Curcumin ameliorates LPS/D-GalN induced acute liver injury by regulating TLR4/NF-кB/NLRP3 signaling pathway in vivo and in vitro

doi:10.21203/rs.3.rs-1819677/v1

Download PDF

Research Article

Curcumin ameliorates LPS/D-GalN induced acute liver injury by regulating TLR4/NF-кB/NLRP3 signaling pathway in vivo and in vitro

https://doi.org/10.21203/rs.3.rs-1819677/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: NLRP3 inflammasome activation results in liver inflammation and injury. Curcumin, a polyphenol from Curcumin longa, exhibits anti-inflammatory properties. The effects and anti-inflammatory mechanisms of curcumin were explored on acute liver injury induced by LPS/D-GalN.

Methods and Results: An in vitro acute liver injury model was established on L-02 cells by treatment with10 μg/mL lipopolysaccharide (LPS); An in vivo model was established on SD rats by intraperitoneal injection of 0.02 mg/kg LPS and 500 mg/kg D-galactosamine (D-GalN). Biochemical index detection, histopathology, Western blotting, and qPCR were used to explore the effects and anti-inflammatory mechanisms of curcumin on acute liver injury induced by LPS/D-GalN in vitro and in vivo. Our results showed that curcumin significantly reduced the damage of L-02 cells induced by LPS, reduced the levels of transminase, inhibited oxidative stress induced by LPS in rats, and alleviated liver pathological injury. These effects accompanied by the downregulation of the expression of TLR4, NF-кB, and pyrotosis related proteins NLRP3 and caspase 1.

Conclusions: Curcumin ameliorated acute liver injury induced by LPS and D-GalN in L-02 cells and SD rats by inhibiting TLR4/NF-кB/NLRP3 pathway.

Curcumin

Acute liver injury

Lipopolysaccharide

D-galactosamine

Inflammation

Oxidative stress

TLR4/NF-κB/NLRP3 pathway

Liver harms are regularly accompanied by solid inflammatory reactions, and liver cell death caused by inflammation is a key factor to the progression of liver disease^[1]. Hepatocyte apoptosis, necrosis, necrotic apoptosis, and autophagy are indicators of liver pathogenesis. The interactions between Bax and Bcl-2 drive the discharge of apoptotic factor cytochrome C from mitochondria and cytochrome C binds to pro-Caspase 9 to form apoptotic bodies which actuateed Caspase 3, thus initiating the death of hepatocytes^[2]. Toll-like receptors (TLRs), as one of the PRRs, recognize and produce receptor-interacting protein kinase 1 (RIPK1). RIPK1 polyubiquitination advances the actuation of the NF-κB pathway^[3]. After NLRP3 is actuated by TLRs, it activates the gathering of NLRP3-inflammasome which causes discharge of IL-1β, IL-8 and hepatocyte pyroptosis^[4]. In a classical pyroptosis process, activated caspase-1 converts GSDMD protein to GSDMD-n by releasing PAMP or DAMP to activate PRR pattern recognition at sites of infection or tissue injury^[5]; In a non-classical pyroptosis process, LPS and PAMP directly stimulate caspase 4, caspase 5, and caspase 11 to activate GSDMD and caused hepatocyte death^[6].

Currently, CCl4, alcohol, high-fat diet, paracetamol, LPS, and D-GalN are commonly used agents to modulate acute liver damage^[7–9]. LPS and D-GalN effectively kill hepatocytes, seriously impairing physiological liver function^[10] and producing a stable and reproducible pattern of liver injury. The hepatoprotective effects of natural products such as schisandra polysaccharide, emodin, diterpenoid fenugreek lactone, and quercetin have been extensively studied^{[11, 12]}. As one of the active ingredients from Curcuma longa L., curcumin was a lipophilic polyphenol acting on a variety of receptors. The pharmacological activity of curcumin has attracted wide attention^[13].50 mg/kg curcumin activated the Nrf2/HO-1 signaling pathway and attenuated oxidative stress^[14]. The generation and activation of myofibroblasts was the key to liver fibrosis. Curcumin (100, 200, 400 mg/kg) inhibited hepatocyte epithelial-mesenchymal transition by activating PPAR-ɑ and suppressed the activity of hepatocytes by activating oxygen levels^[15]. Curcumin (100 mg/kg) inhibited nonalcoholic fatty liver disease in mice by decreasing translocation of HMGB1 in cytoplasm and the expression of TLR4, thus weakening atomic translocation of NF-κB^[16]. After actuating the Nrf2 pathway, curcumin (50, 100 mg/kg) reduced oxaliplatin-induced liver harm, oxidative stress, and inflammation in mouse liver^[17]. Curcumin also had great anti-inflammatory function in vitro and in vivo. It down-regulated the TLR4/NF-κB pathway, decreased the expression of iNOS and IL-1β, expanded IL-4, IL-10 and CD206, and inhibited LPS-induced microglial neuroinflammation^[18]. In addition, curcumin repressed NLRP3 inflammasome, restrained the expression of IL-1β, IL-6 and MCP-1, and subsequently reduced dextran sulfate-induced colitis^[19].

