DOI: https://doi.org/10.21203/rs.3.rs-1787672/v1
BACKGROUD: Mesenchymal Stromal Cells (MSC) from adipose tissue are among the most extensively investigated cells for clinical applications both in human and veterinary medicine. Their isolation is mostly carried out by collagenase digestion followed by filtration and seeding. Non-adherent cells are then removed from culture 48 hours upon seeding. Our hypothesis is that fragments eliminated by filtration or discarded after 48h might contain residual MSC that adhere later to the plastic, also after 6 days (144 hours) upon isolation. The aim of this study is to evaluate the basic features of cells that adhere to the plastic at 3 different time points after isolation in order to speculate on the possible existence of MSC subpopulations that are located in different tissue niches.
METHODS: Subcutaneous adipose tissue collected from 3 dogs was minced and digested with collagenase I. Three cell populations were obtained at different time points from isolation (48h, 96h, and 144h). They were expanded until passage 3 and characterized by flow cytometry for positive (CD90, CD44, CD29) and negative (CD14, MHC2, CD45) MSC markers as well as for CD31 (endothelial cell marker), CD146 (pericyte marker), alpha-SMA (smooth muscle cell marker). At passage 3, cells were evaluated for viability (MTT assay), doubling time, and trilineage differentiation ability.
RESULTS: No significant differences between the 3 subpopulations were observed. They were all characterized by the expression of MSC positive markers and by the absence of negative markers. CD31, CD146, and alpha-SMA were expressed by less than 5% of the cells in all the 3 sub-populations. No differences in differentiation ability and viability were detected. Doubling time ranged between 25 and 30 hours in all the 3 experimental groups.
CONCLUSIONS: The 3 cell subpopulations were similar in terms of immunophenotype, proliferation, and differentiation potential. In this view, the procedure of sequential adhesions seems to be a useful method to efficiently improve MSC yield. Indeed, it allows for optimized cell recovery, reducing the amount of sampled tissue and shortening the time necessary to obtain an adequate number of cells for clinical applications. However, functional differences cannot be excluded, and potency assays are required in order to explore possible distinct biological attitudes.
Mesenchymal Stromal Cells (MSC) are a subset of heterogeneous fibroblastoid stromal cells with high self-renewal capacity and differentiation potential. Over the last years, the interest on MSC in human and veterinary medicine has dramatically risen. This is confirmed by the abundance of clinical trials aimed at validating their efficacy in a wide range of pathological conditions (https://clinicaltrials.gov/) and by the increasing number of reports concerning MSC clinical use in spontaneous animal diseases (Voga et al., 2020). By virtue of their biological features, MSC are currently the most extensively investigated cell type for advanced therapies. The ability to modulate inflammation/immunologic related disorders, the pro-regenerative potential, the tropism for injured sites, and the paracrine signaling make them suitable "smart" therapeutic tools (Pittenger et al., 2019).
Over time, MSC have been collected from many different tissues and organs of adult mammals, like bone marrow, peripheral blood, synovial fluid, umbilical cord blood, Wharton's jelly, placenta, spleen, adipose tissue (Han et al., 2019).
In a position paper of the International Society for Cellular Therapy – ISCT, the main basic features of MSC were elucidated (Dominici et al., 2006). According to ISCT suggestions, MSC must display the ability to adhere to plastic when isolated from tissues and cultured in vitro, must express several antigens such as CD90, CD73, CD105 in a percentage ≥ 95%, and must express the typical hematopoietic surface molecules (CD45, CD34, CD14) in a rate ≤ 5%. Finally, they must be multipotent in vitro and display adipocytic, osteoblastic and chondroblastic trilineage differentiation potential (Dominici et al., 2006).
MSC are becoming increasingly used in canine species to treat a range of diseases, including orthopedic (Dias et al., 2021), digestive tract disorders (Cristóbal et al., 2021; Pérez-Merino et al., 2015), as well as diseases of the liver (Gardin et al., 2018), kidney (Lee et al., 2017), heart (Pogue et al., 2013), respiratory, skin (Enciso et al., 2019), ocular (Villatoro et al., 2015) and reproductive system. In addition, canine MSC have been extensively studied due to the interest this species holds as preclinical/clinical models for cell therapy in humans (Hoffman & Dow, 2016).
