Anemoside B4 alleviates neuropathic pain through inhibiting inflammation

doi:10.21203/rs.3.rs-1821028/v1

Download PDF

Research Article

Anemoside B4 alleviates neuropathic pain through inhibiting inflammation

https://doi.org/10.21203/rs.3.rs-1821028/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Research background: Neuropathic pain (NP), which is caused by nerve injury or other diseases damages patients’ life quality seriously. Anemoside B4 (AB4) is the active component of triterpenoid saponins in traditional Chinese medicine Pulsatilla, with prominent effects of anti-inflammation and analgesia. However, its pharmacological mechanisms acting on NP remains unclear.

Methods: The analgesia effects of AB4 against NP were investigated on the basis of the spinal nerve ligation (SNL) rat model by detecting the thresholds of mechanical pain and response times to cold stimulate. The key targets of AB4 acting on NP is selected based on the transcriptomic analysis, and their relative expression level was further verified by RT-qPCR. The binding sites of AB4 to the targets were searched by molecular docking. The regulation effects of AB4 on cytokines including IL-1β, IL-6 and TNF-α in the serum of SNL rats were tested by ELISA.

Results: In contrast with normal rats, the thresholds of mechanical pain was decreased, whereas the response times to cold stimulate was increased in SNL rats, and the above phenomenon was reversed by AB4 treatment. The transcriptome sequencing results revealed that AB4 mainly regulated the serotonergic synapse, glutamatergic synapse, GABAergic synapse, dopaminergic synapse and cholinergic synapse pathways which was closely related to neuroinflammation and central pain sensitization. Further overlap analysis selected five genes in the pathway, named Alox15, Gngt1, Gngt2, Gnb3 and Tph1 respectively. Further RT-qPCR confirmed that the gene expression of them was down-regulated in the hippocampus of SNL rats, and up-regulated by AB4 administration. According to the molecular docking results, Anemoside B4 forms tightly bonded hydrogen bonding forces with key target molecules of the synaptic pathway, including Alox15, Gngt1, Gngt2, Gnb3 and Tph1. In addition, AB4 treatment also decreased the contents of inflammatory cytokines IL-1β, IL-6 and TNF-α in the serum of SNL rats.

Conclusion: Our findings suggested the possibility of AB4 as a promising candidate for NP treatment by inhibiting inflammation.

Anemoside B4

neuropathic pain

inflammation

Neuropathic pain (NP) is regarded as pain caused by injury or disease in the somatic nervous system [1],with characters of psychological and emotional distress [2], which affects 5% of the world's general population. The major symptoms of NP including hyperalgesia caused by peripheral and central nervous sensitization due to excessive amplification of nerve excitation, paroxysmal and abnormal pain caused by spontaneous abnormal potential activity after nerve injury. In clinic, NP contains a series of diseases such as trigeminal neuralgia, peripheral nerve injury, multiple radiculitis, diabetic polyneuropathy, post-herpetic neuralgia and other peripheral nerve pain, as well as spinal cord injury, multiple sclerosis, post-stroke pain, Parkinson's disease and other central nerve pain [3–5]. The neuro-immune system interaction plays an important role in inducing pain generation, amplifying pain response, and maintaining long-term pain [6]. At present, drug therapy still remains to be the major pain control method for NP patients. Clinically, there are curative drugs that are recommended. The first-line drugs cover tricyclic antidepressants drugs (amitriptyline, nortriptyline), serotonin-norepinephrine reuptake inhibitors (duloxetine or venlafaxine) and anticonvulsants (gabapentin and pregabalin); whereas, the second-line treatments include the opioid tramadol, topical patches (lidocaine and capsaicin); and third-line treatments comprise the strong opioids oxycodone and morphine, and the subcutaneous injection Botulinum toxin type A [7, 8]. Capsaicin has gained great popularity in recent years for its excellent effects in regulating the immune response of Schwann cells, enhancing the ability of anti-inflammatory and antioxidant and reducing neuroinflammation [9]. As reported, lidocaine inhibits the activation of microglia and astrocytes,decreases the secretion of pro-inflammatory factors TNF-α and IL-1β, and alleviates hyperalgesia by inhibiting the excitatory potential induced by the excessive release of glutamate from the presynaptic terminal [10]. Therefore, there is convincing evidence of a link between reduction of neuroinflammation and pain control.

