Risk assessment of transgene introgression from genetically modified soybean into its wild relatives

doi:10.21203/rs.3.rs-1828244/v1

Background: Crop-wild hybridization has generated great concerns since gene flow can be an avenue for transgene escape. However, a rather limited number of studies on risk assessment regarding the dispersion of transgenes from GM soybean to its wild relative populations have been conducted before.

Results: The results of the 3-year experiment demonstrated that F₁, F₂ and F₃had lower seed germination, higher pod and seed production than GM soybeans, and the seed productivity of hybrids (especially F₂ and F₃) were close to those of wild soybean. Furthermore, the foreign protein was stably expressed in F₁, F₂ and F₃ EPSPS positive plants, conferring to hybrids herbicide tolerance. However, despite being stably inherited, neither the presence of the EPSPS transgene nor the number of its copies does affect the detected hybrid vigor, since no difference is observed in agronomic measurements between hybrids that are glyphosate sensitive or resistant, homozygous or heterozygous for the transgene.

While EPSPS genes had little effect on crop growth and reproduction, hybridization between GM soybean to wild soybean may have more impact on hybrid growth and fecundity, this increase in biomass and yield conferring a potential competition benefit to hybrids.

Conclusions: Hybrids between GM soybean and wild soybean had similar germination characteristics and seed productivity as wild parent, such characteristics acquired by gene flow have the potential to promote the adaptability of hybrids and may increase the possibility of dispersal of transgenes through seed systems.

Genetically modified soybean

Hybrids

Seed germination

Aboveground biomass

Fecundity

Ecological risk

Since the first approval of commercial genetically modified (GM) maize in 1996, the extent of global GM plant cultivation has increased rapidly over the past two decades, reaching 191.7 million hectares in 2018. The principal GM crops in 2018 were soybean, occupying 50% or 95.9 million hectares of the global GM area [1]. Most GM soybeans have been modified with agronomically valuable traits, such as herbicide tolerance, insect resistance, and disease resistance [2], with herbicide tolerance consistently being the dominant trait. Cultivation of GM crops not only provides enormous economic and social benefits but also has positive effects on the environment in terms of decreasing pollution.

Although GM crops have great benefits [3], some ecological risks are emerging, such as the evolution of resistance in target insects, the parallel movement of foreign genes, and a decrease in the biodiversity of nontarget organisms [4, 5]. One of the main issues in the safety assessment of GM crops is pollen-mediated gene flow between the GM crop and its wild relatives [6, 7].

Annual wild soybean (Glycine soja) is widely distributed in Japan, Korea and northeastern Russia, and China is one of the main distribution areas of wild soybean. It has been reported that wild soybean has excellent characteristics, such as high protein, high yield, and tolerance to salt [8], which are valuable genetic resources for cultivated soybean breeding. Since wild soybean is the wild ancestor of cultivated soybean and its chromosome number is the same as that of soybean (2n = 40), outcrossing between cultivated soybean and wild soybean can frequently occur under natural field conditions, although some studies have shown that gene flow between cultivated and wild soybean occurred at very low frequencies [9–11]. However, wild soybean commonly grows throughout almost all of China, and their distributions largely overlap with the distributions of cultivated soybean fields, especially in northeastern and southeastern China [12]. While more favorable conditions, such as flowering synchrony and certain climatic conditions, are available, greater gene flow may be observed [13].

Transgene flow from GM crops to their wild relatives may have the potential to exacerbate weed problems by providing novel traits that allow these plants to compete better, produce more seeds, and become more abundant [14], which could result in changing variations in wild populations [15], and will probably cause unwanted ecological consequences. Models to predict consequences of gene flow from GM crops to wild relatives require a measure of hybrid fitness [16–18], which is mainly reflected by the ability of individuals to survive and reproduce in their new environment [19–22]. At present, a few studies were conducted to evaluate the growth performance of hybrids between GM soybean and wild soybean under greenhouse or field conditions. Kan et al. [23] measured the F₁ and F₂ hybrids of four wild soybeans and glyphosate-resistant soybean in a greenhouse and found that hybrids had similar pod and seed numbers per plant as their wild relatives. Field experimental studies conducted by Yook et al. [13] and Guan et al. [24] also found that hybrids (especially F₂ hybrids) showed similar characteristics to wild soybean in vegetative growth and seed productivity, the results of previous studies [13, 23, 24] indicated that hybrids with a higher fitness level might be associated with a higher ability to adapt to the environment and may therefore be beneficial for establishment transgenes in populations.

