Latifolin enhances both survival and cardiomyocyte differentiation of bone marrow mesenchymal stem cells on rat myocardial infarction model

doi:10.21203/rs.3.rs-1768122/v1

Download PDF

Research Article

Latifolin enhances both survival and cardiomyocyte differentiation of bone marrow mesenchymal stem cells on rat myocardial infarction model

https://doi.org/10.21203/rs.3.rs-1768122/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Myocardial infarction caused abundant loss of cardiomyocytes and myocardium limited self-repair ability. Mesenchymal stem cells (MSCs) were a promising option for cardiomyocyte regeneration therapies. However, low cardiomyocyte differentiation efficiency and poor cell survival limit application in myocardial infarction. Here, our study aimed to promote the survival and cardiomyocyte differentiation of BM-MSCs by latifolin from Dalbergiae Odoriferae.

Methods: In vitro, cell survival was measured by MTT and apoptosis assays. BM-MSCs morphological differentiation was observed under microscope and TEM. Cardiac-specific genes and proteins were measured by RT-PCR and immunofluorescence staining. In vivo, cardiac function was assessed by LDH and CK-MB and echocardiography. The gross morphology and TTC were used to assess the LV infarct size. Masson’s trichrome was used to detect the extent of fibrosis. Histopathological changes were observed by HE staining. Immunofluorescence was used to detect the survival and cardiomyocyte differentiation of BM-MSCs. Immunohistochemistry was used to detect macrophage CD68 and neutrophils MPO expression. The protein expression of IL-6, p-NF-κB, β-catenin and HIF-1αwere detected by Western Blot.

Results: In vitro, latifolin increased BM-MSCs viability and decreased apoptosis. Both atrial particles and myofilaments were precisely observed in the cytoplasm under TEM. Latifolin increased the cardiac-specific mRNA and proteins. In vivo, latifolin promoted BM-MSCs to reduce myocardial enzyme and improve cardiac function. Moreover, latifolin promoted BM-MSCs to reduces myocardial infarction size, myocardial fibrosis size, histopathological changes and macrophage infiltration in myocardial tissue. At the same time, latifolin promoted survival and cardiomyocyte differentiation of BM-MSCs. Latifolin up-regulated the protein expression of β-catenin and down-regulated the protein expression of IL-6, p-NF-κB, HIF-1α.

Conclusion: Latifolin enhanced the effect of BM-MSCs to cure MI by promoting survival and cardiomyocyte differentiation after transplant in myocardial tissue though HIF-1α/NF-κB/IL-6 pathway and HIF-1α/β-catenin pathway. Such pro-differentiation and pro-survival might be a potential strategy to increase their regenerative efficacy.

Mesenchymal stem cells

Myocardial infarction

Dalbergiae Odoriferae

Cardiomyocyte differentiation

Survival

Myocardial infarction (MI) is considered as a major reason leading to not only morbidity but also mortality across the globe. MI is caused by myocardial ischemia on account of sudden complete occlusion of coronary artery leading to myocardial injury ^{[1, 2]}. This ischemic impairment gives rise to the irrevocable apoptosis or necrosis of myocardial cells because of limited self-repair ability of these cells. The human heart loses most of its regenerative capacity during postnatal development and is not able to replace any defects after damage. A large number of studies have shown that cardiovascular regeneration based on mesenchymal stem cells may cure cardiovascular diseases with cardiomyocyte damage ^[3–5].

Mesenchymal stem cells (MSCs) are multipotent progenitor cells and have a cardiomyogenic transdifferentiation ability. Keiichi Fukuda found cardiomyocyte differentiation of marrow-derived mesenchymal stem cells treated with 5-azacytidine (5Aza) in 1999 ^[6]. In the treatment of myocardial infarction by transplantation of BM-MSCs can improve cardiac function and inhibit remodeling of myocardium. Scientists investigated MSCs retention rates in the myocardium after transplantation, as a result, the low retention rates and low cardiomyocyte differentiation rates were responsible for the therapeutic ineffective. There are numbers of studies demonstrating that the ongoing ischemia, anoikis, and inflammation tough environmental conditions in the ischemic region is likely to lead to the numerous demise of transplanted cells within a period of few days of getting injected ^{[7, 8]}. Such an inflammatory environment also directly affects the myocardial differentiation of BM-MSCs. Accordingly, the enhanced strategies, improving survival and enhancing cardiomyocyte differentiation, is termed as crucially to enhanced the efficacy of the MSC-mediated treatment for MI.

The heartwood of Dalbergiae Odoriferae Lignum T. Chen, named ‘Jiangxiang’, is an important Chinese medicine. It was used to treat heart disease in China and has been in general used in various Chinese herbal preparations including Danshen injection ^[9], Guanxin-Danshen pills ^[10] and Qi-Shen-Yi-Qi decoction ^[11]. The contemporary pharmacological investigations had reported that Dalbergiae Odoriferae Lignum possesses the function of relaxing the blood vessels, augmenting the coronary flow, anti-inflammation anti-oxidation and anti-tumor ^{[12, 13]}. Latifolin is a new flavonoid compound, extracted from Dalbergiae Odoriferae Lignum T. Chen.. Our previous study had discovered the fact that latifolin protected myocardium by inhibiting inflammatory response after myocardial infarction ^[14]. In this study, we would investigate the effects of latifolin on the survival and myocardial differentiation of BM-MSCs in vitro and in vivo. We could made it clear whether latifolin have protective effect on BM-MSCs from inflammation tough environmental conditions and enhance cardiomyocyte differentiation after myocardial infarction.

BM-MSCs culture and characterization

Sprague Dawley rats, male, aged 4–6 weeks old or 8-week-old, were housed at Animal Facility of Jiangxi University of Traditional Chinese Medicine on a 12-h light/dark cycle with free access to water and standard rodent food. All animal procedures were approved by the Ethics Committee of Jiangxi University of Traditional Chinese Medicine, Nanchang, China, and were carried out in accordance with the Guidelines for the Care and Use of Research Animals established by Jiangxi University of Traditional Chinese Medicine. MSCs were derived from Sprague Dawley rats’ bone marrow and cultured in a standard incubator. Rats were sacrificed by spine dislocation and bone marrow was washed out from the tibia and femur marrow cavities. Rinse the marrow cavity with complete medium and all the cells cultured in DMEM/F12 supplemented with 10% FBS at 37℃ in a humidified incubator containing 5% CO₂. The culture medium was changed per two or three days and non-adherent cells were discarded. We characterized the BM-MSCs by their specific markers and the mesoderm-lineage differentiation potency. The typical MSC surface markers (CD29 and CD90), hematopoietic cell lineage markers (CD34 and CD45), osteogenic and adipogenic differentiation were used to identificate BM-MSCs. BM- MSCs (the 3rd passage) were harvested and stained by antibodies (FITC anti-rat CD90, PE anti-rat CD29, PE anti-rat CD45, FITC anti-rat CD34) (BioLegend San Diego, USA) in PBS containing 2% fetal bovine serum. Fluorescence expression was detected by Flow cytometry (Gallios, Beckman, USA). The data analysis was performed by Kaluza software. For adipogenic and osteogenic differentiation, the 3rd passage BM-MSCs were treated with adipogenic differentiation medium and osteogenic differentiation medium (R&D Systems, USA) for 21 days. Oil red O staining was performed to check the oil droplets, the calcium depositions were examined with Alizarin red stain.