Pulsatilla is an ancient Chinese herb medicine, which has the effects of cooling blood, stopping dysentery, fighting bacteria and reducing inflammation based on traditional Chinese medicine theory. In ancient times, it was widely applicated in the treatment of bacillary dysentery, more importantly, its powerful healing result of ulcerative colitis has been confirmed in recent studies with major component Anemoside B4 (AB4) [11, 12]. As reported, AB4 can effectively reduce inflammatory responses, such as klebsiella pneumoniae, bacterial and viral pneumonia, as well as acute lung injury caused by sepsis [13, 14]. In addition, it also reduced acute hepatitis associated with sepsis [15], renal injury [16], ulcerative colitis, endometritis induced by phenol [17], chemotactic aggregation of neutrophils and other inflammatory reactions [18]. Recent studies provide evidence that AB4 has surprising anti-inflammatory and analgesic effects in inflammatory pain, but the underlying mechanisms remain unclear [19]. In this study, the analgesia effects and molecular mechanisms of AB4 against NP is investigated on the base of spinal nerve ligation (SNL) rat model by the combination strategy of transcriptomic analysis, molecular docking and experimental verification on both gene and protein level.

Experimental animal

Healthy male rats were fed for 2-3months at 180-250g in the Animal house of China Academy of Chinese Medical Sciences at a temperature of 22-24℃, humidity of 50%-60%, light and darkness for 12 hours each day. Food and water were sufficient and freely available. The experiment was conducted in accordance with the relevant guidelines for experimental animals and approved by the Ethics Committee of Experimental Animals, Institute of Chinese Materia Medica, China Academy of Chinese Medical Sciences (No.2021B113).

Experimental groups and drug delivery

SD rats were divided into 4 groups with 8 rats in each group, including the normal group (Con), the model group (SNL), the Anemoside B4 group (AB4), and the pregabalin group (PGB). AB4 group was given intraperitoneal injection with the dosage of 4.15mg/kg selected according to the preliminary experiment results, and PGB group was given intragastric injection with the dose of 22.5mg/kg.

Construction of NP rat model

We constructed the NP rat model based on published paper [20], in brief, rats were anesthetized with pentobarbital. Then, the animals were operated under a small operating microscope after shave hair. Rats’ skin was cut parallel to the spine along the middle of the anterior superior iliac spine and the spine with surgical scissors. After that, we carefully separated tissues beside the spine to identify the transverse process of the L6 vertebral body. The next, we gently separated the L4 and L5 spinal nerves with surgical tweezers, and ligated the L5 spinal nerves with surgical sutures. After cleaning, the rats were carefully sutured and observed until awake.

Measurement of mechanical and cold hyperalgesia

The mechanical hyperalgesia (50% withdraw threshold) of rats was detected by using Von Frey fibers according to the description in the paper [21]. In short, the paw surface of rats were vertically stimulated with fiber(s) for 5-10s by up and down method, if a foot withdrawal response within the stimulation time or quickly and quickly withdrawn after the stimulation as a positive behavior. Then data was calculated on the base of published formula. The mechanical hyperalgesia was measured at 4, 6, 8, 10 and 12 days after administration.

The sensitivity of rats to cold stimulation was measured on the base of published paper [22]. In detail, 20 μL acetone was sprayed to stimulate the central plantar skin of the rat’s hind paw, and the times of licking or shaking the left hind paw within 5 minutes was recorded so as to reflect their sensitivity to cold stimulation. The cold hyperalgesia was also tested at 4, 6, 8, 10 and 12 days after drug treatment.

Transcriptome sequencing and bioinformatics analysis

Rat hippocampal tissue was selected for RNA sequencing. In brief, total RNA was extracted using the RNeasy mini kit (Qiagen, Germany). According to TruSeq™RNA sample preparation guidelines, a double-terminal library was prepared using the TruSeq™RNA Sample Preparation Kit (Illumina, USA). Then, mRNA fragmentation, synthesis of double-stranded cDNA, cDNA terminal repair, DNA purification and PCR amplification were performed. Sequencing was performed using Illumina NovaSeq 6000 (Illumina, USA). Hisat2 software was used for reference genome comparison, and edgeR software was used for gene quantification. On this basis, the difference genes obtained by comparison between the two groups were calculated according to group information. The screening threshold was |log2FC|≥1 and P ≤ 0.05. The differentially expressed genes were analyzed for GO (Gene Ontology) and KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway enrichment.