Various studies had suggested various anti-inflammatory mechanisms of curcumin, including the down-regulation of TLR4/NF-κB pathway and the inhibition of NLRP3 inflammasome formation^{[20, 21]}. But it is not clear whether curcumin regulates TLR4/NF-кB/NLRP3-related inflammatory pathways in alleviating liver injury caused by LPS and D-GalN. In this study, inflammatory models of liver injury were established using LPS and D-GalN in vitro and in vivo, and the mechanisms of curcumin in the anti-inflammatory treatment of liver injury were explored. Our findings will provide theoretical and experimental basis for the anti-inflammatory treatment of liver diseases with curcumin.

Cell viability

L-02 cells was developed at 37℃ with 4% CO2 in DMEM high glucose medium containing 10 KU/mL penicillin and 10 mg/mL streptomycin. Cytotoxicity test with MTT (Saiguo Bio-Technology Co., Ltd., Guangzhou, China) was utilized to decide the impact of curcumin on the viability of L-02 cells. L-02 cells (6×10³ /well) were incubated in a 96-well plate with curcumin (2.5, 5, 10 µM) for 1 h. The plate was replenished with medium with or without LPS (10 µg/mL). For positive control group, the cells were treated with dexamethasone (16 µM) and LPS (10 µg/mL). The absorbance was measured at 490 nm with a microplate spectrophotometer (Dawn, Tecan, Switzerland). Cell viability was calculated with Eq. (1). The tests were repeated three times.

Cell viability (%) = [OD490 (Treatment)/OD490 (Control)] ×100 (1)

Analysis of ALT, AST and LDH in cell supernatant

Cell culture and treatment was the same as the above. The concentrations of ALT, AST, and LDH in cell supernatant were measured according to instructions.

Animals and treatment

This experiment was approved by the Animal Care and Protection Committee of Wuhan Polytechnic University in November 2021 (No. WPU202111005). Male SD rats (180 ~ 220 g, SCXK (E) 2020-0018) were provided by the Experimental Animal Center of Hubei Provincial Center for Disease Control and Prevention (Wuhan, China). The rats were raised in standard cages, within stable temperature and humidity. This experiment was carried out in compliance with the P. R. China Legislation for the Use and Care of Laboratory Animals.

Rats were randomly divided into 6 groups (n = 8): control group, model group, curcumin treatment groups, and positive group. After adaptive feeding, the rats in the curcumin treatment groups were given 50, 100 and 200 mg/kg curcumin respectively and the positive group was given 150 mg/kg bifendate by gavage for 10 consecutive days. Two hours after last administration, rats were intraperitoneally injected with 0.02 mg/kg LPS and 500 mg/Kg D-GalN. 16 hours fasting and water deprivation preceded modeling.

Analysis of ALT and AST in sera

Blood was taken from rat eyeballs 6 h after modeling. It was centrifuged at 5000 rpm for 10 min at 4 ℃ after standing overnight, and supernatant was taken for analysis. The activities of ALT and AST in sera were measured according to instructions

Analysis of oxidative stress in livers

Liver tissue of rats was fully homogenized to make a10% (v/w) homogenate, and the homogenate was centrifuged at 3500 rpm for 10 min at 4℃. The contents of MDA, SOD, CAT, and GSH-Px in supernatant were measured according to the instructions.

Hematoxylin and eosin staining

The slices of liver were stained with hematoxylin and eosin (H&E), rehydrated, transparentized with xylene, and sealed with resin. Each slice was observed under optical microscope (CKX41-A32PH, Olympus Corporation, Japan) and images were collected for analysis.