MTT assay

Cell viability was measured by MTT assay. The 3rd passage BM- MSCs were

plated in 96- well plates, cultured for 48 hour, and then treatment as follows:(1) control group: cultured with complete medium in a humidified incubator containing 5% CO₂; (2) model group: the complete medium was removed and replaced with 20ng/ml TNF-α (Sino Biological Beijing, China), glucose-free, serum-free DMEM (Gibco Thermo Fisher scientific, USA), placed in an oxygen-free incubator for 12 h; (3) latifolin group: the complete medium was removed and replaced with different concentration gradients latifolin(1.25, 2.5, 5, 10µg/ml) (Latifolin, chemical structure name is (-)-(R)-latifolin, PubChem No.: 340211, provided by Jiangxi University of Traditional Chinese Medicine (Broadwood Dalbergia was purchased from Fangchenggang City, Guangxi Province, China in July 2014, and the quality of forest products by Guangxi University. The testing center was identified as the heartwood of D. latifolia, the genus Dalbergia. Latifolin is isolated and prepared from the core material of Dalbergia. Structure was determined by 1H-NMR, 13C-NMR, purity > 95%) for 24h, then removed it and replaced with 20ng/ml TNF-α, glucose-free, serum-free DMEM with latifolin, placed in an oxygen-free incubator for 12 h. Cells were washed with PBS and medium was changed according to the experimental groups. MTT assay was performed and the formed formazan crystals were solubilized by DMSO. The absorbance of colored solution was measured at 490 nm.

Apoptosis assayThe cyto-protection mediated by latifolin was further confirmed by Annexin-V apoptosis assay. The 3rd passage BM- MSCs were plated in 10cm dish, cultured for 48hour, and then treatment as as same as MTT assay. Apoptosis was measured by flow cytometry using Annexin V FITC/ PI Kit (BD, USA). Briefly, cells were conjugated with 5 µL Annexin V FITC and 1 µL PI. Cells were mixed gently and incubated for 15 min at room temperature in the dark. After the incubation, annexin-binding buffer was added, mixed gently, and kept on ice. Data was acquired by flow cytometry.

Induction and differentiation of BM-MSCs

The 2rd passage BM- MSCs were plated in 6-well plates, cultured for 48 hour, and then treatment as follows: (1) control group: cells were incubated in complete medium; (2) 5-azacytidine (5Aza) group: cells were incubated in 5µmol/L 5Aza for the first 24h, then switched to complete medium; (3) 5Aza + latifolin group: cells were incubated in 5µmol/L 5Aza for the first 24h, then switched to latifolin (1.25, 2.5, 5 µg/ml) for 72h, and then switched to complete medium; (4) latifolin group: cells were incubated in latifolin (1.25, 2.5, 5 µg/ml) for 72h, then switched to complete medium. Myocardial differentiation was examined until the end of incubation. Culture media was replaced every 3 days and morphology were observed weekly under the microscope until induction completely in 28d.

RT- PCR assay

The expressions of cardiac- specific genes GATA4, NKX2.5 and MEF2C were measured by RT-PCR assay. Harvesting of the total RNA was carried out from the transduced BM-MSCs with the using of Trizol, and cDNAs was synthesized with RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, USA). The validation and optimization of the standard curves, the melting curves with every primer set were carried out. The primers for RT- PCR were presented in Table 1.

Table 1

The sequence of primer used in real-time PCR
gene name	forward	reverse
GATA4	ACTACCTATGCAACGCCTGT	AGTGTGGTGGTGGTAGTCTG
NKX2.5	CAAGTGCTCTCCTGCTTTCC	TCTGTCTCGGCTTTGTCCAG
MEF2C	TCAGTTGGGAGCTTGCACTA	GTGGTGGTACGGTCTCTAGG
β-actin	CAACCTTCTTGCAGCTCCTC	GACCCATACCCACCATCACA

Immunofluorescence assay

Immunofluorescence staining of α-actin and cTnI was performed to identify cardiomyocyte differentiation. Cells were fixed for 20 min with 4% formalin at room temperature, and permeabilized for 30 min with 0.5% Triton X-100. Then cells were blocked with 3% goat serum for 1h at room temperature. Primary α-actin antibody (1:300) and cTnI antibody (1:200) (Abcam, Cambridge, USA) were incubated for overnight at 4°C, and then followed by staining with Alexa Fluor™ 488 lgG secondary antibody (1:300) (Abcam, Cambridge, USA) for 2h at room temperature in dark. Nuclei were stained with DAPI for 3 min at room temperature. The images were acquired with fluorescence microscope (Leica, Germany).

Transmission electron microscopy assay

After differentiation completely for 4 weeks, cells were harvested and fixed with 2.5% glutaraldehyde, then followed by embedding in epoxy resin. Ultra-thin sections were product horizontally, stained with lead citrate and uranyl acetate. The cellular ultrastructure was observed with FEI-Tecnai G20 transmission electron microscope (FEI, USA).

Rat MI model and BM-MSCs transplantation

Male SPF grade Sprague-Dawley (SD) rats (250-280g) (SJA Laboratory Animal Co. Ltd, Hunan, China) were subjected to MI using left anterior descending coronary artery (LADCA) ligation. Rats were anesthetized with isoflurane gas inhalation for 2 min after intraperitoneal injection of urethane (0.6 g/kg). The chest was opened between the third and fourth ribs, and the pericardium was split to expose the left ventricle (LV), aorta, and left atrium. Using the flush position of the inferior edge of the left atrial appendage as a mark, the left coronary artery was ligated with 6 − 0 ligation line 2mm below the lower edge of the left atrial appendage. Seventy-two rats were randomly divided into six treatment groups: rats that received MSCs (n = 12), MSCs + latifolin 25mg/kg/d (n = 12), MSCs + latifolin 50mg/kg/d (n = 12), MSCs + latifolin 100mg/kg/d (n = 12), MI group (n = 12), sham group (n = 12) total 1×10⁶ in the three infarct border region immediately after LAD ligation. The chest and skin were then closed. All experiments were approved by the Ethics Committee of the Affiliated Hospital of Guilin Medical University.

LDH and CK-MB examination

Blood samples were collected from the orbital venous plexus at 7 after the surgery. The blood was centrifuged at 3000g for 15 minutes to obtain the serum. The levels of lactic dehydrogenase (LDH) and creatine kinase-MB (CK-MB) (Solarbio, China) in the serum were detected by fully automatic biochemical analysis.

Cardiac function assessment

Rat heart function was monitored by echocardiography at 4 weeks after surgery. The rats were anesthetized with intraperitoneal injection of urethane (1.4g/kg), LV end-diastolic and end-systolic dimensions (LVEDD, LVESD) from the parasternal short-axis view at the papillary muscle were measured using M-mode tracing. LVEF and LVFS as the evaluation indicators of cardiac function were automatically calculated by the echocardiographic system (Visualsonics, Ottawa, Canada).

