DOI: https://doi.org/10.21203/rs.3.rs-1795722/v1
Hypoxic-ischemic (HI) encephalopathy is the main cause of infant brain damage, perinatal death, and chronic neonatal disability worldwide. Ferroptosis is a new form of cell death that is closely related to hypoxia-induced brain damage. N-acetyl serotonin (NAS) exerts neuroprotective effects, but its effects and underlying mechanisms in hypoxia-induced brain damage remain unclear. In the present study, 5-day-old neonatal Sprague–Dawley rats were exposed to hypoxia for 7 days to establish a hypoxia model. Histochemical staining was used to measure the effects of hypoxia on the rat hippocampus. The hippocampal tissue in the hypoxia group showed significant atrophy. Hypoxia significantly increased the levels of prostaglandin-endoperoxide synthase 2 (PTGS2) and the iron metabolism-related protein transferrin receptor 1 (TfR1) and decreased the levels of glutathione peroxidase 4 (GPX4). These changes resulted in mitochondrial damage, causing neuronal ferroptosis in the hippocampus. More importantly, NAS may improve mitochondrial function and alleviate downstream ferroptosis and damage to the hippocampus following hypoxia. In conclusion, we found that NAS could suppress neuronal ferroptosis in the hippocampus following hypoxic brain injury. These discoveries highlight the potential use of NAS as a treatment for neuronal damage through the suppression of ferroptosis, suggesting new treatment strategies for hypoxia-induced brain damage.
Neonatal hypoxia can result in severe lifelong sequelae and cognitive impairments and can lead to infant death. This condition has become a critical healthcare problem, and 23% of neonatal deaths occur due to neonatal hypoxia[1]. There are various events that cause hypoxic-ischemic (HI) insult, and brain damage is ultimately caused by impaired oxygen delivery to the brain[2] and cerebral blood flow[3]. Severe HI stress can cause mitochondrial dysfunction[4], cellular energy depletion, and brain edema and enhance the release of intracellular calcium[5,6] and neurotransmitters. Hypoxic-ischemic brain damage (HIBD) is thought to involve neuroinflammation, oxidative stress and mitochondrial dysfunction. Hypoxia in childhood can induce bilateral pathological changes in the hippocampus at an early age and precipitate memory issues[7]. There are few effective treatments available to prevent hypoxic injury in fetal brains during and after birth[8], and hypothermia is the only clinical treatment, which is efficient for less than 60% of infants[9]. Thus, identifying new treatment strategies is important.
Recent research has reported that ferroptosis is associated with the development of a few neurological diseases. As a type of cell death, ferroptosis can be induced by the inhibition of glutathione peroxidase 4 (GPX4) or the disruption of glutathione (GSH) synthesis; iron accumulation can exacerbate this process[10]. Researchers have shown that iron levels were increased in the brain tissue of neonatal HIBD patients[11]. In addition, some studies have shown that the prognosis of HIBD may be improved by desferrioxamine and erythropoietin, which modulate iron metabolism[12, 13]. Accumulating evidence shows that ferroptosis plays a critical role in central nervous system (CNS) disorders, including HIBD and traumatic brain injury, and inhibiting ferroptosis can prevent neuronal death[14, 15]. However, in brain diseases, the efficacy of ferroptosis inhibitors is restricted because of the blood–brain barrier. Thus, determining the mechanisms of ferroptosis in HIBD and investigating potential antiferroptotic agents to treat HIBD are important.
As a precursor of melatonin, N-acetyl serotonin (NAS) is produced from serotonin by serotonin N-acetyltransferase; its antioxidant activity is stronger than melatonin[16]. NAS activates tropomyosin-related kinase-derived neurotrophic factor (TrkB) in a circadian manner[17]. Previous studies have shown that NAS can play distinctive roles in the CNS, which was associated with its increasing antioxidant capacity at higher concentrations[18].
Thus, we hypothesize that NAS can be used to treat hypoxia/ischemia-induced injury. To validate this hypothesis, the molecular mechanisms by which NAS inhibits ferroptosis were examined, and we showed that NAS has neuroprotective effects against hypoxia-induced injury in the hippocampus of neonatal Sprague–Dawley (SD) rats.
1.1 Animals
We purchased the SD rats (5–8 g, 3 days old) from Pengyue Laboratory Animal Breeding Co., Ltd(located in Jinan, Shandong) Postnatal day 5 (P5) pups were used in our experiments. All rats were bred in a room with a 12/12-h light/dark cycle and a temperature of 25 ± 1°C. The room was ventilated, and the bedding, water and feed were replaced regularly to ensure the health of the animals. All animal experimental protocols were approved by the Animal Experimental Ethics Committee at Qilu Hospital of Shandong University and were conducted with the guidance of the Animal Care and Use Committee of Qilu Hospital at Shandong University (Approval number: ECAESDUSM 2012029).