Quantitative Real-time PCR

Total RNA from liver tissue was extracted with RNAiso kit. After the genomic DNA was removed according to the instruction of the kit, total RNA was reverse transcribed to obtain cDNA. A PCR reaction system was configured using TB Green Premix Ex Taq as a fluorescent dye. Forward and reverse primers used were constructed with the following sequences: TLR4, CCGCTCTGGCATCATCTTCA (forward), TCCCACTCGAGGTAGGTGTT (reverse), NLRP3, GCATGCCGTATCTGGTTGTG (forward), AGCTGAGCAAGCTAAAGGCT (reverse), Caspase 1, GAACAAAGAAGGTGGCGCAT (forward), AGACGTGTACGAGTGGGTGT (reverse), IL-1β, CCTATGTCTTGCCCGTGGAG (forward), CACACACTAGCAGGTCGTCA (reverse), and GAPDH, TCTCTGCTCCTCCCTGTTCTA (forward), ATCCGTTCACACCGACCTTC (reverse). Amplification reactions were performed using Bio-Radar CFX96 fluorescence quantitative PCR. With GAPDH as internal reference, the blank group was normalized, and the level of mRNA in each group relative to the blank group was calculated by 2^{−"∆∆"CT} method.

Western blot

Protein in cells and liver were extracted and protein concentrations were determined by BCA method (P0010S, Beyotime Biotechnology Co., Shanghai, China). Proteins in each group were separated by 10% SDS-PAGE. After proteins were transferred to a PVDF membrane (at current of 200mA, 1.5 h), and the membrane was incubated with QuickBlock blocking buffer with shaking for 25 min. The PVDF membrane was incubated with the following antibodies at 4℃ in a shaker overnight: β-actin, TLR4, NF-κB p65, NLRP3, ASC, Caspase 1, IL-1β, IL-18, Caspase 3, BAX, and BCL2, followed by secondary antibody incubation. Western blot image was obtained with a gel imaging analysis system (ChemiDocTMXRS+, BIO-RAD, USA). The gray values of the proteins were analyzed by Image J software, and relative protein expression levels were calculated based on β-actin gray value.

Statistical analysis

All analyses were carried out by GraphPad Prism 6.0, and data were expressed as mean ± SD. Independent sample t-test was used to assess the differences between two groups, and statistical significance was specified by p < 0.05.

Curcumin mitigated the LPS-induced L-02 cells damage

Treatment with LPS (10 µg/mL) significantly decreased the viability of L-02 cells (p < 0.05), and curcumin groups (2.5, 5, 10 µM) significantly increased the viability of L-02 cells compared with model group (p < 0.01) in a dose-dependent manner (Fig. 1A). Compared with control group, AST and ALT activities of L-02 cells in the model group increased (p < 0.05) due to LPS exposure (Fig. 1B and C). Curcumin (5, 10 µM) treatments significantly decreased the activities of AST and ALT in L-02 cells compared with model group (p < 0.05). Curcumin (5, 10 µM) significantly inhibited the activity of LDH induced by LPS in L-02 cells (p < 0.05). LDH is an intracellular enzyme involved in glycolysis. It is released into the circulation after cell membrane injury and the increased LDH level indicates cell inflammatory injury ^[16]. The above data indicated that a model of acute liver injury was established successfully and curcumin could effectively mitigate the L-02 cells damage induced by LPS.

Curcumin suppressed TLR4/NF-кB/NLRP3 signal pathway triggered by LPS in L-02 cell

After incubating with LPS (10 µg/mL), the expressions of TLR4, P65, NLRP3, caspase 1, IL-1β, and IL-18 significantly increased (Fig. 2A-E), which indicated that LPS activated the TLR4/NF-кB pathway, promoted the production of NLRP3, stimulated inflammatory responses, and caused L-02 cell damage. In addition, the protein expression levels of BAX/BCL2 and caspase 3 (Fig. 2F and G) in the model group obviously increased, suggesting that LPS also lead to hepatocyte apoptosis. Dexamethasone inhibited the protein expression levels of TLR4, P65, NLRP3, caspase 1, IL-1β, and IL-18, and it down-regulated protein expression levels of BAX/BCL2 and caspase 3. Similarly, the protein expression levels of TLR4, P65, NLRP3, caspase 1, IL-1β, and IL-18 of curcumin treatment groups (5, 10 µM) were obviously inhibited compared to those of the model group. At the same time, curcumin also significantly down-regulated protein expression levels of BAX/BCL2 and caspase 3. These results suggested that curcumin could reduce the inflammation and apoptosis of L-02 cells by inhibiting the activation of TLR4/NF-кB/NLRP3 pathway.