RT-qPCR

We performed RT-qPCR to detect the gene expression level of key targets in the hippocampus of rats in different groups. During RNA extraction, TRzol was added to100mg of hippocampus for tissue homogenization. RNA was extracted by chloroform, precipitated by isoacetone and washed by 75% ethanol. The purity and concentration of RNA was detected by ultramicro spectrophotometer, and the absorbance ratio of 260/280 nm and 260/230 nm was about 2.0, whereas, the RNA concentration was set at 500-1000ng. The next, RNA was reversed into cDNA by EasyScript® One-step gDNA Removal and cDNA Synthesis SuperMix (TransGen Biotech, China) kit. Then, TransStart® Top Green qPCR SuperMix (TransGen Biotech, China) kit was used. Real-time quantitative PCR was performed in ABI StepOnePlus™ Real-Time PCR System with Tower. GAPDH was detected for normalization and quantification. The relative expression levels of genes were calculated by the comparative cycle threshold (CT) method.

Table 1 Primer sequences

Gene name	Primer Forward(5'-3')	Primer Reverse(3'-5')
Alox15	CACCGGAGACTCCAAGTACG	AGTGGCCCAAGGTATCCTGA
Gngt1	CTAAGCCTGGCGTGTGGAAT	CACCGGCATCTTTTGTCAGG
Gngt2	AGAGCTCTAACAGGGCAGGA	GGAAATCGGATCACGTGGGT
Gnb3	ACGTCCGTAGCCTTCTCACTCAG	CGCCTACACGCTCACACTTCAG
Tph1	TGAGTCCCGGAAATCGAAGC	TCGGATCCGTACAACAGCAC
GAPDH	TGCTGAGTATGTCGTGGAGTC	GGAGATGATGACCCTTTTGG

Molecular docking

Mol format of Anemoside B4 was obtained from PubChem database (PubChem CID: 71307558), and protein crystal structures including Alox15 (UniPROtKB-Q02759), Gngt1 (UniPROtKB-D4AAI1), Gngt2 (UniPROTKB-Q61017), Gnb3 (UniPROtKB-P52287) and Tph1 (UniPROTKB-P09810) were searched from Uniprot protein database. AutoDock Vina39 software removes water molecules, adds nonpolar hydrogen, and docking molecules. Pymol software is used for visualization of docking results.

ELISA

The serum levels of IL-1β, IL-6 and TNF-α in the serum of different groups were detected by ELISA. ELISA kits were purchased from Nanjing Jiancheng Biological Engineering Research Institute and all experiments were performed based on the manufacturer's protocols.

Statistical analysis

GraphPad Prism version 9.0 was used for statistical analysis, and data were expressed as mean ± standard deviation. P-values less than 0.05 were regarded as significant.

AB4 produced analgesic action in a rat SNL model

AB4 at the concentration of 4.15mg/kg which was selected by pre-test or the positive drug Pregabalin (PGB) at the dosage of 22.5mg/kg was administered daily by gavage for 2 weeks, since the forth day of they accepted the SNL surgical operation. As a result, in contrast with Con rats, the 50% threshold of rats in SNL group was sharply reduced and there was no evidence to show that the 50% withdrawal threshold of SNL rats recovering within two weeks. However, compared with SNL rats, both AB4 and PGB effectively increased the 50% withdrawal threshold with the prolongation of administration time (all P＜0.05). Interestingly, the 50% withdrawal threshold of rats which accepted AB4 administration for 12 days was similar to that of Con rats, as shown in Figure 1C. Similarly, the reaction times to cold stimulation of SNL rats were markedly increased than those of Con rats and this phenomenon was reversed by both AB4 and PGB administration for 12 days, as shown in Figure 1D.The above data indicating the effective analgesic action of AB4.

