Vitamin D binding protein gene polymorphism and its association with free serum bioavailability among tuberculosis patients and household contacts

doi:10.21203/rs.3.rs-1819336/v1

Download PDF

Article

Vitamin D binding protein gene polymorphism and its association with free serum bioavailability among tuberculosis patients and household contacts

https://doi.org/10.21203/rs.3.rs-1819336/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Genetic variants influence the distribution of vitamin D in circulation leading to vitamin D deficiency. This study aimed to determine the association between the DBP gene polymorphism with vitamin D bioavailability among active tuberculosis patients, latent Tuberculosis and with no Tuberculosis infection individuals. This was a cross-sectional study of 52 active tuberculosis patients, 23 latent tuberculosis individuals, and 27 with no tuberculosis infection. Sanger sequencing was performed and single nucleotide polymorphisms were identified using the BioEdit tool. Logistic regression was used to determine associations. Frequencies of 97% Gc1F, 2% Gc2 and 1% Gc1S genotypes were reported. The median (IQR) vitamin D levels of the predominant genotype, Gc1F were 3.8 (1.1-10.5) ng/ml, Gc1S individual, 2.2 ng/ml, and Gc2 individuals were 1.9 ng/ml. No significant association was found between vitamin D binding protein gene and free and bioavailable vitamin D levels, p=value 0.05. Spearman’s correlation revealed a negative association (r-0.0404) between the two. The Gc1F genotype was predominantly found in the study population with the minor alleles associated with active and latent TB states. However, the non-significant association observed between the vitamin D Binding Protein gene and the free and bioavailable vitamin D levels may be a consequence of the homogenous population.

The vitamin D binding protein (DBP), also known as the group-specific component (Gc), is one of the abundant and most important carrier proteins of 99% of vitamin D metabolites(1-4). DBP is part of the albumin family and is synthesized in the liver (5). It is assumed that this protein is responsible for the malfunction of vitamin D in the target cells as the bound-fraction has minimal effect on the cells (5, 6). Other functions of DBP are actin scavenging, macrophage activation, and fatty acid transportation (1).

The DBP gene located on 4q12-q13 is highly polymorphic, with over 120 variants (7)These genetic variants influence the distribution of vitamin D in circulation leading to vitamin D deficiency(3). The two extensively studied nonsynonymous DBP single nucleotide polymorphisms (SNPs) rs7041 and rs4588 are found in diverse populations (2). These variants are found on exon 11, and 7041 encodes for c.1296 T > G p.Asp416Glu, while rs4588 encodes for c.1307 C > A p.Thr420Lys (8). These SNPs are a result of the change in amino acids at the codons 416 Asp→Glu (ACG→AAG) and 420 Thr→Lys (GAT→GAG) (9). These two variants form three polymorphic isoforms, the Gc1F, Gc1S, and Gc2 and they are shown to vary in occurrence between different races (10). GC1F is the wild type of these SNPs, with Gc1S formed by a change from Gc1F, D416E, and Gc2 = a T420K also a change from the Gc1F variant(11). Gc1F and Gc1S variants are located on the rs7041 locus and Gc2 is found on the rs4588 locus (7). Individuals with the rs7041 G allele instead of the T allele and those with the rs4588 A allele instead of the C allele are said to have higher DBP levels with a high affinity for vitamin D leading to less bioavailable vitamin D levels.

Vitamin D deficiency has been found to play a prominent role in the susceptibility to tuberculosis, and vitamin D deficient individuals have a greater risk of being susceptible to developing TB(12). As a product of skin synthesis, vitamin D is produced a s result of exposure to the sun’s ultraviolet light which is then metabolized in the liver to form 25-hydroxyvitamin D(25(OH)D), the immunomodulatory metabolite formed as a result of this product (1,25-dihydroxycholecalciferol) in turn enhances the antimicrobial activity in the cell(13). As a result of their antimicrobial efficacy, vitamin D has been used to treat tuberculosis in the pre-antibiotic era.

In addition, several evidence points on the effects of vitamin D status on the response to M. tuberculosis are genotype-dependent and vitamin D receptor variants vary across geographical ranges(14). It is known that the wild-type Gc1F genotype is predominantly found in the African population, with a low frequency of Gc2 and Gc1S, and it is associated with low vitamin D levels in whites. Here, we, therefore, conducted a cross-sectional study to examine the association of the DBP gene polymorphism with the free and bioavailable vitamin D levels among TB patients, individuals with latent TB infection, and those without TB infection in Uganda.