Measurement of LV infarct size

28 days later, rats were anesthetized followed by cardiac perfusion with normal saline to eliminate the blood in the cardiac chamber. After freezing at -20°C for about 20min, the myocardium was cut into 4 slices from the ligation site to the apex. The slices were incubated in a 1% 2,3,5-triphenyl ammonium tetraazide (TTC) solution (Solarbio, China) in saline at 37°C for 15min. During the staining process, the sections were carefully flipped every 5min. Finally, stained slices were photographed and infarction size was calculated by Image J software.

Masson’s trichrome examination

The heart tissues were fixed in 10% formalin, embedded in paraffin, and cut into 5µm slices. Sections were then stained with Masson’s trichrome (Solarbio, China) according to the manufacturer’s instructions and examined using an optical microscope (Olympus, Tokyo, Japan), and photographed using a digital camera.

Histological examination

To observe the histopathological changes in experimental rats, fresh heart tissues were fixed in 4% paraformaldehyde for over 24 hours, washed with running water, dehydrated in automatic organizations dehydration machine (Beijing Jiayuan Xingye Science and Technology, China), and embedded in wax using a paraffin embedding machine (Hubei Xiaogan Yaguang Medical Electronic Technology Co, Ltd., China). Next, tissue blocks were cut into 5-µm thickness sections using a paraffin-slicing machine (Leica, Germany), and mounted onto anti-shedding glass slides. Sections were stained with haematoxylin and eosin (H&E) (Solarbio, China) examined by light microscopy (Nikon, Japan) for a histological assessment.

Survival and cardiomyocyte differentiation examination

Before transplantation, BM-MSCs were labeled with CM-Dil dye (Invitrogen, USA) to track it, and detected the labeling rate in a flow cytometer.

The survival and cardiomyocyte differentiation were examined by immunofluorescence staining. The sections were first stained with antibody to cTnI(1:200) and then washed with PBS and stained with Alexa Fluor 488 goat anti- rabbit IgG (Invitrogen, USA ) (1:500) at RT for 1 h. Nuclei were counterstained with DAPI, and sections were mounted in the aqueous mounting medium. Finally, images were examined using a fluorescent microscope (OLYMPUS, Japan) and observing blue fluorescence (DAPI) with ultraviolet excitation light, red fluorescence (CM-DiI) with green excitation light, and green fluorescence (cTnI) with blue excitation light.

Immunohistochemistry examination

Sections were pretreated to antigen retrieval in a sodium citrate buffer (pH 6.0) after deparaffinization and rehydration. Subsequently, the sections were blocked with 10% sheep serum and then incubated with anti-CD68 or anti-MPO primary antibody at 4℃ overnight, thereafter incubated with secondary antibody at room temperature. At last, the sections were stained with 3,3-diaminobenzidine (DAB), counterstained with haematoxylin and sealed with neutral gum. Image-Pro Plus software was used to determine the positive staining cells. In each slide, 5 different visual fields were randomly selected and photographed under optical microscope (Nikon, Japan).

Western blotting

Total protein was extracted from the left ventricular myocardial tissues using tissue homogenates and centrifugation. The total protein concentration was determined by BCA protein assay kit. The protein was denatured on a 95 ~ 100℃ for 5 min. The protein lysate of 20µg was fractionated by electrophoresis on a 10% SDS-PAGE gel. Protein was then transferred to the PVDF membrane. After 1 hour of blocking at room temperature in 5% skim milk, PVDF membrane incubated overnight with primary antibodies at 4°C with anti-p-NF-κB (1:500), anti-IL-6 (1:1000), anti-HIF-1 (1:250), anti-β-catenin (1:500) (Abcam, Cambridge, USA). Then the membrane was incubated with horseradish peroxidase labelled secondary antibody at room temperature for 1.5 hours and visualized by chemiluminescence (ECL) with a Western blotting detection system (Bio-Rad, USA). The protein expression levels of the stripes were analysed by Image J software, and normalized based on the grey value of β-tublin.

Statistical analysis

All analyses were performed with SPSS 20.0 software. The measurement data are presented as mean ± SD. and the multigroup comparisons were made with a one-way factor analysis of variance. P < 0.05 were considered statistically significant difference.

Identification of BM-MSCs

Isolated MSC showed fibroblast-like shapes and spiral or radioactive paste growth(Fig. 1A, B). Flow cytometry results revealed that BM-MSCs were positive for the markers CD90, CD29, and almostly negative for CD45, and CD34 (Fig. 1C).The differentiation capacity of BM-MSCs was confirmed with standard induction protocols. Lipid droplets were identified from the differentiated culture upon staining with Oil Red O which confirms adipogenic differentiation of the BM-MSCs (Fig. 1D). For osteogenic differentiation, significant calcium depositions were detected in induced cells as determined by Alizarin Red staining (Fig. 1E). These results confirm the mesodermal differentiation capacity of BM-MSCs.

Latifolin promoted viability and decreased apoptosis of BM-MSC in vitro

The cytoprotective role of latifolin to BM-MSCs was assessed by MTT assay. Compared with control group, 81% of cell viability was observed when cells in model group. The concentration 10µg/ml of latifolin have remarkable cytoprotective effect on BM-MSCs compared with model group (98.97 ± 5.20% VS 81.60 ± 8.98%. (Fig. 1F, P < 0.05).

The apoptosis was analyzed by flow cytometry following Annexin V/PI staining Kit. Compared with control group, the apoptosis of BM-MSCs was significantly increased (10.07 ± 2.32% vs 1.77 ± 0.38%). Latifolin on the concentration of 10µg/ml significantly reduced the percentage of apoptosis cells (6.13 ± 1.12% vs 10.07 ± 2.32%) (Fig. 1G, H, P < 0.05). Taken together these results demonstrate that latifolin can play the role in cytoprotection from tough environmental conditions.

Latifolin promoted BM-MSCs morphological differentiation under microscope and TEM in vitro

After the 2rd passage BM- MSCs were induced by 5Aza and latifolin, alone or in combination, the morphological of cardiomyocyte differentiation was observed under microscope. Cell show fibroblast-like morphology after treatment one week, there was no significant difference in each group (Fig. 2A). Compared with control group, the morphology of the cells gradually changed after treatment two week in 5Aza group and 5Aza combine with latifolin group. Cells gradually increased in size and swelling, formed a stick-like morphology, or lengthened with nuclei located in the center (Fig. 2B, C, D indicated by white arrows). In the four weeks, cells connected with adjoining cells and formed myotube-like structures (Fig. 2D, indicated by white triangle). The architecture of cells in the alone latifolin treatment groups was similar to the control group.

Transmission electron microscope (TEM) observation revealed that the cells contained abundant organelles with oval nuclei located in the center of the cells (arrow). These organelles contained a large number of mitochondria (triangle). Myofilament was found to be parallel in the cytoplasm (pentagram), glycogen particles around the nucleus (circle) in 5-aza + latifolin (5µg/ml) group, suggesting characteristic myofilament installation during differentiation. Ultrastructural observation demonstated that the combined group were more typical myocardial structure than in those of the other treatment groups (Fig. 2E).

Latifolin promoted BM-MSCs expression of cardiac-specific gene and protein in vitro

The mRNA expressions of GATA4, NKX2.5 and MEF2C were determined by RT-PCR. The data showed that the expressions of cardiac-specific genes GATA4, NKX2.5 were markedly increased following treatment with 5 µg/mL latifolin combine with 5Aza for 7d; GATA4, NKX2.5 and MEF2C was markedly increased following treatment with 5 µg/mL latifolin combine with 5Aza for 14d; GATA4 was markedly increased following treatment for 21d (Fig. 2F).