Different research groups have carried out canine MSC isolation. Their characterization is usually performed through flow-cytometry, immuno-fluorescence, or RT-PCR. Comparison between various studies revealed some differences concerning ISCT indications for surface markers of MSC. The most recurrent positive markers for canine MSC are CD29, CD44 and CD90 (Ivanovska et al., 2017; W. S. Lee et al., 2011; Russell et al., 2016; Takemitsu et al., 2012); among these, only CD90 is included in ISCT guidelines. CD73 was detected by flow cytometry in canine MSC only by Russel et al. (Russell et al., 2016), and through RT-PCR in three published works (Ivanovska et al., 2017; W. S. Lee et al., 2011; Screven et al., 2014). Canine MSC expression of CD105 marker was detected by flow cytometry only in two papers (Bearden et al., 2017; Chow et al., 2017).
Different sources of MSC are currently used in dogs, but adipose tissue (AT) is one of the most studied since it is abundant, easy to collect using minimally invasive procedures, and rich in MSC that are relatively easy to isolate, propagate and exhibit high proliferative potential in vitro (Rashid et al., 2021; Zhan et al., 2019).
Isolation of MSC from AT is commonly carried out by a standardized procedure including the following phases: 1. Mincing tissue with scissors or scalpel; 2. Digestion by collagenase type I for 45 min to 1 h at 37 ◦C by gently shaking in a water bath; 3. Centrifugation and removal of the floating lipid layer; 4. Filtration of the stromal vascular fraction (SVF) through 100 and 70, or 40 µm filters; 5. Washing and new centrifugation; 6. Removal of the supernatant, resuspension of the cell pellet, and seeding in a culture flask. 7. Removal of non-adherent cells from the culture 48 hours after seeding. Comparing different protocols described in the relevant literature, it is evident that the main differences concern collagenase concentration and digestion length, but no other consistent differences emerge. The procedure described in the most of the studies, therefore, represents a succession of consolidated phases which is repeated rather constantly in different laboratories (Bearden et al., 2017; Chow et al., 2017; Ivanovska et al., 2017; W. S. Lee et al., 2011; Russell et al., 2016; Screven et al., 2014; Takemitsu et al., 2012; Zhan et al., 2019).
In our multi-year experience in isolating and expanding AT-derived MSC from animal species, we observed that vascular-stromal fragments, usually eliminated by filtration or discarded after 48h from seeding, release over time cells able to adhere to the plastic and to proliferate for subsequent passages. Two possible hypotheses have been formulated to explain this behavior: i) Cells adhere at different time points but share the same MSC biological identity; ii) Cells adhere at different time points because they belong to different tissue niches. To verify the correct hypothesis, we compared MSC subpopulations from 3 donors to highlight differences or common traits. To this aim, 3 cell sub-populations were obtained based on their time-dependent affinity to plastic. They were compared for viability, proliferative activity, immune-phenotype, and differentiation ability towards adipogenic, osteogenic, and chondrogenic lineages.
Five grams of subcutaneous adipose tissue were collected from three dogs under the age of 5 who died of traumatic causes and that were referred to the OVUD (Veterinary University Didactic Hospital) of the University of Perugia. The adipose tissue was collected in a sterile way a few hours after death and with the consent of the owners who donated the cadavers for educational and research needs. Tissue samples were washed 3 times in phosphate-buffered saline (PBS), supplemented with 200 U/ml penicillin, 200 ug/ml streptomycin, and 250 ng/ml amphotericin B (Merck, Darmstadt, Germany). Tissue samples were finely minced by forceps and digested with 0.075% collagenase type I (Worthington Biochemical Corp., Lakewood, NJ) at 37° C for 75 minutes. The homogenate was centrifuged at 600g for 10 minutes; the lipid fraction was discarded while the pellet containing the SVF was seeded without filtration in 2 T25 tissue culture flasks (TPP, Trasadingen, Switzerland) and cultivated at 37° C with 5% CO2 in DMEM low glucose (Dulbecco’s modified Eagle Medium; Gibco, Gaithersburg, MD) supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin, and 100 ug/ml streptomycin for 48 hours. Cells obtained from the first 48 hours were named 1st adhesion (Ad1).