Socio-demographic description of study participants

Of the 102 samples analysed, 52 were active TB patients 23 were LTBI and 27 were individuals with no TB infection. The median age of the study participants was 25 years and the majority,61 (59.8%) were female. The proportion of HIV-positive participants was 39 (38.2%) and of these only 11 were male, (28.2%). Details of the social demographic characteristics of the study participants are found in table 1.

Table 1: Baseline sociodemographic characteristics of study participants

Participant characteristic

Frequency n( %)

Median(IQR)

Age(years)

18 and below

19-30

31-40

Above 40

17(17)

49(48.0)

22(22)

14(14)

25 (12,65)

Sex

Female

Male

61(63)

42(37)

TB status

No TB infection

Latent TB infection

Active TB

27(26)

23(23)

52(51)

BCG scar

Yes

48(47)

54( 53)

Alcohol consumption

Yes

75(73.5)

27 (25.5)

Smoking

Yes

96(94.1)

6(5.8)

HIV status

Negative

Positive

63(62)

39(38)

n is number of participant IQR is interquartile range

Frequency distribution of the DBP rs7041 and rs4588 SNPs among active TB patients LTBI and those with no TB infection

The reference sequence that was retrieved from NCBI (Homo sapiens vitamin D-binding protein gene), for use was the Gc1S with the GAG codon at position 416. According to our search in BioEdit, all our sequences had the wild-type GAT codon at that position compared to the reference sequence. At position 420, all our samples had an ACG codon, except for only two samples that had a conversion to AAG. Ninety-seven percent of the study population had rs7041 GAT and ACG for rs4588 with 2% having GAT rs7041 and AAG rs4588 and 1% was rs7041 GAG and rs4588 ACG (Gc1S). Figures 1a- 1c show the details of this analysis and the conversions marked. The frequency distribution of GcF1 genotype was 97%, 2% Gc2 and 1% Gc1S genotypes. However, the two samples with the Gc2 genotype were HIV-positive TB patients. The Gc1S was an LTBI individual. Table 2 shows details of the genotype distribution of the study participants. The Hardy-Weinberg equilibrium analysis was in equilibrium, D'= 0.

Table 2: Genotype and allele distribution of the DBP gene among TB patients LTBI and those without TB infection

Genotype	rs7041	rs4588	Haplotypes	Cases/controls n/%
Gc1F	TT	AC	TC	99 (97%)
Gc1S	GG	AC	GC	1 (%)
Gc2	TG	AA	TA	2 (2%)

The frequency distribution of genotypes is represented as a percentage, where n is the number of participants and the percentage

Relatedness of the DBP reference gene sequence and study sequence data

A phylogenetic tree was constructed to determine the closeness of the sequences using the maximum likelihood method. The outcome of the phylogenetic tree revealed a close relatedness of the samples and reference genes as shown in Figure 2.

Association of the DBP gene polymorphism and free and bioavailable vitamin D levels among active TB patients LTBI and those with no TB infection

The free and bioavailable vitamin D levels were measured to determine the levels among the study groups and any relationship with the genotypes. The overall median (IQR) free vitamin D levels of the study population were 3.8 (1,1-10,5) ng/ml and the population predominantly had the Gc1F genotype. The median (IQR) of active TB patients were 1.3 (1.1, 8.4) ng/ml, LTBI 4.8(1.1,9.7) ng/ml and those with no TB infection 5.3 (1.4,10.4) ng/ml, p=< 0.05. The median free vitamin D levels of the Gc1S and Gc2 genotypes were 2.2 ng/ml and 1.9 ng/ml respectively. The Gc1S genotype was found in the LTBI participant while the Gc2 genotype was among the active TB patients. A logistic regression analysis was performed to determine the association between the DBP gene and free and bioavailable vitamin D levels, and a non significant association was observed (p-value 0.05), as shown in table 3. Spearman’s correlation was performed to determine any association of the DBP gene with free vitamin D and a negative association was found(r-0.0404).