Cardiac-specific proteins of the α-actinin and cTnI were examined with immunofluorescence staining. The results showed that both 5Aza group and 5Aza conbine with latifolin group has obvious α-actinin (Fig. 2H) and cTnI (Fig. 2G) protein expression, while control group and latifolin alone group has no green fluorescence. 5Aza conbine with latifolin group had more and brighter green fluorescence than 5Aza group in cytoplasm. The results indicated that latifolin promoted the cardiomyocyte differentiation of BM-MSCs.

Latifolin increased the effect of BM-MSCs on cardiac function in MI rats

On the 7th day after operation, the contents of LDH and CK-MB in the serum of rats were measured. The results showed that rats in the model group had higher levels of LDH and CK-MB compared the sham group on the 7th day after surgery (p < 0.01, p < 0.05), as presented in Fig. 8; Compared with the model group, LDH content in the MSC + 100mg/kg latifolin group was significantly lower (p < 0.05) (Fig. 3A) and the CK-MB content in the MSC + 100mg/kg latifolin group was markedly decreased (p < 0.05) (Fig. 3B).

Cardiac function was assessed by echocardiography after BM-MSC implantation 4 weeks in rats (Fig. 3C). LVEF and LVFS were significantly lower in the model group compared to sham group (p < 0.05) and significantly higher in the MSC + latifolin 100 mg/kg group compared to model group (p < 0.05) (Fig. 3D, E). Furthermore, the cardiac output (CO) was significantly lower in the model group compared to sham group (p < 0.05) but significantly higher in the MSC + latifolin 50 mg/kg group (p < 0.05) and MSC + latifolin 100 mg/kg group (p < 0.01) compared to model group (Fig. 3F). This result indicated that latifolin promoted BM-MSCs to improve cardiac function in MI rats.

Latifolin promoted BM-MSCs to reduce myocardial infarction size and fibrosis area of MI rats

The gross morphology and TTC were used to assess the LV infarct size. Compared to the sham groups, the infarct was clearly observed to be white, enlarged, and the left ventricular wall became thinner in the model group (Fig. 3H, I). Compared to the model group, MSC + latifolin 50mg/kg group and MSC + latifolin 100mg/kg group infarct were improved (Fig. 3I, K). The TTC results showed that there was no myocardial infarction in the normal group, and the infarct area reached 39% in the model group. Compared to model group, Both MSC group and MSC + latifolin group could significantly reduce the infarct area (P༜0.05, P༜0.01) (Fig. 3K).

Masson’s trichrome was used to detect the fibrosis in rat myocardial tissue (Fig. 3J). In the sham operation group, there was no infarction and fibrosis in the heart tissue, and the myocardium was arranged. But there was obvious fibrosis, and blue stained fibers appeared in the marginal area of the infarction in the model group (p < 0.01). Compared to the model group, the fibrosis size was significantly small in the MSC group, MSC + latifolin 50mg/kg group, MSC + latifolin 100mg/kg group (p < 0.05) (Fig. 3L).

Latifolin enhanced BM-MSCs to improve the myocardial tissue histopathological changes

Histopathological changes were observed by HE staining. The results of HE staining showed that the myocardial cells were arranged neatly and the myocardial fibres were arranged regularly in the sham group, but the myofilament was lysed and myocardial cells was disordered in the model group compared to the sham group. The MSC + latifolin 100mg/kg group significantly improved myofilament dissolve (Fig. 4A, B, C).

Latifolin reduced inflammatory cell infiltration in infarction myocardial tissue

Immunohistochemical analysis of infarction myocardial tissue was performed after 28 days. The results showed that there were many CD68 positive cells and few MPO positive cells in the myocardial tissue of the model group, confirming the presence of a large number of macrophage infiltration (Fig. 4E). On the contrary, the number of macrophages in the MSC + latifolin treatment groups were significantly reduced compared to the model group (P < 0.01), but there was no difference in MSC group compared to the model group. Compared to the MSC group, the number of macrophages in the MSC + latifolin treatment groups were significantly reduced (P < 0.01) (Fig. 6D). However, all intervene groups had no obvious effect on neutrophils compared to the model group (supplemental information Fig. 1).

latifolin promoted survival and improved cardiomyocyte differentiation of BM-MSCs after transplanting in myocardial tissue

BM-MSCs were stained to red fluorescence with CM-DiI, and all BM-MSCs were stained detected by flow cytometry (Fig. 5A B). Immunofluorescence was used to detect the survival and cardiomyocyte differentiation of BM-MSCs. The results showed that there was no BM-MSCs (red fluorescence) in the sham group and model group. But there were a small number of surviving cells in the MSCs transplantation group (Fig. 5C). Compared to the MSC group, the survival was increased significantly in the MSC + latifolin 100mg/kg group (P < 0.05) (Fig. 5D). There was significant cTnI protein expression in the surviving BM-MSCs. Compared to the MSC group, cTnI protein expression was increased significantly in the MSC + latifolin 100mg/kg group (P < 0.05) (Fig. 5E).

Latifolin affected HIF-1α/NF-κB/IL-6 and HIF-1α/β-catenin pathway in myocardial tissue

The expression of IL-6, p-NF-κB, β-catenin and HIF-1α protein in the heart tissue of rats were detected by Western Blot. The results showed that IL-6 expression was significantly increased in the model group compared with the sham group (P < 0.01), but it was significantly reduced in the MSC group, MSC + latifolin groups compared with the model group (Fig. 6A, E). Compared to the sham group, the protein expression of p-NF-κB was significantly increased in the model group (P < 0.05), however, it was significantly reduced in the MSC group and MSC + latifolin groups (P < 0.05, P < 0.01) compared with the model group (Fig. 6A, D). The β-catenin protein expression was significantly reduced in the model group compared with the model group (P < 0.01), MSC group and MSC + latifolin groups could significantly increase β-catenin expression compared to the model group (P < 0.01, P < 0.05) (Fig. 6A, C). The expression of HIF-1α protein in the model group was significantly increased compared to the sham group (P < 0.05), MSC + latifolin 25mg/kg group and MSC + latifolin 100mg/kg group were significantly decreased compared to the model group (P < 0.05) (Fig. 6A, B). Western Blot results show that latifolin can regulate the expression of key proteins of the HIF-1α/NF-κB pathway and β-catenin pathway. In addition, molecular docking result show that latifolin and HIF-1α have docking activity through hydrogen bonds (Fig. 6F).

Stem cell therapy is developing as a hopeful therapeutic trend for heart diseases. The animal models and clinical trials have shown that BM-MSCs are a possible, safe, and efficient type of stem cell used in MI ^[15]. In the infarcted site, injected BM-MSCs have beneficial effects regardless of either the transplanted cells differentiate into cardiomyocytes or play a role via paracrine signaling that ameliorate the destructive effects created by MI ^[16]. However, survival is terrible and cardiomyocyte differentiation was inefficient in the transplant microenvironment, which limiting clinical application for the stem cell therapy. Strategies used to improve not only cardiomyocyte differentiation efficiently, but also higher survival rate of MSCs is necessary and imperative. Here, our study aimed to enhance the survival and cardiomyocyte differentiation of BM-MSCs by latifolin from Dalbergiae Odoriferae.