The residual SVF floating in the medium was re-plated in 2 new T25 flasks (2nd adhesion - Ad2) to allow the adhesion of residual cells. After 48 hours, tissue residues in suspension were recovered and seeded again in 2 new T25 flasks (3rd adhesion – Ad3). Adherent cells from Ad1, Ad2 and Ad3 were maintained in the same culture condition; when cells reached 80% of confluence, they were detached with Trypsin-EDTA solution, counted by Trypan blue dye exclusion, and seeded in new culture flasks at 20000 cells/cm2.
Proliferative potential was calculated to estimate the cumulative cell number and the Doubling time at Passage 3 for each population. Ad1, Ad2 and Ad3 cell populations were counted at each passage, from Passage 1 to Passage 4. Cumulative cell number (CN) was calculated with the following formula: CN=(nP1 x nP2 x nP3 x nP4)/(sP2 x sP3 x sP4); (nP: number of cells counted after each passage; sP: number of cells seeded for each passage).
Doubling time was calculated for Ad1, Ad2, and Ad3 at passage 3. Cells were seeded in a 48-well plate at the concentration of 104 cells/cm2 in triplicate. Next 4 days cells were detached and counted by Trypan blue dye exclusion. Doubling time was calculated between day 1 and day 4, using the following formula: DT = 72h x [ln(2) / ln(n2/n1)]; (n2: number of cells at day 4; n1: number of cells at day 1).
Ad1, Ad2, and Ad3 at passage 3 were seeded in a 24-well plate at 3 x 104 cells/cm2 and incubated until confluence in DMEM supplemented with 10% FBS, 100 U/ml penicillin, 100 ug/ml streptomycin.
For adipogenic differentiation, cells were treated with induction medium (DMEM-LG, 10% FBS, 100 U/ml penicillin, 100 ug/ml streptomycin, 0,5 mM isobutyl-methylxantine, 100 uM indomethacin, 1 uM dexamethasone, 10 ug/ml Insulin) alternated with maintenance medium (DMEM-LG, 10% FBS, 100 U/ml penicillin, 100 ug/ml streptomycin, 10 ug/ml Insulin). Adipogenic induction lasted 21 days with medium changes every 2 days. At the end of the procedure, cells were labeled with the intra-vital fluorescent dye LipidSpot (Biotium, Fremont, CA). The dye was diluted to a concentration of 1% in phenol red free DMEM and applied to the culture for 30 minutes at 37 ° C before observation under a fluorescence microscope.
For osteogenic differentiation, cells were cultivated in DMEM-LG supplemented with 10% FBS, 100 U/ml penicillin, 100 ug/ml streptomycin, 100 nM dexamethasone, 10 mM glycerophosphate, 50 uM ascorbate-2-phosphate. Osteogenic induction lasted for 21 days with medium changes every 2 days. At the end of the procedure, cells were fixed in 10% formalin and stained with Alizarin S.
For chondrogenic differentiation, cells were cultivated in DMEM-LG supplemented with 1% FBS, 100 U/ml penicillin, 100 ug/ml streptomycin, 6,5 ug/ml Insulin, 10 ng/ml TGF beta-3, 50 nM ascorbate-2-phosphate). Induction lasted 21 days, and the medium was changed every 2 days. Chondrogenic differentiation was performed in microcentrifuge tubes to obtain micromass pellets. Micromass samples were fixed with 10% formalin and paraffin-embedded. Five um sections were stained with Alcian Blue pH 1.