Effect of curcumin on LPS/D-GalN-induced liver injury in rats

To examine the effects of curcumin on LPS/D-GalN-induced liver injury in rats, serum enzymes of liver function and oxidative stress were measured. The activities of ALT and AST in the model group were significantly higher than in the control group (p < 0.01) (Fig. 3A and B). With the treatment of curcumin or bifendate, these biomarkers activities obviously decreased compared to the model group (p < 0.05 or 0.01). The model group also showed higher level of MDA but lower levels of SOD, CAT, and GSH-Px (p < 0.05 or 0.01) (Fig. 3C-F). After treated with curcumin or bifendate, the levels of SOD and CAT significantly increased while the level of MDA significantly decreased (p < 0.05 or 0.01). These results suggested that curcumin could effectively improve the oxidative stress induced by LPS/D-GalN in rat liver.

Protective effect of curcumin on pathological injury of liver in rats

The effects of curcumin on pathological changes in rats were studied by hematoxylin and eosin (H&E) staining (Fig. 4). Normal rat liver tissue in control group showed clear boundary, complete cell edge, and normal cell nucleus. Instead, liver tissue in model group induced by LPS/D-GalN showed severe dilation and congestion of portal vein, disordered hepatic cords, and dissolved cell nuclei. The treatment with curcumin however reduced necrotic foci, the structural disorder of hepatic lobules, the vacuolization of hepatocytes, and the congestion phenomenon, and restored hepatic cords. The protective effect of curcumin on the liver appeared to be dose-dependent. Similarly, The treatment with curcumin basically restored hepatic lobules and hepatic cords to normal structure, reduced the vacuolization of hepatocytes, and decreased congestion phenomenon, but with some inflammatory cells infiltrated.

Arrows indicate an infiltration of inflammatory cells in liver tissue.

Effect of curcumin on TLR4/NF-кB/NLRP3 signal pathway in the liver of rats

The model group showed significantly increased levels of TLR4, NLRP3, caspase 1 and IL-1β mRNA (Fig. 5A) (p < 0.05 or 0.01), indicating that LPS/D-GalN activated the TLR4 pathway and NLRP3 inflammasomes. The administration of curcumin obviously decreased the levels of TLR4, NLRP3, caspase 1 and IL-1β mRNA (p < 0.05 or 0.01), and the treatment of bifendate also decreased the levels of TLR4, NLRP3 and IL-1β mRNA (p < 0.01).

The protein expression of TLR4, P65, NLRP3, ASC, caspase 1, IL-1β, and IL-18 by Western blot significantly increased in model group (p < 0.01) (Fig. 5B-C), which indicated that LPS/D-GalN activated the TLR4/NF-кB pathway, promoted the production of NLRP3 inflammasome, stimulated the inflammatory response, and caused liver damage. In addition, model group also showed higher protein expression levels of BAX/BCL2 and caspase 3 (Fig. 5D) (p < 0.01), indicating that LPS/D-GalN also led to hepatocyte apoptosis. The treatment with curcumin significantly decreased the protein expression levels of TLR4, P65, NLRP3, ASC, caspase 1, IL-1β, and IL-18 (p < 0.01 or 0.05) (Fig. 5B-C), and down-regulated protein expression levels of BAX/BCL2 and caspase 3 as well. The treatment with Bifendate had a similar effect on the expressions of those proteins. These results suggested that curcumin could alleviate LPS/D-GalN-induced liver inflammation and apoptosis by down-regulating TLR4/NF-кB/NLRP3 pathway, thus alleviating liver pathological injury.

The inflammatory responses in liver disease, related to the activation of TLR4/NF-κB signaling pathway, were inextricably linked to NLRPS inflammasome^{[22, 23]}. In this study, LPS and D-GalN were used to induce the acute liver injury, and this model was used to evaluate the effects of curcumin on oxidative stress, inflammation and apoptosis. Curcumin was found to down-regulate the TLR4/NF-κB/NLRP3 signaling pathway, thus inhibiting liver inflammation. Our findings provided a new direction to treat liver damage using curcumin. Acute liver injury models were successfully established both in vivo and in vitro. AST and ALT, two liver biomarker enzymes, increased after the treatment of LPS with or without D-GalN in vivo and in vitro. Treatment with LPS increased the levels of AST, ALT and LDH in L-02 cells, up-regulated the expression of TLR4, NF-кB, NLRP3 and caspase 1 in L-02 cell and rat liver, with liver tissues obviously damaged due to inflammatory infiltration. Acute liver injury induced by LPS/D-GalN was therefore illustrated via modulating TLR4/NF-кB/NLRP3 signaling pathway in vivo and in vitro.