In the present study, we assayed cell survival by MTT and apoptosis. The cardiomyocyte differentiation of BM-MSC was confirmed from the three aspects: gene (GATA4, Nkx2.5 and Mef2c), protein (α-actinin, cTnI) and structure (atrial particles, myofilaments) in vitro. The results show that latifolin both promoted survival and improved cardiomyocyte differentiation in vitro. In vivo, the therapeutic effect of latifolin on promoting MSC to cure myocardial infarction is evaluated by LDH and CK-MB, cardiac function, the LV infarct size, fibrosis, histopathological changes. The results show that latifolin is beneficial to MSC in the treatment of myocardial infarction. In addition, the survival and cardiomyocyte differentiation of BM-MSCs after MI were detected by Immunofluorescence, it illustrated that latifolin improved both survival and cardiomyocyte differentiation in vivo. To explore the mechanism, macrophages and neutrophils were detected by immunohistochemistry and Western Blot was used to detected the expression of IL-6, p-NF-κB, β-catenin and HIF-1α protein in the heart tissue. It was found that latifolin could improve myocardial inflammatory environment by reducing macrophage infiltration in myocardial tissue. The mechanism may be related to the HIF-1α /NF-κB /β-catenin pathway. Overall, latifolin improved effectively survival and enhances cardiomyocyte differentiation after BM-MSCs transplant in the infarcted tissue.

Studies demonstrated that the ongoing stress in the ischemic region is likely to lead to the demise of almost 90 per cent of the transplanted cells within a period of few days of getting injected ^{[17, 18]}. In this study, we observed that the retention of MSC is only 2% after transplant. It is fortunate that latifolin can remarkable enhanced cell viability and significantly reduced the percentage of apoptosis in vitro, as well as enhanced BM-MSCs survival in vivo. Moreover, latifolin promoted BM-MSCs to reduce myocardial enzyme and improve cardiac function significantly. Woo-Sup Sim et.al ^{[19, 20]} enhanced retention of BM-MSCs ultimately led to a significant cardiac function improvement, which was consistent with our results. Myocardial infarction was caused by obstruction of the blood supply to the heart and result in substantial death cardiomyocytes, which further stimulates the activation of inflammation response. The tough environmental conditions, such as ischemia, anoikis, and inflammation in the infarcted area was the principle criminal for poor survival rate of engrafted BM-MSCs ^[21]. Cardiac inflammation is characterized by the sequential release of inflammatory mediators, resulting in the immediate influx of leukocytes, followed by phagocytosis, monocytes and macrophages, along with proteolysis, angiogenesis, and collagen deposition ^[22]. Accordingly, improving the inflammatory microenvironment was an efficient strategy to enhancing cell cardiomyocyte differentiation and survival. Our previous study had discovered that latifolin had protective effect by inhibiting the inflammation after myocardial infarction. Dong-Sung Lee have illustrated that the latifolin played a critical role in anti-inflammatory effects ^[13]. which was consistent with our previous results. Nili Naftali-Shani ^[23] indicated that the inflammatory environment of infarcted myocardium restricts their survival and reparative effects mediated by TLR4. In this study, the results proved that latifolin have remarkable cytoprotective effect on BM-MSCs from tough ischemia and inflammation environmental conditions (Fig. 1F, G, H). Interestingly, our study found that latifolin promoted MSC to inhibited macrophage infiltration significantly in myocardial tissue, but there were fewer neutrophils in myocardial tissue after MI (Fig. 4D, E). This may be related to mesenchymal stem cell immunomodulation ^{[24, 25]} (supplemental information Fig. 1).

The cardiomyocyte differentiation of stem cells has been come through over 2 decades, with several different strategies being used to make MSCs generate cardiomyocyte-like cell ^[26]. In 1995 Wakitani S and colleagues illustrated that rat bone marrow mesenchymal stem cells exposed to 5-Aza appear to have the capacity of differentiation into cardiomyocyte in vitro ^[27]. Many pharmacological agents, such as 5Aza, DMSO, and growth or morphogenic factors, were used to MSCs cardiomyocyte differentiation strategies. 5Aza is a classic inducer promoting differentiation of MSCs into cardiomyocytes by random demethylation. Studies demonstrated that 5Aza facilitate cardiomyocyte differentiation from BM-MSCs inducing expression of cardiac-specific genes ^{[28, 29]}. In this study we studied the effect of latifolin combination with 5Aza (5µmol/L) on cardiomyocytes differentiation of rat BM-MSCs. The results showed that the effect of 5Aza combinated latifolin had more efficient on cardiomyocyte differentiation. The expression profile of cardiac lineage markers is used to define the process of stem cell differentiation towards the cardiac lineage. Early differentiation markers, such as NKX2.5 ^{[30, 31]}, myocyte enhancer factor 2C (Mef2c), and GATA4, can be an indication of the initiation of the cardiomyogenic process ^{[32, 33]}. Mature cardiomyocyte markers commonly used to assess differentiation efficacy are cardiac troponin T (cTnT), cardiac troponin I (cTnI), a-sarcomeric actin(a-actin), and connexin 43 (Cx43) ^[34]. Many studies confirmed cardiomyogenic differentiation by the transcriptional expression of the cardiomyocyte-specific genes GATA4, NKx2.5, Mef2c and the cardiomyocyte-specific protein cTnT ^[35–37]. In our study, the cardiomyocyte differentiation of BM-MSC was confirmed from the three aspects: gene (GATA4, Nkx2.5 and Mef2c), protein (α-actinin, cTnI) and electron microscope structure (atrial particles, myofilaments) in vitro. The result showed that the transcriptional expression of GATA4, NKX2.5 and MEF2C was significantly higher in 5Aza + latifolin group (Fig. 2F). There were obvious expression of the cardiac-specific proteins α-actin and cTnI in 5Aza + latifolin group. Cells connected with adjoining cells and formed myotube-like structures under microscope, which show that atrial particles and myofilaments were observed (Fig. 2E). In addition, cardiac-specific proteins expression of the α-actinin and cTnI was examined with immunofluorescence staining in vitro experiment (Fig. 2G, H). We also found that there was significant cTnI protein expression in the surviving BM-MSCs in vivo (Fig. 5). Consequently, our data demonstrated that latifolin have a synergistic effect on cardiomyocyte differentiation.

