2.1 Plant material and tissue culture
In 2011, the transgenic plant of Pennisetum glaucum (L.) R. Br was obtained using shoot apices as explant source by P. Jha [30]. In this study, the in vitro regeneration system of foxtail millet is established according to P. Jha and regenerated plants are obtained. The mature seeds of foxtail millet are sterilized in 0.1% mercuric chloride for 20 min. And then rinsed with 80% alcohol for 2 min and with sterile distilled water five times, each time for 2 min. After that, the surface sterilized seeds are blot dried using sterile filter paper on a plastic petri dish. Then 16 seeds are inoculated on MS medium (4.33 g·L-1 MS + 30 g·L-1 sucrose + 10 g·L-1 agar) in a culture dish and cultured in the dark for 4 days at 25 ℃. The shoot tips, about 5 mm of the top of seedlings, are cut and placed on MS medium to induce differentiation. After continuous culturing for 2 weeks, the differentiated seedlings are transferred into a culture bottle containing 1/2 MS medium for rooting. The seedlings growing up to 3 cm are moved into nutrient soil after one day of acclimatization.
2.2 GUS histochemical assay and expression analysis
The shoot tips of foxtail millet cultured for 4 days are infected by the Agrobacterium tumefaciens LBA4404 harboring pCAMBIA-1305.1. Then GUS staining is performed after co-cultivating for 3 days according to the prescribed method [31]. The shoot tips are made a small incision in the middle with a scalpel, and then they are put into a 1.5 mL EP tube. GUS staining solution (0.5 M Na2EDTA (pH 8.0), 50 mM K4Fe (CN6). 3H2O, 50 mM K3Fe (CN6), 0.1 g·mol-1 X-Gluc, 10% Triton X-100, 0.05 M PBS (pH 7.0)) is added for dying at 37 ℃ for 16 h. The gradient decolorization is conducted by using ethanol until the material has no obvious green, then photos are taken by a microscope.
2.3 The concentration screening of 6-BA and kanamycin
6-BA, an important plant hormone, is used to promote cell differentiation. Therefore, The shoot tips of seedlings cultured on MS medium for 4 days in the dark are taken out and put on the induced differentiation medium containing 6-BA concentration gradient (0, 0.25, 0.5, 0.75, 1.0 mg·L-1). The differentiation rates of shoot tips are counted after 2 weeks of culturing.
Because the pBIB vector transformed contains kanamycin resistance gene, the resistant seedlings are screened by kanamycin. Kanamycin concentration gradient (0, 10, 15, 20, 25, 30, 35 and 40 mg·L-1) is set to find the suitable resistance concentration.
2.4 Establishment of genetic transformation system
In our early work, the CDS region of SiSERK1 gene has been constructed into the plant overexpression vector pBIB by Gateway technology and transferred into Agrobacterium tumefaciens LBA4404 [29]. Therefore, only the strain needs to be activated and identified in this experiment.
The system is established according to P. Jha [30]. The shoot tips cultured for 4 days in the dark are cut and put into the prepared Agrobacterium immersion solution (4.33 g·L-1 MS + 30 g·L-1 sucrose + 100 µM·L-1 AS + 0.5 mg·L-1 6-BA + OD600 = 1.0 bacterial solution) for 20 min. After that, the shoot tips are placed on the filter paper for 5 min to dry the surface water. Then the shoot tips are put into the co-culture medium (4.33 g·L-1 MS + 30 g·L-1 sucrose + 100 µM·L-1 AS + 0.5 mg·L-1 6-BA + 10 g·L-1 agar) covered with a layer of filter paper and cultured at 25 ℃ in the dark. After 3 days, they are transferred to the screening differentiation medium (4.33 g·L-1 MS + 30 g·L-1 sucrose + 250 mg·L-1 cephalosporium + 0.5 mg·L-1 6-BA + 10 g·L-1 agar + 25 mg·L-1 kanamycin) for two consecutive screening for 2 weeks each time. After screening, the differentiated seedlings are transferred to 1/2 MS medium for rooting. The seedlings growing to 3 cm are transferred to the soil for culturing after one day of acclimatization.