Total RNA from differentiated cells was extracted with Trizol reagent and purified with PureLink RNA Mini Kit (Invitrogen) following manufacturer's instructions. Isolated RNA was quantified using Nanodrop. cDNA was then obtained via reverse transcription of total RNA (500 ng for sample) using High capacity cDNA RT Kit (Applied Biosystem) in the final volume of 20 ul (thermal cycle condition: 25°C for 10 minutes, 37°C for 120 minutes, 85°C for 5 minutes), 10 ng of cDNA were used as a template for PCR amplification (35 cycles; denaturation at 95°C for 15 seconds, annealing at specific temperatures reported in Table 1 for 20 seconds, extension at 72°C for 20 seconds). PCR products were separated on 2% agarose gel in TAE buffer.
In Table 1 are reported for each gene, forward and reverse primer sequences, as well as annealing temperature and product size.
| Gene | Forward primer sequence | Reverse primer sequence | Annealing temperature | Product size |
|---|---|---|---|---|
| OPN | AGAGAAGTGCAGCATCGTCC | CACAGCATTCTGCTTTTCCTCA | 60°C | 170 bp |
| OSX | ACGACACTGGGCAAAGCAG | CATGTCCAGGGAGGTGTAGAC | 60°C | 285 bp |
| FABP4 | ATCAGTGTAAACGGGGATGTG | GACTTTTCTGTCATCCGCAGTA | 57°C | 117 bp |
| PPARg | ACACGATGCTGGCGTCCTTGATG | TGGCTCCATGAAGTCACCAAAGG | 63°C | 119 bp |
| ACAN | ATCAACAGTGCTTACCAAGACA | ATAACCTCACAGCGATAGATCC | 55°C | 122 bp |
| ACAN (aggrecan), FABP4 (fatty acids-binding protein), OPN (osteopontin), OSX (osterix, Trascription factor Sp7), PPARg (peroxisome proliferator activated receptor gamma) | ||||
Ad1, Ad2, and Ad3 cell populations at passage 3 were seeded in a 96-well plate at the concentration of 3 x 104 cells/cm2 and incubated for 48 hours. Cell viability was evaluated by MTT assay (Invitrogen, Vybrant MTT) following manufacturer's instructions. Optical density was measured at 570 nm with Tecan Infinite 200 microplate reader.
Flow cytometric investigation was performed to evaluate the expression of positive (CD90, CD29, CD44) and negative (CD45, CD14, MHC2) MSC markers commonly used in animal species. CD146, CD31, and alpha-SMA were also evaluated to assess the presence of pericytes, endothelial cells, and smooth muscle cells in the 3 subpopulations.
At 80% of confluence, Ad1, Ad2, and Ad3 cells at passage 3 were harvested from the culture flask, counted, and resuspended to a concentration of 0.5 × 106 cells/100 ul per antibody tested in incubation buffer (PBS–0.5% BSA). Primary antibodies used are listed in Table 2.
| Alpha-Smooth Muscle Actin Antibody (SPM332) PE | Novusbio (Centennial, CO, USA) | NBP2-34760PE |
|---|---|---|
| CD14 Monoclonal Antibody (Tuk4) FITC | ThermoFisher Scientific (Carlsbad, CA 92008, USA) | MA1-82074 |
| CD29 anti-human Antibody (TS2/16) PE | BioLegend (San Diego, CA. USA) | 303004 |
| CD90 Monoclonal Antibody (YKIX337.217) PE | ThermoFisher Scientific (Carlsbad, CA 92008, USA) | 12-5900-42 |
| CD44 Monoclonal Antibody (YKIX337.8) FITC | ThermoFisher Scientific (Carlsbad, CA 92008, USA) | 11-5440-42 |
| CD45 Monoclonal Antibody (YKIX716.13) PE | Biorad (Hercules, California USA) | MCA1042PE |
| CD146 Monoclonal Antibody (P1H12) FITC | ThermoFisher Scientific (Carlsbad, CA 92008, USA) | 11-1469-42 |
| CD31 Polyclonal Antibody PE | Bioss Antibodies (Woburn, Massachusetts USA) | bs-0468R-PE |
| Rat anti dog MHC ClassII monomorphic (YKIX334.2) FITC | Biorad (Hercules, California USA) | MCA1044F |
For alpha-actin labeling, a further permeabilization step was required. Briefly, 0.5 × 106 cells were resuspended in 200 ul of fixation buffer and incubated for 10 minutes at room temperature. After washing at 400g for 10 minutes with sterile phosphate buffered saline (PBS, ph 7.4), cells were resuspended in 100 ul of permeabilization buffer for labeling.
