive cells is almost abolished in sorafenib-resistant cells. Mechanistically, sorafenib modulates AGR2 through posttranslational modification instead of transcriptional regulation and activates the IRE1α-XBP1 cascade to induce death in parental cells, but this effect is not observed in sorafenib-resistant cells. This is the first report to uncover the role of AGR2 in sorafenib-resistant HCC and explain how AGR2 induces HCC resistance to sorafenib and reduces cell apoptosis.

The regulation of ER stress-related molecules by sorafenib is also diverse in these two models. Collectively, our preliminary data highlight a novel regulatory mechanism of AGR2 that may serve as a critical determinant of cancer progression and drug resistance in HCC.

Cancer cells often initiate ER stress via misfolded protein accumulation in the ER due to protein overexpression, nutrient deprivation or hypoxia. Cells can activate UPR signaling to trigger ER homeostasis to prolong cell survival [35]. The AGR2 protein is an ER-resident protein that catalyzes thiol-disulfide interchange and protein folding reactions [11, 12]. Based on our results, we showed that dysregulated AGR2 expression and ER stress-related molecules appeared in sorafenib-sensitive and sorafenib-resistant cells. Decreased AGR2 and increased p-IRE1α and spliced XBP1 induced by sorafenib were observed in the cell lysate of sorafenib-treated sensitive cells; in contrast, increased AGR2 in CM and decreased p-IRE1α and spliced XBP1 induced by sorafenib appeared in sorafenib-treated resistant cells. According to these diverse effects, we speculated that the ER stress level differed in these two cell models. Sorafenib induced higher ER stress in parental HCC cells; however, sorafenib-induced ER stress was attenuated in sorafenib-resistant cells, implying that ER stress might be a critical factor in determining whether the cell could resist sorafenib. Therefore, we suggest that ER stress homeostasis is a therapeutic target to influence the status of sorafenib resistance in HCC.

In the present study, cell viability and cell apoptosis were changed in Hep3B, HepG2 and Huh7 parental cells after silencing AGR2 upon sorafenib treatment. AGR2 contributes to ER homeostasis via UPR signaling, including the IRE1α-XBP1 cascade [29]. In the present study, we found that spliced XBP1 levels were increased by silencing AGR2 in the presence or absence of sorafenib in both sorafenib-sensitive and sorafenib-resistant cells. We further identified that exogenous recombinant AGR2 can reduce sorafenib-induced XBP1 splicing. However, it is unclear whether XBP1 could be an upstream effector modulating AGR2 expression in HCC progression and resistance to sorafenib. Some ER stress inhibitors, including tauroursodeoxycholic acid (TUDCA, 100 µM, [36]) and the IRE1α endonuclease inhibitor MKC-3946 (10 µM, [37]), can be used to inhibit ER stress to further delineate the relationship between AGR2 and ER stress in both sorafenib-sensitive and -resistant cells. Collectively, we provided a new mechanism by which AGR2 might act as an upstream factor of XBP1 to modulate ER homeostasis to influence the status of cell death or survival in sorafenib-sensitive and sorafenib-resistant HCC.

We have preliminarily identified the functions and regulatory mechanisms of AGR2 in the response to sorafenib. AGR2 has been demonstrated to be upregulated upon ER stress, and ER stress-related molecules such as protein kinase R (PKR)-like endoplasmic reticulum kinase (PERK), inositol-requiring enzyme 1 (IRE1) and activating transcription factor 6 (ATF6) are dysregulated in many types of cancers [16]. Herein, we identified that AGR2 can modulate the IRE1α-XBP1 cascade to modulate ER homeostasis to switch HCC from the sorafenib-sensitive to the sorafenib-resistant type. However, other ER stress-related signaling molecules affected by sorafenib in this study; the levels of total ATF6, cleaved ATF6 and p-PERK were regulated by sorafenib, as shown by Western blotting, but the regulatory effects of sorafenib were slightly weaker than those of IRE1α. Hence, we speculated that ATF6 and PERK may constitute another potential pathway regulated by AGR2 that influences cancer cell progression and resistance to sorafenib. In conclusion, we suggest that the AGR2-IRE1α-XBP1 cascade is an ER-related pathway that regulates HCC progression; hence, signaling might be a potential therapeutic target for curing sorafenib-resistant HCC in the future.