1.2 Neonatal hypoxia brain injury models
To induce hypoxia, we exposed the rats to hypoxia for 7 days in a sealed chamber beginning on P5. The 10% oxygen concentration was maintained for 7 days, during which time the animals were returned to their mothers to suckle for 15 min every day and were monitored daily. Age-matched control rats that were not subjected to hypoxia treatment were placed in the same chamber for the same amount of time.
1.3 Drug administration and experimental groups
NAS (purity > 99%, #A1824) was purchased from Sigma–Aldrich (St. Louis, USA) and was dissolved in DMSO and then diluted with saline. The rats were administered NAS (10 mg/kg) by intraperitoneal injection on days 2, 4, and 6 after hypoxia. We purchased ANA-12 from Sigma–Aldrich (St. Louis, USA), which was dissolved in DMSO (35 mg/ml) and then diluted with saline. Before hypoxia was induced, the rats were administered ANA-12 (0.5 mg/kg) by intraperitoneal injection.
We divided the rats into 4 groups: sham, hypoxia, NAS + hypoxia and ANA-12 + NAS + hypoxia.
1.4 Nissl staining
The sections were dewaxed, washed with distilled water, and then incubated with Nissl staining solution at room temperature for 10 min. Then, 95% and 100% ethanol were used to dehydrate the sections, which were then made transparent using xylene, placed under coverslips and analyzed by microscopy.
1.5 H&E staining
The rats were anesthetized and perfused with PBS. The brain tissues were rapidly removed and fixed with 4% paraformaldehyde at 4°C overnight. Then, the tissues were embedded in paraffin and sectioned into 4-µm-thick slices. Next, the sections were deparaffinized in xylene and rehydrated using graded alcohol solutions. Finally, the sections were stained with H&E, and pathological changes in the brain tissue were observed under a light microscope (400-fold magnification).
1.6 Western blot analysis
The treated tissues from each group were carefully aspirated, and 2 mL of PBS was added for repeated washes; the tissues were then lysed in lysis buffer on ice for 30 min. The sample was centrifuged at 12,000 × g at 4°C for 15 min, and the total protein was harvested. The proteins were separated by electrophoresis and transferred onto polyvinylidene difluoride membranes based on the different molecular weights of each protein at low temperature. The membranes were blocked with 5% nonfat dry milk in TBS at room temperature for 1 h and incubated with primary antibodies overnight at 4°C. Then, the membranes were incubated for 1 h at room temperature with a secondary antibody. The protein signals were detected by enhanced chemiluminescence. The signal bands were analyzed using a ChemiDoc XRS instrument and Image Lab Software. The relative expression was calculated as the ratio between the protein of interest and GAPDH in the same sample and are displayed graphically.
1.7 Real‑time quantitative polymerase chain reaction (qRT–PCR)
The PCR solution containing SYBR Green I was prepared on ice. The finished reaction solution was dispensed into the reaction plate and then sealed and centrifuged at high speed. The reaction plate was placed into the real-time PCR amplification instrument. All samples were analyzed in triplicate. The cycling program was as follows: Step 1, 95°C for 30 sec; Step 2, 40 cycles of 95°C for 3 sec, followed by 60°C for 30 sec. The amplification curve and the melting curve were confirmed after the reaction. Melting curve analysis was performed to confirm amplification specificity. Finally, the data were exported and copied, and the results were calculated and counted. Transcript levels of each mRNA was normalized to GAPDH and were calculated using the 2−∆∆CT method.
The following primers were used:
PTGS2 forward, CTCAGCCATGCAGCAAATCC;
reverse, GGGTGGGCTTCAGCAGTAAT;
GPX4, forward, TCTGAGCCGCTTATTGAAGCC;
reverse, CACACGCAACCCCTGTACTT;
TfR1, forward, CCGGCCTATATGCTTGGGTA; and
reverse, CAAGGGAGCACTCTGAAGCA.
1.8 Transmission electron microscopy (TEM)
Hippocampal tissue samples were cut into 2×2 mm pieces and quickly fixed in electron microscopy fixation solution at room temperature for 2 h. Then, the samples were dehydrated, embedded, and cut into ultrathin sections. The stained samples were then observed and imaged with a transmission electron microscope (JEOL, Japan).