KEGG pathway enrichment analysis of AB4 regulated NP-related genes

According to the KEGG pathway enrichment analysis, AB4 regulated NP-related genes in the hippocampus were closely enriched in five synaptic pathways, including serotonergic synapse, glutamatergic synapse, GABAergic synapse, dopaminergic synapse and cholinergic synapse pathways. Further overlap analysis Indicated that the common genes in the above pathways included Alox15, Gngt1, Gngt2, Gnb3 and Tph1, which were down-regulated by the SNL surgery operation in contrast with normal rats, whereas up-regulated by AB4 administration in compared with the SNL group. Interestingly, we didn’t find any common gene which was up-regulated by the SNL surgery operation and down-regulated by AB4 administration. Thus, we regarded Alox15, Gngt1, Gngt2, Gnb3 and Tph1 as key target genes of AB4 acting on NP.

Validation of the regulation effects of AB4 on the gene expression level of key genes against NP

The relative gene expression level of five key genes which was selected by the KEGG pathway enrichment analysis was further detected by RT-qPCR in the rat hippocampus of different groups. As a result, the SNL operation which mimicked the NP condition markedly reduced the gene expression level of Alox15, Gngt1, Gngt2, Gnb3 and Tph1, however, AB4 treatment significantly increased their gene level. The RT-qPCR results was in accordance with that of the transcriptome sequencing.

Molecular docking results of AB4 and 5 key genes against NP

Molecular docking further confirmed the predicted results of key target molecules in the pathway, and revealed substantial interactions between Anemoside B4 and key target molecules in the pathway. The results showed that amino acid residues of Anemoside B4 and Alox15 molecules included ARG-474, ASN-473, ASP-446, amino acid residues of Gngt1 molecule ASP-51, and amino acid residues of Gngt2 molecule included GlU-35, PRO-25, Gnb3 amino acid residues include ARG-314, ASP-290, Tph1 amino acid residues ARG-412, GLY-398, SER-414 to form hydrogen bond force . These results indicate that Anemoside B4 interacts closely with the target protein.

Regulation effects of AB4 on the protein expression level of inflammatory cytokines in serum

Serum levels of inflammatory factors IL-1β、IL-6 and TNF-α were determined by ELISA. The SNL operation which mimicked the NP condition markedly increased the inflammatory factor content of IL-1β、IL-6 and TNF-α. On the contrary, AB4 treatment significantly reduced their inflammatory factor content.

In this study, we demonstrated the following: (1) AB4 produced exact analgesic effect against NP based on the classic SNL rat model; (2) AB4 regulated NP-related genes in the hippocampus were closely enriched in five synaptic pathways, and the key target genes were identified as Alox15, Gngt1, Gngt2, Gnb3 and Tph1; (3) The SNL operation reduced the gene expression level of the above 5 genes, which was reversed by AB4 administration; (4) AB4 interacted with the 5 key target genes at different sites which was simulated by molecular docking; (5) AB4 decreased the protein expression level of inflammatory factors including IL-1β, IL-6 and TNF-α in the serum of rats which accepted SNL surgery. To sum up, the above findings indicating that the anti-NP effect of AB4 was exerted through the inhibition of neuroinflammation by reducing the gene expression level of Alox15,Gngt1, Gngt2, Gnb3 and Tph1, as well as the down-regulating of IL-1β, IL-6 and TNF-α proteins. The possible molecular mechanisms of AB4 acting on NP were described in Fig. 6.

Although the pathogenesis of NP still needs further investigation, it is widely accepted that neuroinflammation plays a primary role during both its onset and development. Excessive activation and proliferation of Schwann cells, microglia and astrocytes that secrete neurotrophic factors release a large number of pro-inflammatory factors such as IL-1β, IL-6 and TNF-α, resulting in the aggregation of macrophages, neutrophils, T lymphocytes and mast cells gather to inflammatory sites. Positive feedback of inflammatory cell aggregation regulates the high expression of pro-inflammatory factors such as IL-2, IL-6, NF-κB, histamine, leukotriene and TNF-α, which continuously stimulates nociceptors and enhances the excitatory toxicity of neurons to produce hyperalgesia [23, 24]. Therefore, targeting reducing the neuroinflammatory response is an effective strategy for NP control. Based on published paper, AB4 with immunomodulatory activity and inhibition effect of immune cells activation and inflammatory factors secretion is a promising treatment strategy for inflammatory diseases including neuroinflammation [25]. ELISA results showed that AB4 markedly decreased the serum concentrations of inflammatory cytokines IL-1β, IL-6 and TNF-α which was increased by SNL surgery.