Table 3: DBP genotype and serum free and bioavailable vitamin D levels among active TB patients LTBI and those with no TB infection

Genotype	Free and bioavailable vitamin D (ng/ml)	P value
Gc1F	3.8	0.05
Gc1S	2.2
Gc2	1.9

Vitamin levels in median p-value significant 0.05 CI = 95%

The DBP is highly polymorphic, with approximately120 variants. However, the rs7041and rs4588 SNPS leading to three variant genotypesGc1F, Gc1S and Gc2 have been predominant repo with diversity observed across different geographical locations and ethnicity. The widely documented reports have focused on multiracial populations and a paucity of information is revealed about homogenous populations(15). Extensive research in population genetics has reported the frequency of the Gc1F genotype to be predominantly found in black Africans and African Americans and Gc2 to be the lowest. The major finding of the current study shows a frequency distribution of 97% of the Gc1F genotype, 2% Gc2, and 1% of the Gc1S genotypes in the population.This finding is comparable to two West African studies in Gambia with a closely homogenous population to ours that reported a frequency distribution of the genotype to be 86.0 %, 83.3%, and another from South Africa with 80.0% (15-17). However, these studies had a larger sample size compared to the present study. Similarly, another study among black Americans and whites found a frequency distribution of 92.7% Gc1F genotype among blacks and 2.1% Gc2 and 2%. In contrast, the same study found a high frequency distribution of Gc1S in the whites(18). Furthermore, according to a study among the Euro-Asian population, the Gc1F genotype was the lowest (13.7%), and the highest was the Gc1S (19). Similarly, a study from Finland found a low frequency of Gc1F (3.7%) (20). The above observations demonstrate that the DBP polymorphisms are ethnic-based and therefore variable effects of vitamin D levels may be observed.

In the current study we did not perform analysis of the relationship between TB status and DBP gene polymorphism owing to the homogeneity of the population. However, we noted that the Gc2 genotype was found in active TB patients only. This finding is comparable to the South African earlier mentioned study that reported an association between the Gc2 genotype and TB status among Asians (17). Additionally, the only Gc1S genotype observed in the present study was an LTBI individual. Consequently, these findings indicate an association between the DBP gene polymorphism and TB status. Notable also was the significant difference that was found in vitamin D levels among the three study groups.

Regarding the studied genetic polymorphisms and free and bioavailable vitamin D levels, the Gc1F and Gc1S were associated with higher free and bioavailable vitamin D levels compared to the Gc2 which had the lowest. This finding may be closely similar to a recent study that found higher levels in the same genotypes compared to Gc2, nonetheless, they measured total vitamin D not free and bioavailable levels(16). A study from Finland after parameter adjustments found the Gc2 genotype to have the highest free and bioavailable vitamin D levels and the lowest in the Gc1F(20). This finding is contrary to the present study in which the Gc1F genotype had higher levels compared to the other genotypes. However, in the association analysis no statistically significant association was observed. This finding could be explained by the predominance of a single genotype due to a homogenous population. Previous studies have found an association between DBP genotypes and free and bioavailable vitamin D levels, while others have not found a variation. Similar to the present study, one from Saudi Arabia did not find an association between the DBP gene polymorphism and free and bioavailable vitamin D levels among postmenopausal women(21). However, another study from the same region reported that free and bioavailable vitamin D levels differed according to minor and major rs7041 and rs4588 alleles (22). In contrast, the study from Gambia among children across different countries of Africa found an association between the DBP gene polymorphism and total vitamin D levels (16).

The free hormone hypothesis stipulates that only the unbound or loosely bound to albumin fraction of vitamin D penetrates through the cell membrane and therefore is biologically important. In a study of healthy individuals, a better correlation was observed between bone mineral density and the free and bioavailable levels(23). According to the findings by Powe et al, the bioavailable vitamin D levels were not different between the black and white populations, however, reported that 9.9 % of variations in total vitamin D are caused by genetic polymorphisms (18). The GcIF genotype predominantly found in the present study is known to have low DBP levels and high affinity for total vitamin D levels consequently leading to low free and bioavailable vitamin D levels.

We acknowledge that the small sample size and homogenous population of the present study may have contributed to the predominant genotype obtained, especially with the knowledge that the Gc1F genotype is predominant in the black population. Therefore a larger sample size is required to increase the chances of detecting the minor alleles. However, based on previous studies the rs7041 and rs4588 SNPs have demonstrated associations with total vitamin D status, and inadequate information available on their relationship with the free and bioavailable vitamin D levels.

Therefore the strength of the study is based on the measurement of free and bioavailable vitamin D levels using a sensitive competitive ELISA method. This is the first study to perform an analysis of free vitamin D and DBP gene polymorphism in the African population. The inclusion of the active TB patients and household contacts gives an adequate representation of the TB status.