Statistical analysis
Statistical analysis was performed using GraphPad Prism 8.0, and the data are expressed as the mean ± SD. The statistical significance of multiple comparisons was analyzed by one-way analysis of variance (ANOVA). SPSS 19.0 software was used to perform all statistical analyses. P < 0.05 was considered to be statistically significant.
2.1 Hypoxia induces hippocampal injury
The hypoxia rat model was established, and then the next experiments were performed (Fig. 1A). Nissl body staining of neurons showed that many granule cells and pyramidal cells were present in the hippocampus in the sham group, and no neuronal damage was observed. Following hypoxia-induced brain injury, there was a significant decrease in the number of neurons, as shown by Nissl staining, compared with that in the sham group (Fig. 1B).
2.2 Hypoxia induces hippocampal ferroptosis
qRT–PCR was used to determine whether hypoxia was involved in hippocampal ferroptosis, and we measured ferroptosis marker expression (GPX4, transferrin receptor 1 (TfR1) and prostaglandin-endoperoxide synthase 2 (PTGS2)). Compared with those in the sham group, GPX4 expression was significantly decreased and TfR1 and PTGS2 expression was increased in the hypoxia group (Fig. 2).
2.3 NAS protects the hippocampus against hypoxia-induced ferroptosis
We examined whether neuronal ferroptosis could be rescued by NAS. First, neuronal morphology in the hippocampus was observed by H&E staining. We found significantly worsened pathological injury in the hypoxia group compared with the sham group, but NAS attenuated neuronal damage. However, ANA-12 administration partly reversed the decrease in neuronal damage (Fig. 3A). Western blot analysis also revealed that the hypoxia group had significantly increased TfR1 expression and decreased GPX4 expression compared with those in the sham group. However, GPX4 expression was increased and TfR1 expression was decreased in the NAS group, and ANA-12 blocked the effect of NAS on the expression of these factors in the ANA-12 + NAS + hypoxia group (Fig. 3B). The expression of GPX4 and TfR1 was also measured by qRT–PCR, and the hypoxia group had significantly decreased GPX4 and increased TfR1 expression. However, GPX4 expression was increased and TfR1 expression was decreased in the NAS group, and the effect of NAS on the expression of these factors was blocked by ANA-12 (Fig. 3C). Furthermore, TEM showed that compared with that in the sham group and NAS + hypoxia group, mitochondrial atrophy in hippocampal neurons was significantly increased in the hypoxia group and ANA-12 + NAS + hypoxia group (Fig. 3D). In summary, these findings suggested that NAS rescued hypoxia-induced ferroptosis by inhibiting TfR1 expression and that ANA-12 eliminated this effect.
In this study, a hypoxia model was established in neonatal rats to examine whether NAS could ameliorate brain damage by inhibiting ferroptosis. First, we confirmed the successful establishment of a hypoxia-induced brain injury model in neonatal rats by Nissl staining. Then, we found that ferroptosis occurred in the hippocampus after hypoxia. Furthermore, NAS treatment decreased hypoxia-induced hippocampal ferroptosis, and ANA-12 blocked the NAS-mediated inhibition of ferroptosis. Our data demonstrated that NAS suppressed hypoxia-induced ferroptosis, thereby alleviating brain injury.
Hypoxic and HI damage in utero or at birth are the principal causes of neonatal morbidity and mortality[19]. The hippocampus plays important roles in the development of nerves and is highly sensitive to HI injury[20]. HI injury could result in hippocampal atrophy, which is associated with long-term impaired memory and learning, in human term newborns with neonatal encephalopathy[21, 22]. Additionally, there are decreased expression levels of early neuronal markers and late/mature neuronal markers due to HI injury in patients, suggesting the presence of impairments in neonatal stem cells (NSCs) to mature neurons during the development of normal neurons[23]. In recent years, numerous studies have shown that HI injury in neonatal animals is similar to the clinically manifestations in humans[24, 25]. In our neonatal hypoxia rat model, we observed injury in the hippocampus.