In this study, we also discovered that AB4 mainly regulated synaptic related pathways including serotonergic synapse, glutamatergic synapse, GABAergic synapse, dopaminergic synapse and cholinergic synapse pathway by transcriptome sequencing. Serotonergic synapse played an important role in memory, cognition, pain and endocrine, in addition, serotonin was a monoamine neurotransmitter stored in synaptic vesicles, which could stimulate or inhibit neuronal activities and worked in pain perception and analgesia [26, 27]. Glutamatergic synapse and cholinergic synapse mediated excitatory signaling. When microglia and astrocytes were activated, they released glutamate which was the main excitatory neurotransmitter in the nervous system under neuroinflammatory condition [28]. Cholinergic neurons were closely involved in the process of nociceptive information transmission and pain sensitization through producing acetylcholine [29]. Whereas, GABAergic and dopaminergic synapses mainly mediated inhibitory signaling. GABA was the primary inhibition neurotransmitter in the nervous system, the release of which was reduced during the onset of NP [30]. Dopaminergic neurons activation made contribution to reduce hyperalgesia of harmful stimuli [31, 32]. Thus, the above pathways played an extraordinary role in neuro-immune regulation of NP. Further overlap analysis identified Alox15, Gngt1, Gngt2, Gnb3 and Tph1 to be the key target genes, which were down-regulated in the SNL group and up-regulated by the AB4 treatment. The gene expression levels of them were further validated by RT-qPCR, and the results were in agreement with that of the transcriptome sequencing. Based on the molecular docking results, The key target molecules of Anemoside B4 and NP, including Alox15, Gngt1, Gngt2, Gnb3 and Tph1, form a tight hydrogen bonding force. As reported, ALOX15 could reduce inflammatory responses by regulating the production of lipid mediators such as lipoxins and resolvins, and its down-regulation or knockout promoted the infiltration of inflammatory cells which further led to tissue necrosis and other inflammatory reactions [33]. On the contrary, the overexpression of ALOX15 showed significant anti-inflammatory properties, especially in glomerulonephritis, colitis [34] and tendonitis induced nerve pain patients [35]. According to analgesic drug studies, Alox15 gene could act on the prefrontal cortex to reduce the central sensitization effect and relieve pain [36]. Gnb3, Gngt1 and Gngt2 belong to the β and γ subunits of guanine nucleotide binding protein (G protein), which was important during the inhibition of neutrophil chemotaxis, alleviation of inflammation and relief of NP [37]. For example, the analgesic effect of morphine is produced by G protein-coupled receptor (GPCR), mu opioid receptor (muOR) [38]. µ-opioid G protein-coupled receptor (µOR) acted on the adenylyl cyclase-inhibitory family of G proteins (Gi/o) to mediate signaling and play an analgesic role [39]. During the elimination of neuroinflammation, astrocytes inhibited neuroinflammation by down-regulating the expression of inflammatory factors through the Gi pathway in GPCR [40]. TPH1 (Tryptophan hydroxylase 1) worked as a rate-limiting enzyme in the biosynthesis of 5-Hydroxytryptamine (5-HT), and the reduction of which in cerebrospinal fluid would led to mechanical hyperalgesia with central sensitization [41, 42]. Whereas the TPH1 overexpression promoted the synthesis of 5-methoxytryptophan (5-MTP), improved nephritis and renal fibrosis [43]. Therefore, our findings were in accordance with the published studies which indicating that the increase of Alox15 Gngt1, Gngt2, Gnb3 and Tph1 made contributions to the elimination of neuroinflammation and pain control.