Previously, research has shown that intracellular AGR2 (iAGR2) can promote cancer cell growth and survival, and extracellular AGR2 (eAGR2) is defined as a microenvironment regulator, which can make cancer cells more aggressive [21, 29]. We have found that AGR2 can be detected in CM in both sorafenib-sensitive and sorafenib-resistant cells, and the induction ratio with sorafenib treatment was more robust in resistant cells than in sensitive cells. However, the roles of iAGR2 and eAGR2 in the presence of sorafenib are still unclear. Fessart et al. reported that extracellular AGR2 is defined as an extracellular matrix pro-oncogenic regulator and makes cancer cells more aggressive [21]. AGR2 has been demonstrated to have numerous domains, contributing to diverse functions in cancer cells [32]. However, it is not clear whether these domains are associated with cancer progression and drug resistance in the presence of sorafenib. The functions of AGR2 domains in both sorafenib-sensitive and -resistant cells need to be elucidated in more detail using truncated mutations of AGR2. Two truncated AGR2 forms, including deletions of amino acids (AAs) 1–20 and AA172-175, which can be localized to the extracellular space [32], can be utilized in the future. Therefore, we will be able to determine whether the subcellular location of AGR2 plays a critical role in regulating cancer progression and sorafenib resistance.

Sorafenib has been demonstrated to inhibit numerous receptor tyrosine kinases, such as VEGFR and PDGFR [4]. Sorafenib inhibits numerous cell surface tyrosine kinases, such as VEGFR-1, VEGFR-2, and VEGFR-3 [3, 4]. Moreover, extracellular AGR2 has been shown to bind directly to VEGF to enhance tumor angiogenesis and activities [38]. We found that AGR2 can be secreted into CM with sorafenib stimulation of sorafenib-resistant HepG2 and Huh7 cells, but this is not observed in parental cells. However, the mechanism underlying AGR2-induced resistance to sorafenib in HCC has never been elucidated. Hence, it is necessary to analyze whether recombinant AGR2 can directly interact with recombinant VEGF. Previously, several VEGFR- and PDGFR-related signaling pathways, including the RAS, RAF, MEK, ERK, PI3K/Akt and JAK-STAT pathways, have been reported to be inhibited by sorafenib [6]. However, the signaling underlying AGR2-induced resistance to sorafenib in HCC has never been elucidated. Therefore, these pathways also need to be examined in sorafenib-sensitive and sorafenib-resistant cells with AGR2 silencing and AGR2 overexpression in the presence of sorafenib in the future. Elucidation of the predictive role and molecular and cellular mechanisms of AGR2 related to sorafenib resistance can provide additional opportunities to establish complementary therapies for HCC.

Ethics approval and consent to participate:

The National Health Research Institute Biobank and its associated institutions or providing the biological specimen and related clinical data (all of which have been deidentified) for our research. The doxorubicin-treated HCC patient specimens were obtained from the human biobank of National Cheng Kung University Hospital.

Consent for publication:

The authors agree to publish

Competing interests:

The authors declare no conflict of interests.

Funding:

This work was supported by grants from the Ministry of Science and Technology of the Republic of China (MOST 109-2320-B-006-067 to C.-Y.C.) and National Cheng Kung University Hospital (NCKUH-11102040)

Acknowledgments:

We would like to thank The National Health Research Institute Biobank and its associated institutions or providing the biological specimen and related clinical data (all of which have been deidentified) for our research. The National Health Research Institute Biobank is supported by grants from the Ministry of Health and Welfare, Ministry of Science and Technology and National Health Research Institutes, Taiwan. We are grateful for the support from the Human Biobank, Research Center of Clinical Medicine and the Cancer Data Bank of National Cheng Kung University Hospital. This work was supported by grant from the Ministry of Science and Technology of the Republic of China (MOST 109-2320-B-006-067 to C.-Y.C.) and grant from National Cheng Kung University Hospital (NCKUH-11102040)