The DBP, Gc1F genotype was predominantly found in the study population, and the minor alleles observed were associated with active and LTBI TB states. Statistically low free vitamin D levels were observed among the TB patients compared to other TB states however due to the homogeneity of the study population, no statistically significant association was observed between the DBP gene polymorphism and the free and bioavailable vitamin D levels.

Further research is warranted in a heterogeneous population to detect adequate minor alleles and associate them with the free and bioavailable vitamin D levels to confirm our findings.

Ethical consideration

We sought approval of this study from Makerere University SBS HDREC (#SBS-637), Kiruddu Referral Hospital, and the National Council of Science and Technology (HS2639) to enroll active TB patients for the study. Written informed consent was obtained from the active TB patients for study participation. Waiver of consent was also obtained from Makerere University SBS HDREC (#SBS-637) to use the KTB study samples. Other details of the ethical approvals of the KTB study are documented elsewhere(24). All experimental protocols of the study were approved by Makerere University SBS HDREC (#SBS-637), and the National Council of Science and Technology (HS2639) as guided by the Helsinki declaration.

Sample size, study design, and study population

A total of 102 participant samples between the ages of 12-63 years were selected from a previous sub-study of 148 participants whose LL-37 levels had been estimated. Forty-six samples of these were excluded based on inadequate peripheral blood mononuclear cell (PBMCs) sample volume available for successful genotyping A purposive cross-sectional study was performed among active TB patients, LTBI, and those with no TB infection. Genexpert-positive TB patients from Kiruddu Referral Hospital were enrolled and then retrieved samples of household contacts from the Kampala TB (KTB) project. Both HIV⁺ and HIV^-individuals were included in the study.

Genotyping of the DBP gene

DNA was extracted from whole blood samples of active TB patients and PBMCs of LTBI and those with no TB infection, using the phenol-chloroform (PhCHCL₃) method customized by the MBN laboratories. Agarose gel electrophoresis of human genomic DNA was performed using a 1% agarose gel prepared by weighing and dissolving 1.5g of agarose in 150 ml of1x TAE (1% solution). Primers were purchased from Eurofins Genomics Inc., Germany. The primer sequences were forward 5^’ AAATAATGAGCAAATGAAAGAAGAC3^’ and reverse 5^’ CAATAACAGCAAAGAAATGAGTAGA3^’ withexpectedamplicons of about 483 bps. Mastermix preparation was performed from the pre-amplification room accordingly; 25 µl of 2X Taq Master Mix, 2.5 µl of the reverse primer (6 pM) and 2.5 µl of forward Primer (0.6 pM), and 15 µl of PCR water making a total of 45 µl for each reaction. Forty-five microliters of the master mix were added to each of the PCR tubes then 5 µl of DNA was added to each of the tubes. Five microliters of PCR water were added to the negative control tube.PCR tubes were transferred into the SimpliAmp Thermocycler for 40 cycles and the programmed conditions were as follows; Enzyme Activation step 5 minutes for 95°C then Denaturation for 20 seconds at 95°C, Annealing for 45 seconds at 56°C, Extension at for 10 seconds at 72°C, Final Extension for 5 ° C at 72°C and finally an Infinite hold at 4°C. The amplicons were run on a 2% agarose gel as previously described, and product size of 483 bp was obtained (Figures 3a and 3b). The PCR products were shipped under ambient conditions to the ACGTwheeling United States of America for Sanger sequencing using the forward primer. The DBP gene reference sequence (AH004448.2 Homo sapiens vitamin D-binding protein gene) was retrieved from the National Center for Biotechnology Information (NCBI) gene bank. The DBP raw data sequences were then aligned against the reference genome. Variant filtering was performed in which low read regions and errors were identified as well as checking coverage, quality scores, and proximity. The sites that differed from the reference genome and sequences were identified and sorted according to their nucleotide and amino acid compositions. The detection of the Presence of SNPs by searching for the possible change in the GAT codon to GAG searched at position 416 for rs7041 and ACG to AAG at position 420 for rs4588.

Estimation of free and bioavailable vitamin D levels

Samples were collected in red top vacutainer plain tubes and serum was harvested for analysis. The free and bioavailable vitamin D levels were measured using (abx570015) 25-Hydroxyvitamin D3 (Calcidiol) competitive ELISA kits, according to the manufacturer’s instructions. Spectrophotometry was performed and a curve of OD against concentration was plotted from which the unknown concentrations were interpolated. The reference range that was used for the study was between 1.92 – 8.82 ng/ml.