To sum up, in this study, we evaluated the analgesic effect of AB4 and analysed its possible mechanisms by means of transcriptome sequencing based on the of SNL rat model. We identified five key target genes namely Alox15 Gngt1, Gngt2, Gnb3, and Tph1 respectively. Further molecular docking results clarified the exact sites of AB4 and the above key target genes. In addition, it was validated that AB4 increased their gene expression level in the hippocampal region of rats with NP. More importantly, we demonstrated that AB4 also decreased the inflammatory cytokines protein contents in the serum of SNL rats. In conclusion, this study provided evidence that AB4 was a promising therapy for NP control due to the inhibition of neuroinflammation.

NP: Neuropathic pain; AB4: Anemoside B4;SNL:Spinal nerve ligation; Alox15: Arachidonate 15-lipoxygenase; Gng1: Guanine nucleotide-binding protein G(T) subunit gamma-T1; Gngt2:Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-T2; Gnb3: guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-3; Tph1:Tryptophan hydroxylase 1;

Acknowledgments

We are thankful to the Artemisinin Research Center and Institute of Chinese Materia Medica, China Academy of Chinese Medical Sciences for providing laboratory facilities. The author also acknowledges the funding support provided by the the National Key R&D Program of China, the National Natural Science Foundation of China, the Innovation Team and Talents Cultivation Program of National Administration of Traditional Chinese Medicine, the Beijing Municipal Natural Science Foundation, the CACMS Innovation Fund, the Fundamental Research Funds for the Central Public Welfare Research Institutes, and the Young Elite Scientists Sponsorship Program by CAST.

Author Contributions

Minghong Zhao, Haiyan Li, Tong Yang, Chong Qiu, Tianming Lu and Qixin Wang conducted the experiments, performed data analysis and figures preparation. Minghong Zhao and Qiuyan Guo prepared the manuscript. Qiuyan Guo and Jigang Wang supervised the project, and provided financial supports to this study. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Key R&D Program of China (No. 2020YFA0908000), the National Natural Science Foundation of China (Nos. 82074098 and 82104480), the Innovation Team and Talents Cultivation Program of National Administration of Traditional Chinese Medicine (No. ZYYCXTD-C-202002), the Beijing Municipal Natural Science Foundation (No.7214287), the CACMS Innovation Fund (No. CI2021A05101), the Fundamental Research Funds for the Central Public Welfare Research Institutes (No. ZZ14-YQ-060), and the Young Elite Scientists Sponsorship Program by CAST (No. 2021-QNRC2-B29).

Availability of data and materials

The data presented in this study are available on request from the corresponding authors.

Ethics approval and consent to participate

Ethics approval and consent to participate Institutional Review Board Statement: The study was approved by the Institute of Chinese Materia Medica, China Academy of Chinese Medical Sciences Animal Care and Use Committee (No: 2021B113).Verbal informed consent of participants was obtained.

Consent for publication

Written informed consent was obtained from all participants.

Competing interests

The authors declare that they have no competing interest.

Author details

¹Artemisinin Research Center and Institute of Chinese Materia Medica, China Academy of Chinese Medical Sciences, Beijing, China; ²Key Laboratory of Prevention and Treatment of Cardiovascular and Cerebrovascular Diseases, Ministry of Education, Gannan Medical University, Ganzhou, China; ³School of Medicine, Foshan University, Foshan, China; ⁴School of Public Health of Guangxi Medical University, Nanning, China.