Antibodies were diluted in PBS according to the manufacturers’ instructions, added to the cell suspension for 15 min at room temperature, in the dark and stirred on a shaker. Finally, cells were washed (400 g for 10 minutes) and resuspended in a fluorescent buffer. Data were acquired by FACS Calibur (Becton Dickinson) equipped with a laser BLUE 488 nm. Data analysis was performed with the software CellQuest Pro (Becton Dickinson Immunocytometry Systems) and Kaluza 1.1 (Beckman Coulter). Unstained cells were used as control to detect autofluorescence.
Changes to the classic isolation protocol performed during this study have shown that the vascular-stromal fragments, typically eliminated by filtration or after 48h from seeding, contain cells capable of adhering to the culture plastic and proliferating for subsequent passages. Ad1, Ad2, and Ad3 cell subpopulations were fibroblastoid in shape and did not show morphological differences in culture.
Cumulative cell number was estimated for Ad1, Ad2, and Ad3 by counting the cells after all passages and calculating the growth ratio between the number of cells seeded and the cells recovered after the growth period. The estimated cell number of the three populations at Passage 4 was 5,20 ± 1,20 billion of cells for Ad1, 6,39 ± 1,00 for Ad2 and 5,29 ± 1,42 for Ad3.
Ad1, Ad2, and Ad3 at passage 3 were evaluated for their proliferative capacity by calculating the doubling time for 4 days. The graph obtained using the count data shows the cell growth trend of the three subpopulations for 4 days. No significant differences were observed when cells from the same donor were considered. On the other hand, small differences were seen when cells from different donors were compared due to the individual variability. The doubling time of the 3 populations ranged from 22 to 35 hours. The mean doubling time was 26,93 ± 4,08 hours for Ad1, 27,72 ± 6,77 for Ad2 and 29,85 ± 5,57 for Ad3 (Fig. 1a and 1b).
Differentiation potential of Ad1, Ad2, and Ad3 at passage 3 was verified by inducing cells to differentiate in vitro towards adipogenic, osteogenic and chondrogenic lineages. Osteogenic and chondrogenic differentiation was confirmed by histochemical techniques (Alizarin S and Alcian Blue). For adipogenic differentiation, the intracellular fluorescent dye Lipidspot demonstrated the presence of multiple yellow-green fluorescent lipid drops inside differentiated cells.
RT-PCR results confirmed the expression of tissue specific genes in all the three populations: osteopontin (OPN) and osterix (OSX) for osteogenic differentiation, fatty acid binding protein (FABP4) and peroxisome proliferator activated receptor gamma (PPARγ) for adipogenic differentiation and aggrecan (ACAN) for chondrogenic differentiation. The results obtained showed that Ad1, Ad2, and Ad3 from all the subjects were characterized by a trilineage differentiation potential as expected for MSC based on ISCT guidelines (Fig. 2).
MTT assay was carried out to evaluate cell viability by seeding Ad1, Ad2, and Ad3 cells at 3,2x104/cm2. Cell viability values obtained by MTT assay were normalized for the Ad1 population and analyzed for each donor to eliminate differences deriving from individual variability. The mean values for the three populations were 100 ± 2.6%, 112.5 ± 17.1%, and 121.3 ± 23.1%. The results showed that the relative viability was comparable among the three populations since the values did not show statistically significant differences (Fig. 3).
The immunophenotypic profile of the three populations was investigated by flow cytometry. Results were affected by individual variability. Nevertheless, cell populations did not differ in size and graininess, even though aggregating forms were found, corresponding to off-scale fluorescence peaks.
High autofluorescence of cells made it difficult to accurately evaluate weak positive events and presumably determined an underestimation of the values and an increased degree of uncertainty.