Ahn JH, Kim SJ, Park WS, Cho SY, Ha JD, Kim SS et al. Synthesis and biological evaluation of rhodanine derivatives as PRL-3 inhibitors. Bioorg Med Chem Lett 2006; 16: 2996–2999.
Kudo M, Finn RS, Qin S, Han KH, Ikeda K, Piscaglia F et al. Lenvatinib versus sorafenib in first-line treatment of patients with unresectable hepatocellular carcinoma: a randomised phase 3 non-inferiority trial. Lancet 2018; 391: 1163–1173.
Adnane L, Trail PA, Taylor I, Wilhelm SM. Sorafenib (BAY 43-9006, Nexavar), a dual-action inhibitor that targets RAF/MEK/ERK pathway in tumor cells and tyrosine kinases VEGFR/PDGFR in tumor vasculature. Methods Enzymol 2006; 407: 597–612.
Wilhelm S, Carter C, Lynch M, Lowinger T, Dumas J, Smith RA et al. Discovery and development of sorafenib: a multikinase inhibitor for treating cancer. Nat Rev Drug Discov 2006; 5: 835–844.
Liu L, Cao Y, Chen C, Zhang X, McNabola A, Wilkie D et al. Sorafenib blocks the RAF/MEK/ERK pathway, inhibits tumor angiogenesis, and induces tumor cell apoptosis in hepatocellular carcinoma model PLC/PRF/5. Cancer Res 2006; 66: 11851–11858.
Zhu YJ, Zheng B, Wang HY, Chen L. New knowledge of the mechanisms of sorafenib resistance in liver cancer. Acta Pharmacol Sin 2017; 38: 614–622.
Chen KF, Tai WT, Hsu CY, Huang JW, Liu CY, Chen PJ et al. Blockade of STAT3 activation by sorafenib derivatives through enhancing SHP-1 phosphatase activity. Eur J Med Chem 2012; 55: 220–227.
Llovet JM. Focal gains of VEGFA: candidate predictors of sorafenib response in hepatocellular carcinoma. Cancer Cell 2014; 25: 560–562.
Regan-Fendt K, Li D, Reyes R, Yu L, Wani NA, Hu P et al. Transcriptomics-Based Drug Repurposing Approach Identifies Novel Drugs against Sorafenib-Resistant Hepatocellular Carcinoma. Cancers (Basel) 2020; 12.
Roessler S, Jia HL, Budhu A, Forgues M, Ye QH, Lee JS et al. A unique metastasis gene signature enables prediction of tumor relapse in early-stage hepatocellular carcinoma patients. Cancer Res 2010; 70: 10202–10212.
Galligan JJ, Petersen DR. The human protein disulfide isomerase gene family. Hum Genomics 2012; 6: 6.
Persson S, Rosenquist M, Knoblach B, Khosravi-Far R, Sommarin M, Michalak M. Diversity of the protein disulfide isomerase family: identification of breast tumor induced Hag2 and Hag3 as novel members of the protein family. Mol Phylogenet Evol 2005; 36: 734–740.
Thompson DA, Weigel RJ. hAG-2, the human homologue of the Xenopus laevis cement gland gene XAG-2, is coexpressed with estrogen receptor in breast cancer cell lines. Biochem Biophys Res Commun 1998; 251: 111–116.
Wilson CL, Sims AH, Howell A, Miller CJ, Clarke RB. Effects of oestrogen on gene expression in epithelium and stroma of normal human breast tissue. Endocr Relat Cancer 2006; 13: 617–628.
Hrstka R, Nenutil R, Fourtouna A, Maslon MM, Naughton C, Langdon S et al. The pro-metastatic protein anterior gradient-2 predicts poor prognosis in tamoxifen-treated breast cancers. Oncogene 2010; 29: 4838–4847.
Obacz J, Takacova M, Brychtova V, Dobes P, Pastorekova S, Vojtesek B et al. The role of AGR2 and AGR3 in cancer: similar but not identical. Eur J Cell Biol 2015; 94: 139–147.
Li Z, Zhu Q, Hu L, Chen H, Wu Z, Li D. Anterior gradient 2 is a binding stabilizer of hypoxia inducible factor-1alpha that enhances CoCl2 -induced doxorubicin resistance in breast cancer cells. Cancer Sci 2015; 106: 1041–1049.
Yu H, Zhao J, Lin L, Zhang Y, Zhong F, Liu Y et al. Proteomic study explores AGR2 as pro-metastatic protein in HCC. Mol Biosyst 2012; 8: 2710–2718.
Liu Z, Hu Y, Gong Y, Zhang W, Liu C, Wang Q et al. Hydrogen peroxide mediated mitochondrial UNG1-PRDX3 interaction and UNG1 degradation. Free Radic Biol Med 2016; 99: 54–62.
Dumartin L, Whiteman HJ, Weeks ME, Hariharan D, Dmitrovic B, Iacobuzio-Donahue CA et al. AGR2 is a novel surface antigen that promotes the dissemination of pancreatic cancer cells through regulation of cathepsins B and D. Cancer Res 2011; 71: 7091–7102.
Fessart D, Domblides C, Avril T, Eriksson LA, Begueret H, Pineau R et al. Secretion of protein disulphide isomerase AGR2 confers tumorigenic properties. Elife 2016; 5.