As a newly discovered mode of regulated cell death, ferroptosis is different from apoptosis, programmed necrosis, and autophagy. The accumulation of reactive oxygen species and iron-dependent lipid peroxidation result in ferroptosis[26]. Iron is an important trace element, which abnormal distribution and content of iron can affect the normal physiological processes[27]. Excess Fe2+ is oxidized to Fe3+ by ferroportin (FPN). This recycling of internal iron strictly controls iron homeostasis in cells. Silencing the gene encoding transferrin receptor 1 (TFR 1) can inhibit erastin induced ferroptosis[28]. Furthermore, Lipid metabolism is also closely related to ferroptosis. Polyunsaturated fatty acids (PUFAs) are one of the essential elements for ferroptosis and are sensitive to lipid peroxidation. Reducing the expression of Acyl-CoA synthetase long-chain family member 4 (ACSL4) and lysophosphatidylcholine acyltransferase 3 (LPCAT3) reduces the accumulation of lipid peroxide substrates in cells, thus inhibiting ferroptosis[29]. The most common features of ferroptosis are shrunken mitochondria, mitochondrial aberrations, rupture of the outer mitochondrial membrane and reduced cristae[30]. The density of the mitochondrial membrane also increases[31]. There is a central endogenous inhibitor of ferroptosis known as GPX4, and neurons prevent toxic lipid peroxidation by relying on GPX4[32]. A study showed that selective knockout of GPX4 resulted in rapid death and the loss of hippocampal neurons in adult mice. Cognitive impairment and hippocampal degeneration are caused by targeted knockout of the GPX4 gene in forebrain neurons[33]. Although ferroptosis is involved in various pathological conditions, such as neoplastic diseases, glutamate-induced neurotoxicity, neurodegenerative diseases, and ischemia/reperfusion injury, ferroptosis has rarely been examined in an in vivo epilepsy model. In the present study, qRT–PCR showed changes in GPX4, PTGS2 and TfR1 expression in the hippocampus of hypoxia-treated rats, confirming the involvement of ferroptosis in the pathological process of hypoxia-induced brain damage.
Despite many studies and advances in intensive care and neonatology, the only effective treatment available for hypoxia-ischemia is hypothermia[34]. As a naturally occurring chemical intermediate, NAS is generated from serotonin. Melatonin is converted from NAS and has neuroprotective effects against ischemic stroke and other neurological diseases[35–37]. NAS has many biological effects that are similar to those of melatonin, such as antioxidant, antiaging, antianxiety, and neuroprotective effects. However, there is evidence indicating that NAS may play unique roles in the CNS, and its robust antioxidant activity[38] and antioxidant capacity[18] may be unrelated to its conversion to melatonin. In addition, NAS acts as a potent TrkB receptor agonist[39]. ANA-12 is a low–molecular weight molecule and it can prevent TrkB activation and inhibit downstream processes with a high potency in a non-competitive manner with brain-derived neurotrophic factor (BDNF)[40]. And BDNF specifically binds to the tyrosine receptor kinase B (TrkB)[41]. However, the underlying mechanisms by which NAS can treat hypoxia-induced brain damage are largely unknown. In our study, we found that NAS attenuated hypoxia-induced ferroptosis. Further experiments showed that TrkB activity in the hippocampus was efficiently inhibited and that the protective effect of NAS was blocked by the administration of ANA-12 in rats. A possible neuroprotective mechanism of NAS may be related to inhibiting ferroptosis. In this study, we demonstrated that early brain injury could decrease the effect of NAS by attenuating neuronal ferroptosis in a hypoxia-induced brain damage rat model.
In conclusion, ferroptosis is involved in hippocampal impairment associated with hypoxia-induced brain damage. NAS attenuates ferroptosis in the brain following hypoxia-induced brain damage. To the best of our knowledge, this study is the first to report that NAS improves hypoxia-induced brain damage and inhibits ferroptosis in neonatal rats, which could be a potential therapeutic strategy.
Ethics approval
The animal study protocol was approved by the Ethics Committee of Qilu Hospital of Shandong University (protocol code: ECAESDUSM 2012029).
Consent to participate
Not applicable
Consent for publication
Not applicable
Availability of data and materials
The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request.
Competing interests
The authors have no relevant financial or non-financial interests to disclose.
Funding
This work was supported by the Shandong Provincial Natural Science Foundation of China (Grant No. ZR2015PH036), the China Scholarship Council (Grant No. 201706225023), and the China Postdoctoral Science Foundation (Grant No. 2021M691944).
Xiaomei Yang has received research support from the Shandong Provincial Natural Science Foundation of China, the China Scholarship Council and the China Postdoctoral Science Foundation.
Authors' contributions
All authors contributed to the study conception and design. Material preparation, Investigation, data collection and analysis were performed by Xiaomei Yang, Yue Yang, Feng Gao and Kangping Lu. Project Administration and Supervision was performed by Chunling Wang. The first draft of the manuscript was written by Chunling Wang and Yue Yang. All authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.
Acknowledgements
All authors collaborated tightly and made great efforts to the study.
This research was funded by the Shandong Provincial Natural Science Foundation of China (No. ZR2015PH036), the China Scholarship Council (No. 201706225023), and the China Postdoctoral Science Foundation (2021M691944).