The expression of endogenous genes such as Bt and CP4-EPSPS could improve resistance to insects or herbicides; if the transgene is normally expressed in crop-wild hybrids and progenies and inherited between different generations, the transgene may change a certain trait of wild plants, possibly leading to further undesired environmental consequences [25]. Therefore, to evaluate the risk of GM soybean and its hybrids resulting from gene flow, it is necessary to investigate protein expression data for assessing and monitoring the biosafety of GM crops and hybrids; however, previous studies mainly focused on vegetative and reproductive hybrids [13, 23, 24], and the protein levels in hybrid plants were not investigated. In addition, wild soybean seeds have strong dormancy, while cultivated soybean seeds do not [26]. The seed dormancy of the progeny of the hybrid obtained from a cross of wild soybean and GM soybean is still not clear, especially in higher hybrid generations, such as the F₂ and F₃ generations, the hybrid populations will segregate as homozygous resistant plants (RR), heterozygous resistant plants (RS) and homozygous susceptible plants (SS) based on endogenous genes, and the seed dormancy, vegetative growth and fecundity of these three groups are unknown.

As a developing country, China has always attached great importance to the application of GM technology to improve agricultural productivity. After over 20 years of development, GM soybean in China is now closer to the commercialization stage. It is now necessary to monitor the possible gene transfer from GM crops to wild soybean and investigate the characterization of such hybrids before large-scale commercial production of GM soybean. In the present study, we generated and characterized F₁, F₂ and F₃ hybrids between wild soybean and GM soybean lines 40-3-2, and seed dormancy, vegetation and fecundity between herbicide-resistant (homozygous and heterozygous resistant) and susceptible plants in hybrids were measured under greenhouse conditions. The results of this study will provide valuable scientific information for assessing the environmental risk of GM soybeans.

Genotyping assay for F₂ and F₃ generations

QPCR and dPCR assays were used to identify RR, RS and SS genotypes of the F₂ and F₃ populations, a total of 168 F₂ and 123 F₃ populations were submitted to genotype analysis. In this research, the identification and screening of 168 F₂ individuals showed that the F₂ population had 45 RR, 86 RS and 37 SS plants, the frequency of EPSPS genotype showed a 1:2:1 genetic ratio (χ²=0.857, df = 2, p = 0.651, Chi-square test). Among the 123 F₃ population, 38 plants were genotyped as RR, 63 RS, and the remaining 22 SS and F₃ populations were shown to segregate at a ratio of 1:2.86:1.73. The genotype test results are shown in Table S1 and Table S2.

Seed germination and vitality of ungerminated seeds

The 21-day seed germination of GM soybean, wild soybean, and hybrids are shown in Fig. 1. In 2018, GM soybean had the highest total germination rate (93.05%), while wild soybean had the lowest germination rate (14.67%). The F₁ hybrid germination rate (31.48%) was intermediate between that of wild and GM soybeans, and there were significant differences in seed germination between the F₁ hybrid and parental lines.

The germination of GM and wild soybean was similar in different years, and the germination of F₂ and F₃ hybrids was 53.67% and 38.33%, respectively. Both F₂ and F₃ hybrids exhibited intermediate germination between wild and GM soybeans, and significant differences were observed in seed germination between F₂ and F₃ hybrids and the parental lines.

At the end of the germination test, all non-germinated GM seeds were found to be mildewed and rotten; in contrast, most ungerminated wild soybean, F₁, F₂, F₃ seeds seemed normal and did not change in shape, size or color. These seeds were evaluated for their ability to germinate after partial seed coat removal, and the results showed that the five-day seed germination of all observed wild soybean and hybrids was above 87.5% (Table 1).

Table 1

Germination rate of ungerminated seeds after the seed coat was manually removed
Year	Material	Average artificial treatment seed no.	Average no. of germinated seeds	Germination rate (%)
2018	Wild	70 ± 0	68 ± 2	97.14 ± 2.86
	F₁	32	28	87.5
2019	Wild	70 ± 0	65 ± 3	93.33 ± 3.60
	F₂	39 ± 9	35 ± 8	89.08 ± 2.18
2020	Wild	70 ± 0	67 ± 4	95.24 ± 5.95
	F₃	48 ± 4	44 ± 4	91.67 ± 3.22
Note: Data presented are means ± SD.