LPS, an inducer of inflammatory responses, was recognized by Toll-like receptors on cell membranes via a pathogen-associated molecular pattern^[24]. D-GalN led to hepatocyte death by interfering with the metabolism of uridine phosphate in hepatocytes, resulting in the depletion of uridine triphosphate (UTP), thereby preventing the cyclization of uridines; meanwhile, concurrent Ca²⁺ influx inhibited mitochondrial function and accelerated the production of free radicals, resulting in liver injury^[25]. The synergistic effect of LPS and D-GalN could lead to the death of liver cells in a short period of time, thus seriously impairing the physiological function of liver^[26]. LPS or other TLR agonists induced the expression of NLRP3 and Il-1β through the NF-κB pathway and up-regulate the expression of related inflammatory cytokines IL-1β and IL-18^[27]. Excessive inflammatory responses led to hepatocyte death and DAMP released from damaged hepatocytes activated the innate immune system, which further promoted the inflammatory response, ultimately resulting in liver fibrosis or liver cancer^[28]. While innate and adaptive immunity were normally activated, recruited immune cells, persistent inflammatory stimuli or immune dysregulation led to autoimmunity, cirrhosis, or tumor growth^[29].

LPS induced pyroptosis in the liver of mice and primary hepatocytes, as evidenced by caspase-11 activation and generation of GSDMD^[30]. LPS stimulated TLR4 to activate NF-κB signaling to promote pyroptosis^[31]. As a protein complex, NF-κB regulated the transcription of various genes and participated in the regulation of cellular free radicals and cytokines^[32]. Pyroptosis was activated by intracellular and extracellular stimuli, such as bacteria, viruses, toxins, and chemotherapeutic drugs, and caused inflammation. Pyroptosis, like apoptosis, have the characteristics of DNA damage, nuclear condensation, and caspase-dependence. Their difference was that pyroptotic cells swell with bubble-like processes appearing on the membrane surface before cell membrane ruptured^[33]. Pyroptosis is a kind of programmed cell death with a classical pathway mainly involved inflammasome. NLRP3 and ASC activated caspase 1 which cleaved GSDMD and led to cell apoptosis, while releasing inflammatory factors IL-1β and IL-18^[34]. As shown in Fig. 5, LPS stimulated TLR4 to activate NF-κB signaling, leading to the overproduction of ROS and cytokines which in turn activated the NLRP3 inflammasome and led to pyroptosis in liver injury. In this study, the protein expressions of TLR4, p65, NLRP3, caspase 1, IL-1β, and IL-18 were significantly up-regulated after the treatment of LPS with or without D-GalN, which meant that LPS and D-GalN induced the activation of TLR4/NF-кB/NLRP3 signaling pathway and promoted the production of inflammatory factors IL-1β and IL-18 in vivo and in vitro.

The hepatoprotective effects of curcumin have been extensively studied. Curcumin (100 mg/kg) significantly reduced the translocation of HMGB1 and the expression of TLR4 protein in the liver of non-alcoholic steatohepatitis mice^[16]. Curcumin (20, 40, 80 mg/kg) attenuated LPS-induced PI3K/AKT signaling in acute liver injury of mice with endotoxemia^[35]. The hepatoprotective mechanisms of curcumin included inhibition of cytokines, lipid peroxides, and PI3K/Akt, and improvement of the expression of Nrf2, SOD, CAT, GSH, and GSH-Px^[36]. It had been confirmed that TLR4 induced the expression of inflammation-related genes, and activated various transcription factors including NF-κB through TLR4 signaling pathway which was the key to regulate the inflammatory response^[37]. Studies have found that curcumin regulated the TLR4/NF-κB signaling pathway in various models. In the obstructive nephropathy model, curcumin (50 mg/kg) by gavage inhibited the renal inflammatory response via suppressing TLR4/NF-κB signaling pathway^[38]. Oral administration of curcumin (100 mg/kg) effectively reduced the expression of HMGB1 and the protein levels of TLR4 and NF-κB in the hippocampus of transgenic mice, thereby improving the memory deficit of transgenic mice^[39]. Intraperitoneal injection of 100 mg/kg curcumin in rats down-regulated the expression of TLR4 and NF-κB, and inhibited the production of inflammatory cells, thereby improving hindlimb motor defects and spinal cord edema caused by spinal cord injury in rats^[40]. Curcumin (200 mg/kg) significantly decreased the expression of MyD88, NF-кB, TNF-ɑ, IL-1β, and IL-6, and reduced monosodium iodoacetate induced arthritis in rats^[41]. Intragastric administration of curcumin (20, 50 mg/kg) activated the SIRT1/NRF pathway and inhibited the TLR4 pathway in rats to improve LPS-induced necrotizing colitis and apoptosis^[42]. Curcumin (80 mg/kg) down-regulated TLR4 and AP-1 in rat heart tissue and reduced the phosphorylation levels of p38 MAPK, JNK, and ERK1/2 to alleviate oxidative damage and inflammatory response in rat heart^[42]. In the rat gouty arthritis model induced by sodium urate (MSU), MSU activated NF-κB signaling pathway and upregulated NLRP3 and caspase 1 to induce the inflammatory factors IL-1β and TNF-ɑ, which could be reversed by curcumin^[43]. Chen et al. explored the therapeutic effect of curcumin on nephropathy induced by contrast agent, and found that curcumin decreased neutrophil gelatinase-associated apolipoprotein (NGAL) in rats. At the same time, the expression of TXNIP, NLRP3, FOXO3, and IL-1β was reduced, thus reducing the renal injury and inflammatory reaction caused by contrast media in rats^[44]. The above literature showed that curcumin had anti-inflammatory and anti-apoptosis effects by regulating TLR4/NF-κB and NLRP3 pathways.