Meacham K, Shepherd A , Mohapatra DP, Haroutounian S,et al. Neuropathic Pain: Central vs. Peripheral Mechanisms. Curr Pain Headache Rep. 2017, 21(6):28.
Bannister K, Sachau J, Baron R, et al. Neuropathic Pain: Mechanism-Based Therapeutics. Annu Rev Pharmacol Toxicol. 2020, 60:257-274.
Scholz J, Finnerup NB, Attal N, et al. The IASP classification of chronic pain for ICD-11: chronic neuropathic pain. Pain. 2019, 160(1):53-59.
Jensen TS, Finnerup NB. Allodynia and hyperalgesia in neuropathic pain: clinical manifestations and mechanisms. Lancet Neurol. 2014, 13(9):924-935.
Jongen JL, Hans G, Benzon HT, et al. Neuropathic pain and pharmacological treatment. Pain Pract. 2014, 14(3):283-295.
Vergne-Salle P, Bertin P. Chronic pain and neuroinflammation. Joint Bone Spine. 2021, 88(6):105222.
Gilron I, Baron R, Jensen T. Neuropathic pain: principles of diagnosis and treatment. Mayo Clin Proc. 2015, 90(4):532-545.
Finnerup NB, Attal N, Haroutounian S, et al. Pharmacotherapy for neuropathic pain in adults: a systematic review and meta-analysis. Lancet Neurol. 2015, 14(2):162-173.
Grüter T, Blusch A, Motte J, et al. Immunomodulatory and anti-oxidative effect of the direct TRPV1 receptor agonist capsaicin on Schwann cells. J Neuroinflammation. 2020, 17(1):145.
Ma LL, Li J, Zhou JL, et al. Intravenous lidocaine alleviates postherpetic neuralgia in rats via regulation of neuroinflammation of microglia and astrocytes. iScience. 2021, 24(2):102108.
Liu YL, Zhou MY, Yang M, et al. Pulsatilla chinensis Saponins Ameliorate Inflammation and DSS-Induced Ulcerative Colitis in Rats by Regulating the Composition and Diversity of Intestinal Flora. Front Cell Infect Microbiol. 2021, 11:728929.
Li YH, Zou M, Han Q,et al. Therapeutic potential of triterpenoid saponin anemoside B4 from Pulsatilla chinensis. Pharmacol Res. 2020, 160:105079.
He J, Yuan RYK, Cui XL,et al. Anemoside B4 protects against Klebsiella pneumoniae- and influenza virus FM1-induced pneumonia via the TLR4/Myd88 signaling pathway in mice. Chin Med. 2020, 15:68.
Yuan RYK, He J, Huang LT, et al. Anemoside B4 Protects against Acute Lung Injury by Attenuating Inflammation through Blocking NLRP3 Inflammasome Activation and TLR4 Dimerization. J Immunol Res. 2020, 2020:7502301.
Pei L, He LX. Hepatoprotective effect of anemoside B4 against sepsis-induced acute liver injury through modulating the mTOR/p70S6K-mediated autophagy. Chem Biol Interact. 2021, 345:109534.
Gong Q, He LL, Wang ML, et al. Anemoside B4 Protects Rat Kidney from Adenine-Induced Injury by Attenuating Inflammation and Fibrosis and Enhancing Podocin and Nephrin Expression. Evid Based Complement Alternat Med. 2019, 2019:8031039.
Wang LL, Cui YR, Chen LY, et al. Therapeutic effect of Anemoside B4 on chronic Endometritis in Rats and Its Related factors. Chin J Exp Tradit Med Form. 2020, 26(15):54-60.
Yun Y, Jiang JJ, Wang YD, et al. Main components in butyl alcohol extract of Baitouweng Decoction inhibited neutrophil chemotaxis. Zhongguo Zhong Yao Za Zhi. 2021, 46(16):4201-4207.
Zhang P, Wang YE, Xu QM, et al. Experimental study of analgesic effect of Anemoside B4 for mice. China Sciencepap. 2018, 13(24):2754-2759.
Liu ZY, Song ZW, Guo SW, et al. CXCL12/CXCR4 signaling contributes to neuropathic pain via central sensitization mechanisms in a rat spinal nerve ligation model. CNS Neurosci Ther. 2019, 25(9):922-936.
Wang C, Liu CF, Wan HY, et al. Wu-tou decoction inhibits chronic inflammatory pain in mice: participation of TRPV1 and TRPA1 ion channels. Biomed Res Int. 2015:328707.
Guo QY, Li WJ, Wang C, et al. Biomolecular network-based synergistic drug combination discovery: a combination of paeoniflorin and liquiritin alleviates neuropathic pain by inhibiting neuroinflammation via suppressing the chemokine signaling pathway. Signal Transduct Target Ther. 2020, 5(1):73.