Statistical analysis

Data were summarized using STATA software (Stata Corp. STATA 12.0, College Station, Texas, USA). The frequencies of the DBP gene genotypes were determined using percentages. Medians and interquartile ranges were used to express vitamin D levels. Frequencies and percentages were used for the frequency distribution of the DBP gene. Logistic regression and Spearman’s correlation were used to determine associations. A potential deviation from Hardy Weinberg equilibrium was performed using the dnaSP software. The P-value was considered significant at< 0.05 and a 95% confidence interval (CI).

Data availability: The dataset that was generated and analyzed during the current study are available in the Genbank with accession, BankIt2605152: OP032652 - OP032748

Acknowledgements

This work has been funded by The Africa Center of Excellence in Materials, Product Development and Nanotechnology (MAPRONANO ACE) Makerere University. The KTB Household Cohort Study was supported by the Wellcome Trust through PhD Fellowship in Infection and Immunity held by Dr. Irene Andia Biraro, funded by a Wellcome Trust Strategic Award, grant number 084344, and by the European Community's Seventh Framework Programme (FP7/2007-2013) under EC-GA n° 241642 (the IDEA consortium).

Authors’ contributions

Conceptualization: E.L.A, Data curation: E. L. A, Formal analysis: E. L. A, A.A, R.B.S.N, A.O Methodology: E L A, A.A, R.B.S.N, A.O Provided KTB samples: I.A.B, Software: M .B, Supervision: W .W, D.P. K, I. A. B, M L. J, Writing – original draft: E. L. A. Writing – review & editing: E L A, D P K,W .W, M L. J, I .A. B, A.A