The hypoxic response is an ancient stress response triggered by low ambient oxygen (O2) and controlled by hypoxia-inducible transcription factor-1 (HIF-1), whose alpha subunit is rapidly degraded under normoxia but stabilized when O2-dependent prolyl hydroxylases. In the early stages of hypoxia, HIF-1α level changes the microtubular structure and then regulates glycolysis in cardiomyocytes, which further influences energy supply and cell viability ^[38]. Nuclear factor kappa-B (NF-κB) is a critical transcriptional activator of HIF-1α and that basal NF-κB activity is required for HIF-1α protein accumulation under hypoxia. Activation of NF-κB produces a series of inflammatory cytokines, such as IL-6, IL-1β, IL-12, TNF-a. In this inflammatory cytokines, IL-6 plays a central role in body defense by stimulating various cell populations and is an essential part of the inflammatory mediator network ^{[39, 40]}. In recent years, HIF-1/ NF-κB is being increasingly recognized as a critical factor in the inflammatory response. Our study showed that latifolin down-regulate the protein expression of HIF-1α, p-NF-κB, IL-6, which proving that latifolin improves the inflammatory microenvironment through the HIF-1α/NF-κB/IL-6 pathway (Fig. 6B, D, E). HIF-1α/β-catenin signaling pathway occurs in the hypoxic microenvironment. Hypoxia inhibits β-catenin–T-cell factor-4 (TCF-4) complex formation and transcriptional activity for HIF-1α competing with TCF-4 for direct binding to β-catenin ^[41]. β-catenin signaling is important in cardiac remodeling. The canonical β-catenin pathway can regulate the equilibrium between cell differentiation and proliferation ^[42]. β-catenin forms a complex in the nucleus, then activates target gene transcription ^[43]. Research has found that β-catenin activity in the stroma affects stromal decidualization in mice, and the inhibition of β-catenin activation results in the loss of the differentiation potential of hESCs. Qiong Wang ^[44] found that p53 /Wnt / β-catenin redundantly enable mesendodermal differentiation of ESCs. Our study found that latifolin down-regulate the protein expression of HIF-1α and down-regulate the protein expression of HIF-1α, which illustrating that latifolin may increase the myocardial differentiation of MSCs by inhibiting the expression of HIF-1α, and then promoting the activation of β-catenin (Fig. 6B, C). Overall, latifolin improves the inflammatory microenvironment to promotes the survival of MSC may be related to the HIF-1α/NF-κB/IL-6 pathway and improves cardiomyocyte differentiation of MSC may be related to the HIF-1α/β-catenin pathway. However, our study still has limitations. Firstly, the follow-up period only observed 4 weeks and a longer period of examination would be reliable. Secondly, though molecular docking result show that HIF-1α might be the target, we did not have further study to figure out it. In our future studies, the target of latifolin will be further studied.

In this study, latifolin enhanced the effect of BM-MSCs to cure MI by promoting survival and cardiomyocyte differentiation after transplant in myocardial tissue though HIF-1α/NF-κB/IL-6 pathway and HIF-1α/β-catenin pathway (Fig. 7). Such as pro-differentiation and pro-survival might be a potential strategy to increase their regenerative efficacy therapying MI.

Acknowledgments

We thank Huanwen Chen, Yaru Cui and other members of the Laboratory of Cardiovascular Therapeutics for technical assistance. we thank the staff of the National Pharmaceutical Engineering Centre for Solid Preparation of Chinese Herbal Medicine of Jiangxi University of Traditional Chinese Medicine for their assistance in this study.

Author contributions

Ni Zhang and Lanying Chen designed this study together. Ni Zhang and Xiaoxiao Lai jointly performed the experimental work. Ni Zhang, Lanying Chen and Xiaoxiao Lai analyzed the data. Ni Zhang and Lanying Chen wrote the manuscript. All authors have read and approved the final version of the manuscript.

Funding

This work was supported by National Key R&D Program of China (2018YFC1706102), National Natural Science Foundation of China (No. 81660676; 81360629; 82160761).

Availability of data and materials

Not applicable.

Declarations

Ethical approval and consent to participate

All animal work was compliant with the protocol of Institutional Animal Care and Use Committees at Jiangxi University of Chinese Medicine (JZLLSC20220572).

Consent for publication

Not applicable.

Competing interests

No potential conflict of interest was reported by the author(s).

Author details

¹ The College of Pharmacy, Jiangxi University of Chinese Medicine, Nanchang, 330004, China

² National Pharmaceutical Engineering Center for Solid Preparation of Chinese Herbal Medicine, Jiangxi University of Chinese Medicine, Nanchang, 330006, China