The three populations didn’t show expression differences for tested markers; the only parameter that displayed a statistically significant difference was CD29 in the Ad2 population, which resulted lower if compared with Ad1 (Ad2 81,85% vs. Ad1 90,59%) (p value 0,038). Altogether the three populations were positive for CD29, CD44 and CD90, even if with a value lower than the parameter of 95% indicated by ISCT. The three populations were negative for CD14, CD45, and MHCII, with values well below the threshold of 2% (ISCT). Pericyte, smooth muscle, and endothelial cell markers (CD146, a-SMA and CD31) were weakly expressed by the cells under analysis e with very uncertain values (Fig. 4).
This research is based on the observation that SVF obtained by conventional enzymatic digestion of adipose tissue contains fibroblastoid cells capable of adhering to the culture plastic at different time points after isolation. The study's objective was to investigate the possible existence of distinct subpopulations of adipose tissue-derived MSC, characterized by different biological features that explain their delayed adherence. In particular, two hypotheses have been formulated: i) the cells that adhere at different times share the same identity; ii) the cells that adhere at different times are biologically different. Both hypotheses entail considerably different consequences and can have significant implications in the veterinary medical field in which, unlike in humans, MSC are frequently used in clinical practice.
If the first hypothesis is verified, we would have developed a technical procedure capable of amplifying MSC yield, thus reducing the amount of sampled tissue and shortening the time needed between isolation and therapeutic application. Currently, this is one of the major drawbacks of MSC treatment in that a prolonged in vitro expansion may be necessary to obtain a clinical dose of cells. It should be emphasized, however, that long-term culture may affect the MSCs' inherent properties determining up-regulation of senescence genes, morphologic changes, decreased differentiation potential, and decreased immunomodulatory properties (García-Bernal et al., 2021).
MSC isolation and expansion procedure described in this study made it possible to overcome some of these issues by dramatically increasing cell yield. Our data demonstrate that it is possible to obtain theoretically up to 2,5 billion MSC at passage 3 from five grams of adipose tissue, or 17 billion at Passage 4, considering the sum of the three populations.
If the second hypothesis is verified, on the contrary, we would have highlighted the presence of distinct tissue niches hosting cells with different biological characteristics. This evidence would have a considerable impact both in vitro and in vivo and would require further thorough investigations since different biological features are likely to be related to different therapeutic potentials.
To verify which hypothesis is correct, we characterized the 3 cell subpopulations based on the minimum requirements defined by the ISCT for MSC. In particular, we evaluated trilineage multipotency and molecular phenotype. We also compare their proliferative potential by estimating doubling time and vitality. The three cell subgroups identified in this study overlapped for proliferative potential since no significant differences were highlighted by doubling time and MTT assays.
Together with plastic adherence and immunophenotype, the evaluation of multipotency is a common and reliable way to identify MSC. In this study, the 3 subgroups were comparable concerning trilineage differentiation ability, as demonstrated by histochemical staining and RT-PCR.
Regarding immunophenotype, although the data reported in the relevant literature on the phenotype of canine MSC in terms of quantitative expression of surface markers are somewhat inconsistent, the most common molecular pattern used to identify MSC has been confirmed in all 3 sub-populations. In fact, CD29, CD90, and CD44 proved to be reliable positive markers in canine species with a percentage of expression not exceeding 95% (as suggested by the ISCT for human MSC markers) but consistent with previous studies (Ivanovska et al., 2017; W. S. Lee et al., 2011; Russell et al., 2016) and not substantially different among the 3 subpopulations. Equally, negative markers were always less than 2%. The evaluation of markers related to stromal-vascular cell populations different from MSC (pericytes, smooth muscle cells, endothelial cells) showed that these cells were always represented in a minimal percentage (< 5%).
Considering the indications of ISCT, with the appropriate species specificities, we can conclude that the features highlighted in Ad1, Ad2, and Ad3 lead to identifying all of them with MSC. It may be hypothesized that tissue fragments that persist in suspension release over time MSC that had remained sequestered in the tissue and that had not been reached by the enzyme. In this case, the cells that adhere later to the flask result from a passive release that in turn, is the consequence of progressive maceration of the tissue.