Sommer C, Leinders M, Üçeyler N. Inflammation in the pathophysiology of neuropathic pain. Pain. 2018, 159(3):595-602.
Kuffler DP. Mechanisms for Reducing Neuropathic Pain. Mol Neurobiol. 2020, 57(1):67-87.
Kang NX, Shen WH, Zhang Y, et al. Anti-inflammatory and immune-modulatory properties of anemoside B4 isolated from Pulsatilla chinensis in vivo. Phytomedicine. 2019, 64:152934.
Cortes-Altamirano JL, Olmos-Hernandez A, Jaime HB, et al. Review: 5-HT1, 5-HT2, 5-HT3 and 5-HT7 Receptors and their Role in the Modulation of Pain Response in the Central Nervous System. Curr Neuropharmacol. 2018, 16(2):210-221.
Paredes S, Cantillo S, Candido KD, et al. An Association of Serotonin with Pain Disorders and Its Modulation by Estrogens. Int J Mol Sci. 2019, 20(22).
Osikowicz M, Mika J, Przewlocka B. The glutamatergic system as a target for neuropathic pain relief. Exp Physiol. 2013, 98(2):372-384.
Xiao Y, Yang XF, Xu MY. Effect of acetylcholine on pain-related electric activities in hippocampal CA1 area of normal and morphinistic rats. Neurosci Bull. 2007, 23(6):323-328.
Li CJ, Lei YY, Tian Y, et al. The etiological contribution of GABAergic plasticity to the pathogenesis of neuropathic pain. Mol Pain. 2019, 15:1744806919847366.
Moradi M, Fatahi Z, Haghparast A. Blockade of D1-like dopamine receptors within the ventral tegmental area and nucleus accumbens attenuates antinociceptive responses induced by chemical stimulation of the lateral hypothalamus. Neurosci Lett. 2015, 599:61-66.
Wood PB. Mesolimbic dopaminergic mechanisms and pain control. Pain. 2006, 120(3):230-234.
Kim SN, Akindehin S, Kwon HJ, et al. Anti-inflammatory role of 15-lipoxygenase contributes to the maintenance of skin integrity in mice. Sci Rep. 2018, 8(1):8856.
Tian R, Zuo XS, Jaoude J, et al. ALOX15 as a suppressor of inflammation and cancer: Lost in the link. Prostaglandins Other Lipid Mediat. 2017, 132:77-83.
Dakin SG, Martinez FO, Yapp C, et al. Inflammation activation and resolution in human tendon disease. Sci Transl Med. 2015, 7(311):311ra173.
Shalini SM, Herr DR, Ong WY. The Analgesic and Anxiolytic Effect of Souvenaid, a Novel Nutraceutical, Is Mediated by Alox15 Activity in the Prefrontal Cortex. Mol Neurobiol. 2017, 54(8):6032-6045.
Lehmann DM, Seneviratne AM, Smrcka AV. Small molecule disruption of G protein beta gamma subunit signaling inhibits neutrophil chemotaxis and inflammation. Mol Pharmacol. 2008, 73(2):410-418.
Bohn LM, Lefkowitz RJ, Gainetdinov RR, et al. Enhanced morphine analgesia in mice lacking beta-arrestin 2. Science. 1999, 286(5449):2495-2498.
Mafi A, Kim SK, Goddard 3rd WA. Mechanism of β-arrestin recruitment by the μ-opioid G protein-coupled receptor. Proc Natl Acad Sci U S A. 2020, 117(28):16346-16355.
Kim JH, Rahman MH, Lee WH, et al. Chemogenetic stimulation of the G(i) pathway in astrocytes suppresses neuroinflammation. Pharmacol Res Perspect. 2021, 9(6):e00822.
Liu FY, Qu XX, Ding X, et al. Decrease in the descending inhibitory 5-HT system in rats with spinal nerve ligation. Brain Res. 2010, 1330:45-60.
Shen L, Qiu HB, Xu HH, et al. Nicotine withdrawal induces hyperalgesia via downregulation of descending serotonergic pathway in the nucleus raphe magnus. Neuropharmacology. 2021, 189:108515.
Chen DQ, Cao G, Chen H, et al. Identification of serum metabolites associating with chronic kidney disease progression and anti-fibrotic effect of 5-methoxytryptophan. Nat Commun. 2019, 10(1):1476.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Anemoside B4 alleviates neuropathic pain through inhibiting inflammation

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussions

Conclusions

Abbreviations

Declarations

References

Additional Declarations

Status:

Version 1