Claire E, Raphael VL, Roger,Yader Sandoval M, Singh M, Bell A, Lerman CS, Rihal BJ, Gersh B, Lewis RJ, Lennon, Allan S, Jaffe. Rajiv Gulati.. Incidence, Trends, and Outcomes of Type 2 Myocardial Infarction in a Community Cohort. Circulation. 2020;141:454–63. doi:10.1161/CIRCULATIONAHA.119.043100.
Andrew R, Chapman PD, Adamson, Anoop SV, Shah A, Anand FE, Strachan AV, Ferry KK, Lee C, Berry I, Findlay A, Cruikshank A, Reid A, Gray PO, Collinson F, Apple DAMcAllister, Maguire D, Keith AA, Fox CA, Vallejos C, Keerie CJ, Weir DE, Newby NL, Mills. High-Sensitivity Cardiac Troponin and the Universal Definition of Myocardial Infarction. Circulation. 2020;141:161–71. doi:10.1161/CIRCULATIONAHA.119.042960.
Derks W, Bergmann O. Polyploidy in Cardiomyocytes: Roadblock to Heart Regeneration? Circ Res. 2020;126(4):552–65. doi:10.1161/CIRCRESAHA.119.315408.
El Agha E, Kramann R, Schneider RK, Li X, Seeger W, Humphreys BD, Bellusci S. Mesenchymal Stem Cells in Fibrotic Disease. Cell Stem Cell. 2017;21(2):166–77. doi:10.1016/j.stem.2017.07.011.
Levoux J, Prola A, Lafuste P, Gervais M, Chevallier N, Koumaiha Z, Kefi K, Braud L, Schmitt A, Yacia A, Schirmann A, Hersant B, Sid-Ahmed M, Ben Larbi S, Komrskova K, Rohlena J, Relaix F, Neuzil J, Rodriguez AM. Platelets Facilitate the Wound-Healing Capability of Mesenchymal Stem Cells by Mitochondrial Transfer and Metabolic Reprogramming. Cell Metab. 2021;33(2):283–99.e9. doi:10.1016/j.cmet.2020.12.006.
Makino S, Fukuda K, Miyoshi S, Konishi F, Kodama H, Pan J, Sano M, Takahashi T, Hori S, Abe H, Hata J, Umezawa A, Ogawa S. Cardiomyocytes can be generated from marrow stromal cells in vitro. J Clin Invest. 1999;103(5):697–705. doi:10.1172/JCI5298.
Jia D, Chen S, Bai P, Luo C, Liu J, Sun A, Ge J. Cardiac Resident Macrophage-Derived Legumain Improves Cardiac Repair by Promoting Clearance and Degradation of Apoptotic Cardiomyocytes After Myocardial Infarction. Circulation. 2022;145(20):1542–56. doi:10.1161/CIRCULATIONAHA.121.057549.
Mangi AA, Noiseux N, Kong D, He H, Rezvani M, Ingwall JS, Dzau VJ. Mesenchymal stem cells modified with Akt prevent remodeling and restore performance of infarcted hearts. Nat Med. 2003;9(9):1195–201. doi:10.1038/nm912.
Lin R, Duan J, Mu F, Bian H, Zhao M, Zhou M, Li Y, Wen A, Yang Y, Xi M. Cardioprotective effects and underlying mechanism of Radix Salvia miltiorrhiza and Lignum Dalbergia odorifera in a pig chronic myocardial ischemia model. Int J Mol Med. 2018;42(5):2628–40. doi:10.3892/ijmm.2018.3844.
Deng X, Xing X, Sun G, Xu X, Wu H, Li G, Sun X. Guanxin Danshen Formulation Protects against Myocardial Ischemia Reperfusion Injury-Induced Left Ventricular Remodeling by Upregulating Estrogen Receptor β. Front Pharmacol. 2017;8:777. doi:10.3389/fphar.2017.00777.
Cui YC, Yan L, Pan CS, Hu BH, Chang X, Fan JY, Han JY. The Contribution of Different Components in QiShenYiQi Pills® to Its Potential to Modulate Energy Metabolism in Protection of Ischemic Myocardial Injury. Front Physiol. 2018;9:389. doi:10.3389/fphys.2018.00389.
Yang ZH, Mei C, He XH, Sun XB. Advance in studies on chemical constitutions, pharmacological mechanism and pharmacokinetic profile of dalbergiae odoriferae lignum. Zhongguo Zhong Yao Za Zhi. 2013;38(11):1679–83. PMID: 24010276.
Lee DS, Kim KS, Ko W, Li B, Keo S, Jeong GS, Oh H, Kim YC. The neoflavonoid latifolin isolated from MeOH extract of Dalbergia odorifera attenuates inflammatory responses by inhibiting NF-κB activation via Nrf2-mediated heme oxygenase-1 expression. Phytother Res. 2014;28:1216–23. doi:10.1002/ptr.5119.
Lai XX, Zhang N, Chen LY, Luo YY, Shou BY, Xie XX, Liu RH. Latifolin protects against myocardial infarction by alleviating myocardial inflammatory via the HIF-1α/NF-κB/IL-6 pathway. Pharm Biol. 2020;58:1156–66. doi:10.1080/13880209.2020.1840597.
Garbern JC, Lee RT. Cardiac stem cell therapy and the promise of heart regeneration. Cell Stem Cell. 2013;12,689 – 98. doi: 10.1016/j.stem.2013.05.008.
Fiedler LR, Chapman K, Xie M, Maifoshie E, Jenkins M, Golforoush PA, Bellahcene M, Noseda M, Faust D, Jarvis A, Newton G, Paiva MA, Harada M, Stuckey DJ, Song W, Habib J, Narasimhan P, Aqil R, Sanmugalingam D, Yan R, Pavanello L, Sano M, Wang SC, Sampson RD, Kanayaganam S, Taffet GE, Michael LH, Entman ML, Tan TH, Harding SE, Low CMR, Tralau-Stewart C, Perrior T, Schneider MD. MAP4K4 Inhibition Promotes Survival of Human Stem Cell-Derived Cardiomyocytes and Reduces Infarct Size In Vivo. Cell Stem Cell. 2019;24(4):579–91.e12. doi:10.1016/j.stem.2019.01.013.
Breckwoldt K, Letuffe-Brenière D, Mannhardt I, Schulze T, Ulmer B, Werner T, Benzin A, Klampe B, Reinsch MC, Laufer S, Shibamiya A, Prondzynski M, Mearini G, Schade D, Fuchs S, Neuber C, Krämer E, Saleem U, Schulze ML, Rodriguez ML, Eschenhagen T, Hansen A. Differentiation of cardiomyocytes and generation of human engineered heart tissue. Nat Protoc. 2017;12(6):1177–97. doi:10.1038/nprot.2017.033.
Sánchez Alvarado A, Yamanaka S. Rethinking differentiation: stem cells, regeneration, and plasticity. Cell. 2014;157(1):110–9. doi:10.1016/j.cell.2014.02.041.
Sim WS, Park BW, Ban K, Park HJ. In Situ Preconditioning of Human Mesenchymal Stem Cells Elicits Comprehensive Cardiac Repair Following Myocardial Infarction. Int J Mol Sci. 2021;22(3):1449. doi:10.3390/ijms22031449.
Sarre C, Contreras-Lopez R, Nernpermpisooth N, Barrere C, Bahraoui S, Terraza C, Tejedor G, Vincent A, Luz-Crawford P, Kongpol K, Kumphune S, Piot C, Nargeot J, Jorgensen C, Djouad F, Barrere-Lemaire S. PPARβ/δ priming enhances the anti-apoptotic and therapeutic properties of mesenchymal stromal cells in myocardial ischemia-reperfusion injury. Stem Cell Res Ther. 2022;13(1):167. doi:10.1186/s13287-022-02840-0.
Kolpakov MA, Guo X, Rafiq K, Vlasenko L, Hooshdaran B, Seqqat R, Wang T, Fan X, Tilley DG, Kostyak JC, Kunapuli SP, Houser SR, Sabri A. Loss of Protease-Activated Receptor 4 Prevents Inflammation Resolution and Predisposes the Heart to Cardiac Rupture After Myocardial Infarction. Circulation. 2020;142(8):758–75. doi:10.1161/CIRCULATIONAHA.119.044340.
Jenke A, Wilk S, Poller W, Eriksson U, Valaperti A, Rauch BH, Stroux A, Liu P, Schultheiss HP, Scheibenbogen C, Skurk C. Adiponectin protects against Toll-like receptor 4-mediated cardiac inflammation and injury. Cardiovasc Res. 2013;99(3):422–31. doi:10.1093/cvr/cvt118.
Naftali-Shani N, Levin-Kotler LP, Palevski D, Amit U, Kain D, Landa N, Hochhauser E, Leor J. Left Ventricular Dysfunction Switches Mesenchymal Stromal Cells Toward an Inflammatory Phenotype and Impairs Their Reparative Properties Via Toll-Like Receptor-4. Circulation. 2017;135(23):2271–87. doi:10.1161/CIRCULATIONAHA.116.023527.
Song N, Scholtemeijer M, Shah K. Mesenchymal Stem Cell Immunomodulation: Mechanisms and Therapeutic Potential. Trends Pharmacol Sci. 2020;41(9):653–64. doi:10.1016/j.tips.2020.06.009.
Naik S, Larsen SB, Cowley CJ, Fuchs E. Two to Tango: Dialog between Immunity and Stem Cells in Health and Disease. Cell. 2018;175(4):908–20. doi:10.1016/j.cell.2018.08.071.
Friedman CE, Nguyen Q, Lukowski SW, Helfer A, Chiu HS, Miklas J, Levy S, Suo S, Han JJ, Osteil P, Peng G, Jing N, Baillie GJ, Senabouth A, Christ AN, Bruxner TJ, Murry CE, Wong ES, Ding J, Wang Y, Hudson J, Ruohola-Baker H, Bar-Joseph Z, Tam PPL, Powell JE, Palpant NJ. Single-Cell Transcriptomic Analysis of Cardiac Differentiation from Human PSCs Reveals HOPX-Dependent Cardiomyocyte Maturation. Cell Stem Cell. 2018;23(4):586–98.e8. doi:10.1016/j.stem.2018.09.009.
Wakitani S, Saito T, Caplan AI. Myogenic cells derived from rat bone marrow mesenchymal stem cells exposed to 5-azacytidine. Muscle Nerve. 1995;18:1417–26. doi:10.1002/mus.880181212.
Jiang S, Zhang S. Differentiation of cardiomyocytes from amniotic fluid–derived mesenchymal stem cells by combined induction with transforming growth factor β1 and 5–azacytidine. Mol Med Rep. 2017;16:5887–93. doi:10.3892/mmr.2017.7373.
Diesch J, Le Pannérer MM, Winkler R, Casquero R, Muhar M, van der Garde M, Maher M, Herráez CM, Bech-Serra JJ, Fellner M, Rathert P, Brooks N, Zamora L, Gentilella A, de la Torre C, Zuber J, Götze KS, Buschbeck M. Inhibition of CBP synergizes with the RNA-dependent mechanisms of Azacitidine by limiting protein synthesis. Nat Commun. 2021;12(1):6060. doi:10.1038/s41467-021-26258-z.
Leitoguinho AR, Arasaratnam D, Labonne T, Ng ES, Davis RP, Casini S, Passier R, Hudson JE, Porrello ER, Costa MW, Rafii A, Curl CL, Delbridge LM, Harvey RP, Oshlack A, Cheung MM, Mummery CL, Petrou S, Elefanty AG, Stanley EG, Elliott DA. NKX2-5 regulates human cardiomyogenesis via a HEY2 dependent transcriptional network. Nat Commun. 2018;9(1):1373. doi:10.1038/s41467-018-03714-x.
Feng W, Schriever H, Jiang S, Bais A, Wu H, Kostka D, Li G. Computational profiling of hiPSC-derived heart organoids reveals chamber defects associated with NKX2-5 deficiency. Commun Biol. 2022;5(1):399. doi:10.1038/s42003-022-03346-4.
Almalki SG, Agrawal DK. Key transcription factors in the differentiation of mesenchymal stem cells. Differentiation. 2016;92(1–2):41–51. doi:10.1016/j.diff.2016.02.005.
Armiñán A, Gandía C, García-Verdugo JM, Lledó E, Mullor JL, Montero JA, Sepúlveda P. Cardiac transcription factors driven lineage-specification of adult stem cells. J Cardiovasc Transl Res. 2010;3(1):61–5. doi:10.1007/s12265-009-9144-3.
Fukuda K. Molecular characterization of regenerated cardiomyocytes derived from adult mesenchymal stem cells. Congenit Anom. 2002;42:1–9. doi:10.1111/j.1741-4520.2002.tb00847.x.
Saheli M, Pirhajati Mahabadi V, Mesbah-Namin SA, Seifalian A, Bagheri-Hosseinabadi Z. DNA methyltransferase inhibitor 5-azacytidine in high dose promotes ultrastructural maturation of cardiomyocyte. Stem Cell Investig. 2020;7:22. doi:10.21037/sci-2020-007.
Hasani S, Javeri A, Asadi A, Fakhr Taha M. Cardiac Differentiation of Adipose Tissue-Derived Stem Cells Is Driven by BMP4 and bFGF but Counteracted by 5-Azacytidine and Valproic Acid. Cell J. 2020;22(3):273–82. doi:10.22074/cellj.2020.6582.
Piryaei A, Soleimani M, Heidari MH, Saheli M, Rohani R, Almasieh M. Ultrastructural maturation of human bone marrow mesenchymal stem cells-derived cardiomyocytes under alternative induction of 5-azacytidine. Cell Biol Int. 2015;39,519 – 30. doi: 10.1002/cbin.10421.
Yang Y, Lu H, Chen C, Lyu Y, Cole RN, Semenza GL. HIF-1 Interacts with TRIM28 and DNA-PK to release paused RNA polymerase II and activate target gene transcription in response to hypoxia. Nat Commun. 2022;13:316. doi:10.1038/s41467-021-27944-8.
Yoshida Y, Matsunaga N, Nakao T, Hamamura K, Kondo H, Ide T, Tsutsui H, Tsuruta A, Kurogi M, Nakaya M, Kurose H, Koyanagi S, Ohdo S. Alteration of circadian machinery in monocytes underlies chronic kidney disease-associated cardiac inflammation and fibrosis. Nat Commun. 2021;12(1):2783. doi:10.1038/s41467-021-23050-x.
Abe H, Tanada Y, Omiya S, Podaru MN, Murakawa T, Ito J, Shah AM, Conway SJ, Ono M, Otsu K. NF-κB activation in cardiac fibroblasts results in the recruitment of inflammatory Ly6Chi monocytes in pressure-overloaded hearts. Sci Signal. 2021;14(704):eabe4932. doi:10.1126/scisignal.abe4932.
Kaidi A, Williams AC, Paraskeva C. Interaction between beta-catenin and HIF-1 promotes cellular adaptation to hypoxia. Nat Cell Biol. 2007;9(2):210–7. doi:10.1038/ncb1534.
Rochais F, Mesbah K, Kelly RG. Signaling pathways controlling second heart field development. Circ Res. 2009;104,933 – 42. doi: 10.1161/CIRCRESAHA.109.194464.
Sun X, Peng X, Cao Y, Zhou Y, Sun Y. ADNP promotes neural differentiation by modulating Wnt/β-catenin signaling. Nat Commun. 2020;11(1):2984. doi:10.1038/s41467-020-16799-0.
Wang Q, Zou Y, Nowotschin S, Kim SY, Li QV, Soh CL, Su J, Zhang C, Shu W, Xi Q, Huangfu D, Hadjantonakis AK, Massagué J. The p53 Family Coordinates Wnt and Nodal Inputs in Mesendodermal Differentiation of Embryonic Stem Cells. Cell Stem Cell. 2017;20(1):70–86. doi:10.1016/j.stem.2016.10.002.