In this study, curcumin was demonstrated to alleviate acute liver injury in vivo and in vitro, reduce the level of serum transaminase, inhibit the level of LDH, NO and MDA, increase the level of SOD, and alleviate liver pathological injury. These effects were accompanied by the down-regulation of the expression of TLR4, NF-кB, and pyrosis related proteins NLRP3 and caspase 1. The effects of curcumin on GSDMD protein in the process of cell pyrosis however need further study. These results suggested that curcumin inhibit the production of inflammatory cytokines IL-1β and IL-18 by inhibiting TLR4/NF-кB/NLRP3 signaling pathway, and reduce the apoptosis of hepatocytes induced by LPS/D-GalN, thus playing a protective role in the liver. Curcumin could be a promising protective hepatoprotective agent.

Declarations of Competing Interest

The authors declare no conflicts of interest in this work.

Acknowledgement

we are grateful for Dr. Cheng Fang, a professor, at School of Medicine and Health, Wuhan Polytechnic University, Wuhan, China for his help on the animal experiments.

Author contributions

Ying Gui wrote the manuscript. Ying Gui and Yunchao Zhao conceived and designed research. All authors conducted experiments and analyzed data. All authors read and approved the manuscript.

Shan Z, Ju C. Hepatic macrophages in liver injury [J]. Front Immunol, 2020, 11(322.
Shojaie L, Iorga A, Dara L. Cell death in liver diseases: A review [J]. Int J Mol Sci, 2020, 21(24):
Ashkenazi A, Salvesen G. Regulated cell death: Signaling and mechanisms [J]. Annu Rev Cell Dev Biol, 2014, 30(337-356.
He W-T, Wan H, Hu L, et al. Gasdermin d is an executor of pyroptosis and required for interleukin-1β secretion [J]. Cell Res, 2015, 25(12): 1285-1298.
Oh S, Son M, Park C-H, et al. The reducing effects of pyrogallol-phloroglucinol-6,6-bieckol on high-fat diet-induced pyroptosis in endothelial and vascular smooth muscle cells of mice aortas [J]. Mar Drugs, 2020, 18(12):
Kelley N, Jeltema D, Duan Y, et al. The nlrp3 inflammasome: An overview of mechanisms of activation and regulation [J]. Int J Mol Sci, 2019, 20(13):
Hassan H M, Al-Wahaibi L H, Elmorsy M A, et al. Suppression of cisplatin-induced hepatic injury in rats through alarmin high-mobility group box-1 pathway by : Theoretical and experimental study [J]. Drug Des Devel Ther, 2020, 14(2335-2353.
Dai C, Li H, Wang Y, et al. Inhibition of oxidative stress and alox12 and nf-κb pathways contribute to the protective effect of baicalein on carbon tetrachloride-induced acute liver injury [J]. Antioxidants (Basel), 2021, 10(6):
Foulds C E, Treviño L S, York B, et al. Endocrine-disrupting chemicals and fatty liver disease [J]. Nat Rev Endocrinol, 2017, 13(8): 445-457.
Xu Q, Xu J, Zhang K, et al. Study on the protective effect and mechanism of dicliptera chinensis (l.) juss (acanthaceae) polysaccharide on immune liver injury induced by lps [J]. Biomed Pharmacother, 2021, 134(111159.
Xie R, Liu M, Li S. Emodin weakens liver inflammatory injury triggered by lipopolysaccharide through elevating microrna-145 in vitro and in vivo [J]. Artif Cells Nanomed Biotechnol, 2019, 47(1): 1877-1887.
Utaipan T, Suksamrarn A, Kaemchantuek P, et al. Diterpenoid trigonoreidon b isolated from trigonostemon reidioides alleviates inflammation in models of lps-stimulated murine macrophages and inflammatory liver injury in mice [J]. Biomed Pharmacother, 2018, 101(961-971.
Hassanzadeh K, Buccarello L, Dragotto J, et al. Obstacles against the marketing of curcumin as a drug [J]. Int J Mol Sci, 2020, 21(18):