Bu H, Bormann S, Schafer G, Horninger W, Massoner P, Neeb A et al. The anterior gradient 2 (AGR2) gene is overexpressed in prostate cancer and may be useful as a urine sediment marker for prostate cancer detection. Prostate 2011; 71: 575–587.
Delom F, Nazaraliyev A, Fessart D. The role of protein disulphide isomerase AGR2 in the tumour niche. Biol Cell 2018; 110: 271–282.
Brychtova V, Mohtar A, Vojtesek B, Hupp TR. Mechanisms of anterior gradient-2 regulation and function in cancer. Semin Cancer Biol 2015; 33: 16–24.
Arumugam T, Deng D, Bover L, Wang H, Logsdon CD, Ramachandran V. New Blocking Antibodies against Novel AGR2-C4.4A Pathway Reduce Growth and Metastasis of Pancreatic Tumors and Increase Survival in Mice. Mol Cancer Ther 2015; 14: 941–951.
Vanderlaag KE, Hudak S, Bald L, Fayadat-Dilman L, Sathe M, Grein J et al. Anterior gradient-2 plays a critical role in breast cancer cell growth and survival by modulating cyclin D1, estrogen receptor-alpha and survivin. Breast Cancer Res 2010; 12: R32.
Xue X, Fei X, Hou W, Zhang Y, Liu L, Hu R. miR-342-3p suppresses cell proliferation and migration by targeting AGR2 in non-small cell lung cancer. Cancer Lett 2018; 412: 170–178.
Dumartin L, Alrawashdeh W, Trabulo SM, Radon TP, Steiger K, Feakins RM et al. ER stress protein AGR2 precedes and is involved in the regulation of pancreatic cancer initiation. Oncogene 2017; 36: 3094–3103.
Higa A, Mulot A, Delom F, Bouchecareilh M, Nguyen DT, Boismenu D et al. Role of pro-oncogenic protein disulfide isomerase (PDI) family member anterior gradient 2 (AGR2) in the control of endoplasmic reticulum homeostasis. J Biol Chem 2011; 286: 44855–44868.
Hetz C. The unfolded protein response: controlling cell fate decisions under ER stress and beyond. Nat Rev Mol Cell Biol 2012; 13: 89–102.
Chen CY, Chung IH, Tsai MM, Tseng YH, Chi HC, Tsai CY et al. Thyroid hormone enhanced human hepatoma cell motility involves brain-specific serine protease 4 activation via ERK signaling. Mol Cancer 2014; 13: 162.
Delom F, Mohtar MA, Hupp T, Fessart D. The anterior gradient-2 interactome. Am J Physiol Cell Physiol 2020; 318: C40-C47.
Lee AH, Iwakoshi NN, Glimcher LH. XBP-1 regulates a subset of endoplasmic reticulum resident chaperone genes in the unfolded protein response. Mol Cell Biol 2003; 23: 7448–7459.
Yoshida H, Matsui T, Yamamoto A, Okada T, Mori K. XBP1 mRNA is induced by ATF6 and spliced by IRE1 in response to ER stress to produce a highly active transcription factor. Cell 2001; 107: 881–891.
Hetz C, Chevet E, Oakes SA. Proteostasis control by the unfolded protein response. Nat Cell Biol 2015; 17: 829–838.
Ozcan U, Yilmaz E, Ozcan L, Furuhashi M, Vaillancourt E, Smith RO et al. Chemical chaperones reduce ER stress and restore glucose homeostasis in a mouse model of type 2 diabetes. Science 2006; 313: 1137–1140.
Mimura N, Fulciniti M, Gorgun G, Tai YT, Cirstea D, Santo L et al. Blockade of XBP1 splicing by inhibition of IRE1alpha is a promising therapeutic option in multiple myeloma. Blood 2012; 119: 5772–5781.
Guo H, Zhu Q, Yu X, Merugu SB, Mangukiya HB, Smith N et al. Tumor-secreted anterior gradient-2 binds to VEGF and FGF2 and enhances their activities by promoting their homodimerization. Oncogene 2017; 36: 5098–5109.

There is NO conflict of interest to disclose.

Download PDF

Version 1

posted

You are reading this latest preprint version

Anterior gradient 2 induces resistance to sorafenib via endoplasmic reticulum stress regulation in hepatocellular carcinoma

Status:

Version 1

Abstract

Figures

INTRODUCTION

AGR2 and ER stress

Materials And Methods

Cell culture and treatments

Immunohistochemistry

MTT assay

Apoptosis assay

Quantitative RT–PCR

Western blotting

Establishment of AGR2-silenced cells

Establishment of sorafenib-resistant HCC cells

Preparation of conditioned medium (CM)

Statistical analysis

Results

AGR2 is clinically relevant in HCC

Sorafenib decreases cell viability and increases cell apoptosis

Sorafenib induces AGR2 secretion instead of transcriptional regulation

Agr2 Plays A Role In Cell Viability And Apoptosis

Sorafenib Induces Er Stress In Hcc

AGR2 possesses diverse roles

Sorafenib-resistant cells modulate ER stress and reduce cell apoptosis

Discussion

Declarations

References

Additional Declarations

Status:

Version 1