supplementalinformationFIG.1.tif
Supplemental Fig.1 Immunohistochemical analysis of infarction myocardial tissue was performed after 28 days.

Download PDF

Version 1

posted

You are reading this latest preprint version

Latifolin enhances both survival and cardiomyocyte differentiation of bone marrow mesenchymal stem cells on rat myocardial infarction model

Status:

Version 1

Abstract

Figures

Introduction

Methods

BM-MSCs culture and characterization

MTT assay

Induction and differentiation of BM-MSCs

RT- PCR assay

Immunofluorescence assay

Transmission electron microscopy assay

Rat MI model and BM-MSCs transplantation

LDH and CK-MB examination

Cardiac function assessment

Measurement of LV infarct size

Masson’s trichrome examination

Histological examination

Survival and cardiomyocyte differentiation examination

Immunohistochemistry examination

Western blotting

Statistical analysis

Results

Identification of BM-MSCs

Latifolin promoted viability and decreased apoptosis of BM-MSC in vitro

Latifolin promoted BM-MSCs morphological differentiation under microscope and TEM in vitro

Latifolin promoted BM-MSCs expression of cardiac-specific gene and protein in vitro

Latifolin increased the effect of BM-MSCs on cardiac function in MI rats

Latifolin promoted BM-MSCs to reduce myocardial infarction size and fibrosis area of MI rats

Latifolin enhanced BM-MSCs to improve the myocardial tissue histopathological changes

Latifolin reduced inflammatory cell infiltration in infarction myocardial tissue

latifolin promoted survival and improved cardiomyocyte differentiation of BM-MSCs after transplanting in myocardial tissue

Latifolin affected HIF-1α/NF-κB/IL-6 and HIF-1α/β-catenin pathway in myocardial tissue

Discussion

Conclusions

Declarations

References

Supplementary Files

Status:

Version 1