Wang X, Chang X, Zhan H, et al. Curcumin and baicalin ameliorate ethanol-induced liver oxidative damage via the nrf2/ho-1 pathway [J]. J Food Biochem, 2020, e13425.
Kong D, Zhang Z, Chen L, et al. Curcumin blunts epithelial-mesenchymal transition of hepatocytes to alleviate hepatic fibrosis through regulating oxidative stress and autophagy [J]. Redox Biol, 2020, 36(101600.
Afrin R, Arumugam S, Rahman A, et al. Curcumin ameliorates liver damage and progression of nash in nash-hcc mouse model possibly by modulating hmgb1-nf-κb translocation [J]. Int Immunopharmacol, 2017, 44(174-182.
Lu Y, Wu S, Xiang B, et al. Curcumin attenuates oxaliplatin-induced liver injury and oxidative stress by activating the nrf2 pathway [J]. Drug Des Devel Ther, 2020, 14(73-85.
Zhang J, Zheng Y, Luo Y, et al. Curcumin inhibits lps-induced neuroinflammation by promoting microglial m2 polarization via trem2/ tlr4/ nf-κb pathways in bv2 cells [J]. Mol Immunol, 2019, 116(29-37.
Gong Z, Zhao S, Zhou J, et al. Curcumin alleviates dss-induced colitis via inhibiting nlrp3 inflammsome activation and il-1β production [J]. Mol Immunol, 2018, 104(11-19.
Kong F, Ye B, Cao J, et al. Curcumin represses nlrp3 inflammasome activation via tlr4/myd88/nf-κb and p2x7r signaling in pma-induced macrophages [J]. Front Pharmacol, 2016, 7(369.
Lu M, Yin N, Liu W, et al. Curcumin ameliorates diabetic nephropathy by suppressing nlrp3 inflammasome signaling [J]. Biomed Res Int, 2017, 2017(1516985.
Ma J, Tian Y, Li J, et al. Effect of bufei yishen granules combined with electroacupuncture in rats with chronic obstructive pulmonary disease via the regulation of tlr-4/nf-b signaling [J]. Evid Based Complement Alternat Med, 2019, 2019(6708645.
Chen Y, Que R, Lin L, et al. Inhibition of oxidative stress and nlrp3 inflammasome by saikosaponin-d alleviates acute liver injury in carbon tetrachloride-induced hepatitis in mice [J]. Int J Immunopathol Pharmacol, 2020, 34(2058738420950593.
Mazgaeen L, Gurung P. Recent advances in lipopolysaccharide recognition systems [J]. Int J Mol Sci, 2020, 21(2):
Huo Y, Win S, Than T A, et al. Antcin h protects against acute liver injury through disruption of the interaction of c-jun-n-terminal kinase with mitochondria [J]. Antioxid Redox Signal, 2017, 26(5): 207-220.
Zhang Y, Jia H, Jin Y, et al. Glycine attenuates lps-induced apoptosis and inflammatory cell infiltration in mouse liver [J]. J Nutr, 2020, 150(5): 1116-1125.
Mao K, Chen S, Chen M, et al. Nitric oxide suppresses nlrp3 inflammasome activation and protects against lps-induced septic shock [J]. Cell Res, 2013, 23(2): 201-212.
Brenner C, Galluzzi L, Kepp O, et al. Decoding cell death signals in liver inflammation [J]. J Hepatol, 2013, 59(3): 583-594.
D'souza S, Lau K C, Coffin C S, et al. Molecular mechanisms of viral hepatitis induced hepatocellular carcinoma [J]. World J Gastroenterol, 2020, 26(38): 5759-5783.
Liu J, Du S, Kong Q, et al. Hspa12a attenuates lipopolysaccharide-induced liver injury through inhibiting caspase-11-mediated hepatocyte pyroptosis via pgc-1α-dependent acyloxyacyl hydrolase expression [J]. Cell Death Differ, 2020, 27(9): 2651-2667.
Ye L, Li G, Goebel A, et al. Caspase-11-mediated enteric neuronal pyroptosis underlies western diet-induced colonic dysmotility [J]. J Clin Invest, 2020, 130(7): 3621-3636.
Moniruzzaman M, Ghosal I, Das D, et al. Melatonin ameliorates ho-induced oxidative stress through modulation of erk/akt/nfkb pathway [J]. Biol Res, 2018, 51(1): 17.