Additional information

Competing interest

The authors declare no competing interests

Speeckaert M, Huang G, Delanghe JR, Taes YE. Biological and clinical aspects of the vitamin D binding protein (Gc-globulin) and its polymorphism. Clinica chimica acta. 2006;372(1-2):33-42.
Santos BR, Lecke SB, Spritzer PM. Genetic variant in vitamin D-binding protein is associated with metabolic syndrome and lower 25-hydroxyvitamin D levels in polycystic ovary syndrome: A cross-sectional study. PloS one. 2017;12(3):e0173695.
Alhomsi B, Aboualchamat G, Alkadi I. Assessment of vitamin D-binding protein (DBP) gene polymorphisms and their correlation with multiple sclerosis: a case-control study in a sample of the Syrian population. Egyptian Journal of Medical Human Genetics. 2020;21(1):1-7.
Newton DA, Baatz JE, Kindy MS, Gattoni-Celli S, Shary JR, Hollis BW, et al. Vitamin D binding protein polymorphisms significantly impact vitamin D status in children. Pediatric research. 2019;86(5):662-9.
Rehan M, Aslam A, Umber J, Khan M, Azeem W, Aftab H, et al. Immunomodulatory role of vitamin D in infectious and non-infectious diseases. Hosts and Viruses. 2019;6(5):115-29.
Reis JP, Michos ED, Selvin E, Pankow JS, Lutsey PL. Race, vitamin D–binding protein gene polymorphisms, 25-hydroxyvitamin D, and incident diabetes: the Atherosclerosis Risk in Communities (ARIC) Study. The American journal of clinical nutrition. 2015;101(6):1232-40.
Bikle DD, Schwartz J. Vitamin D binding protein, total and free vitamin D levels in different physiological and pathophysiological conditions. Frontiers in endocrinology. 2019;10:317.
Romanko M, Rossokha Z, Maydan I, Mamenko M, Kvashnina L. ASSOCIATION BETWEEN VITAMIN D-BINDING PROTEIN (VDBP) GENE POLYMORPHISM AND VITAMIN D STATUS IN YOUNG CHILDREN. ScienceRise. 2020(6):51-8.
Kurylowicz A, Ramos-Lopez E, Bednarczuk T, Badenhoop K. Vitamin D-binding protein (DBP) gene polymorphism is associated with Graves' disease and the vitamin D status in a Polish population study. Experimental and clinical endocrinology & diabetes. 2006;114(06):329-35.
Nielson CM, Jones KS, Chun RF, Jacobs JM, Wang Y, Hewison M, et al. Free 25-hydroxyvitamin D: impact of vitamin D binding protein assays on racial-genotypic associations. The Journal of Clinical Endocrinology & Metabolism. 2016;101(5):2226-34.
Chun RF, Peercy BE, Orwoll ES, Nielson CM, Adams JS, Hewison M. Vitamin D and DBP: the free hormone hypothesis revisited. The Journal of steroid biochemistry and molecular biology. 2014;144:132-7.
Talat N, Perry S, Parsonnet J, Dawood G, Hussain R. Vitamin D Deficiency and Tuberculosis Progression. Emerg Infect Dis 2010 16(5): 853–5.
Zhang R, Naughton DP. Vitamin D in health and disease: Current perspectives. Nutrition Journal. 2010;9(1):65.
Meyer V, Saccone DS, Tugizimana F, Asani FF, Jeffery TJ, Bornman L. Methylation of the Vitamin D Receptor (VDR) Gene, Together with Genetic Variation, Race, and Environment Influence the Signaling Efficacy of the Toll-Like Receptor 2/1-VDR Pathway. Frontiers in Immunology. 2017;8.
Braithwaite VS, Jones KS, Schoenmakers., Silver M, Prentice A, Hennig BJ. Vitamin D binding protein genotype is associated with plasma 25OHD concentration in West African children. Bone 2015 74:166–70.
Mogire RM, Morovat A, Muriuki JM, Mentzer AJ, Webb EL, Kimita W, et al. Prevalence and predictors of vitamin D deficiency in young African children. BMC medicine. 2021;19(1):115.
Martineau AR, Leandro AC, Anderson ST, Newton SM, Wilkinson KA, Nicol MP, et al. Association between Gc genotype and susceptibility to TB is dependent on vitamin D status. Eur Respir J. 2010;35(5):1106-12.
Powe CE, Evans MK, Wenger J, Zonderman AB, Berg AH, Nalls M, et al. Vitamin D–Binding Protein and Vitamin D Status of Black Americans and White Americans. N Engl J Med. 2013;369:1991-2000.
Nizamutdinov I, Popov Y, Ilinsky V, Rakitko A. Allele frequency distribution of SNPs associated with levels of Vitamin D-binding protein and 25-hydroxyvitamin D. bioRxiv. 2019:564229.
Saarnio E, Pekkinen M, Itkonen ST, Kemi V, Karp H, Kärkkäinen M, et al. Serum parathyroid hormone is related to genetic variation in vitamin D binding protein with respect to total, free, and bioavailable 25-hydroxyvitamin D in middle-aged Caucasians–a cross-sectional study. BMC Nutrition. 2016;2(1):1-9.
Alharazy S, Naseer MI, Alissa E, Robertson MD, Lanham-New S, Alqahtani MH, et al. Association of SNPs in GC and CYP2R1 with total and directly measured free 25-hydroxyvitamin D in multi-ethnic postmenopausal women in Saudi Arabia. Saudi Journal of Biological Sciences. 2021.
Al-Daghri NM, Mohammed AK, Bukhari I, Rikli M, Abdi S, Ansari MGA, et al. Efficacy of vitamin D supplementation according to vitamin D-binding protein polymorphisms. Nutrition (Burbank, Los Angeles County, Calif). 2019;63:148-54.
Powe CE, Ricciardi C, Berg AH, Erdenesanaa D, Collerone G, Ankers E, et al. Vitamin D-binding protein modifies the vitamin D-bone mineral density relationship. J Bone Miner Res. 2011;26(7):1609-16.
Biraro IA, Moses E, Simon K, Steven GS, Frederic T, Jonathan L, et al. Effect of isoniazid preventive therapy on immune responses to mycobacteriumtuberculosis: an open label randomised, controlled, exploratory study BMC Infectious Diseases. 2015 15:438.

No competing interests reported.

SupplimentaryDatasetFile.xlsx

Download PDF

Version 1

posted

You are reading this latest preprint version

Vitamin D binding protein gene polymorphism and its association with free serum bioavailability among tuberculosis patients and household contacts

Status:

Version 1

Abstract

Figures

Introduction

Results

Socio-demographic description of study participants

n is number of participant IQR is interquartile range

Frequency distribution of the DBP rs7041 and rs4588 SNPs among active TB patients LTBI and those with no TB infection

Relatedness of the DBP reference gene sequence and study sequence data

Discussion

Conclusion

Methods

Statistical analysis

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1