1.1 Animals
We purchased the SD rats (5–8 g, 3 days old) from Pengyue Laboratory Animal Breeding Co., Ltd(located in Jinan, Shandong) Postnatal day 5 (P5) pups were used in our experiments. All rats were bred in a room with a 12/12-h light/dark cycle and a temperature of 25 ± 1°C. The room was ventilated, and the bedding, water and feed were replaced regularly to ensure the health of the animals. All animal experimental protocols were approved by the Animal Experimental Ethics Committee at Qilu Hospital of Shandong University and were conducted with the guidance of the Animal Care and Use Committee of Qilu Hospital at Shandong University (Approval number: ECAESDUSM 2012029).
1.2 Neonatal hypoxia brain injury models
To induce hypoxia, we exposed the rats to hypoxia for 7 days in a sealed chamber beginning on P5. The 10% oxygen concentration was maintained for 7 days, during which time the animals were returned to their mothers to suckle for 15 min every day and were monitored daily. Age-matched control rats that were not subjected to hypoxia treatment were placed in the same chamber for the same amount of time.
1.3 Drug administration and experimental groups
NAS (purity > 99%, #A1824) was purchased from Sigma–Aldrich (St. Louis, USA) and was dissolved in DMSO and then diluted with saline. The rats were administered NAS (10 mg/kg) by intraperitoneal injection on days 2, 4, and 6 after hypoxia. We purchased ANA-12 from Sigma–Aldrich (St. Louis, USA), which was dissolved in DMSO (35 mg/ml) and then diluted with saline. Before hypoxia was induced, the rats were administered ANA-12 (0.5 mg/kg) by intraperitoneal injection.
We divided the rats into 4 groups: sham, hypoxia, NAS + hypoxia and ANA-12 + NAS + hypoxia.
1.4 Nissl staining
The sections were dewaxed, washed with distilled water, and then incubated with Nissl staining solution at room temperature for 10 min. Then, 95% and 100% ethanol were used to dehydrate the sections, which were then made transparent using xylene, placed under coverslips and analyzed by microscopy.
1.5 H&E staining
The rats were anesthetized and perfused with PBS. The brain tissues were rapidly removed and fixed with 4% paraformaldehyde at 4°C overnight. Then, the tissues were embedded in paraffin and sectioned into 4-µm-thick slices. Next, the sections were deparaffinized in xylene and rehydrated using graded alcohol solutions. Finally, the sections were stained with H&E, and pathological changes in the brain tissue were observed under a light microscope (400-fold magnification).
1.6 Western blot analysis
The treated tissues from each group were carefully aspirated, and 2 mL of PBS was added for repeated washes; the tissues were then lysed in lysis buffer on ice for 30 min. The sample was centrifuged at 12,000 × g at 4°C for 15 min, and the total protein was harvested. The proteins were separated by electrophoresis and transferred onto polyvinylidene difluoride membranes based on the different molecular weights of each protein at low temperature. The membranes were blocked with 5% nonfat dry milk in TBS at room temperature for 1 h and incubated with primary antibodies overnight at 4°C. Then, the membranes were incubated for 1 h at room temperature with a secondary antibody. The protein signals were detected by enhanced chemiluminescence. The signal bands were analyzed using a ChemiDoc XRS instrument and Image Lab Software. The relative expression was calculated as the ratio between the protein of interest and GAPDH in the same sample and are displayed graphically.
1.7 Real‑time quantitative polymerase chain reaction (qRT–PCR)
The PCR solution containing SYBR Green I was prepared on ice. The finished reaction solution was dispensed into the reaction plate and then sealed and centrifuged at high speed. The reaction plate was placed into the real-time PCR amplification instrument. All samples were analyzed in triplicate. The cycling program was as follows: Step 1, 95°C for 30 sec; Step 2, 40 cycles of 95°C for 3 sec, followed by 60°C for 30 sec. The amplification curve and the melting curve were confirmed after the reaction. Melting curve analysis was performed to confirm amplification specificity. Finally, the data were exported and copied, and the results were calculated and counted. Transcript levels of each mRNA was normalized to GAPDH and were calculated using the 2−∆∆CT method.
The following primers were used:
PTGS2 forward, CTCAGCCATGCAGCAAATCC;
reverse, GGGTGGGCTTCAGCAGTAAT;
GPX4, forward, TCTGAGCCGCTTATTGAAGCC;
reverse, CACACGCAACCCCTGTACTT;
TfR1, forward, CCGGCCTATATGCTTGGGTA; and
reverse, CAAGGGAGCACTCTGAAGCA.
1.8 Transmission electron microscopy (TEM)
Hippocampal tissue samples were cut into 2×2 mm pieces and quickly fixed in electron microscopy fixation solution at room temperature for 2 h. Then, the samples were dehydrated, embedded, and cut into ultrathin sections. The stained samples were then observed and imaged with a transmission electron microscope (JEOL, Japan).
Statistical analysis
Statistical analysis was performed using GraphPad Prism 8.0, and the data are expressed as the mean ± SD. The statistical significance of multiple comparisons was analyzed by one-way analysis of variance (ANOVA). SPSS 19.0 software was used to perform all statistical analyses. P < 0.05 was considered to be statistically significant.