Yu P, Zhang X, Liu N, et al. Pyroptosis: Mechanisms and diseases [J]. Signal Transduct Target Ther, 2021, 6(1): 128.
Orning P, Lien E, Fitzgerald K A. Gasdermins and their role in immunity and inflammation [J]. J Exp Med, 2019, 216(11): 2453-2465.
Zhong W, Qian K, Xiong J, et al. Curcumin alleviates lipopolysaccharide induced sepsis and liver failure by suppression of oxidative stress-related inflammation via pi3k/akt and nf-κb related signaling [J]. Biomed Pharmacother, 2016, 83(302-313.
Farzaei M H, Zobeiri M, Parvizi F, et al. Curcumin in liver diseases: A systematic review of the cellular mechanisms of oxidative stress and clinical perspective [J]. Nutrients, 2018, 10(7):
Roy A, Srivastava M, Saqib U, et al. Potential therapeutic targets for inflammation in toll-like receptor 4 (tlr4)-mediated signaling pathways [J]. Int Immunopharmacol, 2016, 40(79-89.
Wang Z, Chen Z, Li B, et al. Curcumin attenuates renal interstitial fibrosis of obstructive nephropathy by suppressing epithelial-mesenchymal transition through inhibition of the tlr4/nf-кb and pi3k/akt signalling pathways [J]. Pharm Biol, 2020, 58(1): 828-837.
Han Y, Chen R, Lin Q, et al. Curcumin improves memory deficits by inhibiting hmgb1-rage/tlr4-nf-κb signalling pathway in appswe/ps1de9 transgenic mice hippocampus [J]. J Cell Mol Med, 2021, 25(18): 8947-8956.
Ni H, Jin W, Zhu T, et al. Curcumin modulates tlr4/nf-κb inflammatory signaling pathway following traumatic spinal cord injury in rats [J]. J Spinal Cord Med, 2015, 38(2): 199-206.
Zhang Y, Zeng Y. Curcumin reduces inflammation in knee osteoarthritis rats through blocking tlr4 /myd88/nf-κb signal pathway [J]. Drug Dev Res, 2019, 80(3): 353-359.
Sarawi W S, Alhusaini A M, Fadda L M, et al. Nano-curcumin prevents cardiac injury, oxidative stress and inflammation, and modulates tlr4/nf-κb and mapk signaling in copper sulfate-intoxicated rats [J]. Antioxidants (Basel), 2021, 10(9):
Li X, Xu D-Q, Sun D-Y, et al. Curcumin ameliorates monosodium urate-induced gouty arthritis through nod-like receptor 3 inflammasome mediation via inhibiting nuclear factor-kappa b signaling [J]. J Cell Biochem, 2019, 120(4): 6718-6728.
Chen H, Yu X, Ma L. Synergistic effect of curcumin and resveratrol on the prevention of contrast-induced nephropathy by suppressing inflammation via regulating signaling pathways of microrna-17/txnip/nrlp3 and microrna-30c/foxo3/nrlp3 [J]. Biotechnol Appl Biochem, 2022,

Graphicsummary.tif

Download PDF

Version 1

posted

You are reading this latest preprint version

Curcumin ameliorates LPS/D-GalN induced acute liver injury by regulating TLR4/NF-кB/NLRP3 signaling pathway in vivo and in vitro

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Cell viability

Analysis of ALT, AST and LDH in cell supernatant

Animals and treatment

Analysis of ALT and AST in sera

Analysis of oxidative stress in livers

Hematoxylin and eosin staining

Quantitative Real-time PCR

Western blot

Statistical analysis

Results

Curcumin mitigated the LPS-induced L-02 cells damage

Curcumin suppressed TLR4/NF-кB/NLRP3 signal pathway triggered by LPS in L-02 cell

Effect of curcumin on LPS/D-GalN-induced liver injury in rats

Protective effect of curcumin on pathological injury of liver in rats

Effect of curcumin on TLR4/NF-кB/NLRP3 signal pathway in the liver of rats

Discussion

Conclusion

Declarations

Declarations of Competing Interest

Acknowledgement

Author contributions

References

Supplementary Files

Status:

Version 1