According to a slightly more complex and dynamic explanation, it could be hypothesized that the niche in which MSC reside is preserved in suspended fragments. Following stimulation by factors present in the medium or released by cells that have already adhered to the plastic, residual MSC enclosed in the SVF undergo proliferation and increase their number before being released, thus justifying the high cell yield associated with this procedure.
Although suggestive, these conclusions are not supported by confirmatory data, and risk to be only speculative. Therefore, the problem of the identity of MSC cannot be exhaustively solve only using the minimum parameters defined by the ISCT.
It cannot be excluded, for example, that a hierarchy of cells does exist in adipose tissue that share standard basic features but differ in specific markers not considered in this study and associated with different tissue niches. In a paper by Merrick et al., the authors showed that there are subpopulations of stromal cells that display immunophenotypic peculiarities and reside in different tissue areas. The most immature cells are located in the so-called reticular stroma, a compartment that, according to the authors, is located around adipocyte aggregates or around specific organs (Merrick et al., 2019). The use of these unconventional markers, as well as the in situ investigation of resident mesenchymal stromal cells, would give some additional elements to clarify their location and density in canine adipose tissue.
Furthermore, potency assays could provide exciting data helpful in understanding whether the biological identity demonstrated through ISCT parameters corresponds to a functional identity. In this regard, it should be emphasized that MSCs' biology and function depend upon a plethora of mechanisms and soluble and insoluble messages that can be profoundly different even though the cells are phenotypically similar and that can evoke dramatically different effects in vitro and in vivo.
In conclusion, the major findings of this work suggest that the described procedure could allow a large-scale expansion of MSC that would accomplish the rapid development of MSC-based therapies, benefiting the improvement of their separation and culture. However, it cannot be hidden that the increased cell yield resulting from the implementation of this procedure raises the question about the distinctive features of MSC and suggests an urgent revision of the criteria used for their identification. Indeed, the fact that adipose mesenchymal progenitors constitute a heterogeneous pool and that the attempts to characterize these cells have relied on nonspecific markers encourages switching to a functional assessment to define their therapeutic potential.
Our results, in conclusion, raise the necessity to identify functional markers of MSC sub-populations and relate them to possible tissue reservoirs of functionally distinct cell populations in order to develop more targeted therapeutic approaches.
MSC - Mesenchymal Stromal Cells
ISCT - International Society for Cellular Therapy
SVF - Stromal Vascular Fraction
OVUD - Veterinary University Didactic Hospital
PBS -Phosphate-buffered saline (PBS)
Ad1 - 1st adhesion
Ad2 - 2nd adhesion
Ad3 - 3rd adhesion
CN - Cumulative cell number
DT - Doubling time
FBS – Fetal Bovine Serum
DMEM LG – Dulbecco’s modified Eagle Medium – Low Glucose
RT-PCR - Reverse Transcriptase PCR
BSA - Bovine Serum Albumine
OPN - Osteopontin
OSX – Osterix
FABP4 - Fatty acid binding protein
PPARγ - Peroxisome proliferator activated receptor gamma
ACAN - Aggrecan
MTT assays - 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide
Funding
This work was funded by Italian Ministry of Health, Research code IZSUMRC102019
Ethics approval and consent to participate
The owners of donor dogs who died of traumatic causes have given their informed consent to the sampling of adipose tissue.
Consent for publication
Not applicable
Availability of data and material
All data generated or analysed during this study are partly included in this published article and partly available from the corresponding author on reasonable request.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
G. Scattini contributed to the conception and design of the study, collection and assembly of data, data analysis and interpretation, manuscript writing.
M. Pellegrini contributed to the conception and design of the study, collection and assembly of data, data analysis and interpretation, manuscript writing.
G. Severi contributed to the conception and design of the study, data analysis and interpretation, manuscript writing, and acquisition of funding.
L. Pascucci contributed to the conception and design of the study, general supervision of the research group, collection and assembly of data, data analysis and interpretation, manuscript writing, final approval of the manuscript.
Acknowledgements
Not applicable