2.5 Identification of transgenic plants
The DNAs are extracted from transgenic plants and wild-type foxtail millet growing in soil for 4 weeks by plant genomic DNA extraction kit (TIANGEN BIOTECH (BEIJING) CO, China). The PCR reaction to identify transgenic plants is performed according to the procedure of template 2 µL, ddH2O 9.9 µL, 10 × Taq buffer 1.5 µL, dNTPs 0.3 µL, the upstream and downstream primers 0.6 µL, enzyme 0.1 µL respectively, taking the extracted DNA as the template, SiSERK1-F and SiSERK1-R as upstream and downstream primers. The PCR program is as follows: 94 ℃ for 5 min; 36 cycles of 94 ℃ for 30 s, 57 ℃ for 30 s, and 72 ℃ for 3 min; and 72 ℃ for 5 min. The primer sequences are as table 1.
2.6 Expression analysis of SiSERK1 gene
Total RNA is extracted using RNA simple total RNA kit (TIANGEN BIOTECH (BEIJING) CO, China). Complementary DNA (cDNA) is synthesised using HiScript® II 1st Strand cDNA Synthesis Kit (+Gdna wiper) (Nanjing Vazyme Biotech Co, China). The qRT-PCR is performed in a 96-well plate using a Bio-Rad iQ5 (Bio-Rad, USA). The PCR primers are designed by Primer Premier 5.0 software and the sequences are listed in table 1. The qRT-PCR reaction procedure is performed using 2 × SYBR Premix ExTaq Tm II (Takara, Dalian, China). The 20 µL reaction system contains 10 µL 2 × SYBR, 1 µL each of forward and reverse primers, 2 µL cDNA template and 6 µL ddH2O. Reactions are carried out as the following cycling program: 95 ℃ for 5 min, 40 cycles of 95 ℃ for 15 s and 60 ℃ for 30 s, 1 cycle of 95 ℃ for 15 s, 60 ℃ for 1 min and 95 ℃ for 1 s. Actin is taken as an internal control. The 2-△△Ct method is used to calculate relative changes in gene expression.
Table 1 Primer sequences
Primer
|
Sequence (5′-3′)
|
Usage
|
SiSERK1-F
|
GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGCAATATCTGGAACTTTACAGTA
|
Gene identification
|
SiSERK1-R
|
GGGGACCACTTTGTACAAGAAAGCTGGGTCCCTCGGGCCGGACAGCTC
|
Gene identification
|
SiSERK1-qRT-F
|
TTCAATCCCCCAACACCAAC
|
qRT-PCR
|
SiSERK1-qRT-R
|
ATGCTCTTCAGGCTTACGCC
|
qRT-PCR
|
Actin-F
|
TGCTCAGTGGAGGCTCAACA
|
qRT-PCR
|
Actin-R
|
CCAGACACTGTACTTGCGCTC
|
qRT-PCR
|
YFP-F
|
ATGGTGAGCAAGGGCGAG
|
Site detection
|
YFP-R
|
TCACTTGTACAGCTCGTCCATG
|
Site detection
|
Detection primer-R
|
GCCAGGCTGCACGAATC
|
Site detection
|
2.7 Identification of insertional site of SiSERK1 in transgenic plant
The insertion site of SiSERK1 gene in transgenic millet is determined by YFP-F and YFP-R. The PCR reaction is performed DNA 2 µL, ddH2O 9.9 µL, 10 × Taq buffer 1.5 µL, dNTPs 0.3 µL, YFP-F 0.3 µL and YFP-R 0.006 µL, enzyme 0.1 µL respectively, taking the extracted DNA as the template. The PCR program is as follows: 94 ℃ for 5 min; 30 cycles of 94 ℃ for 30 s, 56 ℃ for 30 s, and 72 ℃ for 2 min; and 72 ℃ for 5 min. The primer sequences are as table 1.
The PCR product (about 1000 bp) is sequenced with YFP-F. The YFP is about 700 bp and the other 300 bp is compared with the millet genome sequence to determine its insertion site. The downstream primers of single strand complementary strand are designed according to the sequencing results, and the transgenic millet DNA is identified by YFP-F and detection primer-R to ensure the correct location.