Aboveground biomass

The average aboveground biomass of the F₁ plants and their hybrid female parent, wild soybean, was not significantly different, 85.35 g versus 82.28 g, respectively. In contrast, the average aboveground biomass of GM plants was significantly higher than that of F₁ and wild soybean (Fig. 2).

The aboveground biomass of the F₂ population and GM soybean was significantly higher than that of wild soybean, and there were no significant differences between the F₂ population and GM soybean in aboveground biomass. Our results also did not show any significant difference among the F₂ population in aboveground biomass.

The total aboveground biomass of the F₃ population ranged from 144.06 g, 138.18 g and 131.54 g for the RR, RS and SS plants, respectively, and no significant differences were found in biomass within the F₃ population. However, F₃ had a significantly higher aboveground biomass (P < 0.05) than wild soybean, while F₃ had slightly higher aboveground biomass than GM soybean, but the difference was not significant.

Fecundity

The pod number per plant of wild soybean and F₁ hybrids was significantly higher than that of GM soybean in 2018. Wild soybean produced 565 pods per plant, while F₁ hybrids produced 353 pods, and a significant difference was observed in the wild soybean and F₁ hybrid groups (Table 2).

F₂ homozygous resistant, heterozygous and homozygous susceptible plants produced 561, 545, and 686 pods per plant, respectively, and no significant differences were found between RR, RS and SS. Analysis of variance also showed that the pod numbers were not significantly different between wild soybean and F₂ hybrids (Table 2).

F₃ hybrids produced a much larger number of pods than GM soybean, and the number was slightly lower than that of wild soybean; however, no significant differences were observed between the two groups. In addition, pod numbers were compared between different genotypes of the F₃ population, and no significant of the parameters differed among RR, RS, and SS.

The seed number and full seed number per plant for wild, GM and hybrid soybeans are shown in Table 2. The seed number and full seed number of wild soybean and the hybrids were significantly higher than those of GM soybean. F₁ hybrids produced 491 seeds and 426 full seeds, which were significantly different from wild soybean, while F₂ and F₃ hybrids had a similar number of seeds as wild soybean.

In three years, GM soybeans had higher 100-seed weights than wild and hybrid soybeans. The F₁ hybrid 100-seed weight was more similar to that of wild soybean, no differences were recorded for 100-seed weight between the F₁ hybrid and wild soybean, however, both F₂ and F₃ hybrids had higher 100-seed weights than their wild soybean counterparts; no parameters significantly differed among RR, RS, and SS in the F₂ or F₃ population.

Table 2

Fecundity of GM, wild, and hybrid soybeans
Year	Material	No. of pods per plant	No. of seeds per plant	No. of full seeds per plant	100-seed weight (g)
2018	GM	122 ± 43c	234 ± 76b	189 ± 66b	17.62 ± 2.85a
	Wild	565 ± 203a	1138 ± 406a	1010 ± 400a	1.91 ± 0.04b
	F₁	353 ± 136b	491 ± 190b	426 ± 174b	1.81 ± 0.22b
2019	GM	116 ± 33b	222 ± 58b	199 ± 54b	18.80 ± 2.00a
	Wild	631 ± 136a	1099 ± 219a	949 ± 230a	1.89 ± 0.05c
	F₂-RR	561 ± 179a	881 ± 274a	829 ± 258a	4.93 ± 0.33b
	F₂-RS	545 ± 122a	923 ± 287a	869 ± 277a	4.81 ± 0.63b
	F₂-SS	686 ± 123a	1009 ± 231a	953 ± 208a	4.47 ± 0.34b
2020	GM	115 ± 40b	252 ± 76b	217 ± 69b	15.34 ± 0.74a
	Wild	564 ± 144a	1122 ± 225a	944 ± 406a	1.98 ± 0.12c
	F₃-RR	549 ± 152a	1053 ± 305a	995 ± 322a	4.95 ± 0.31b
	F₃-RS	524 ± 113a	985 ± 261a	931 ± 251a	4.19 ± 0.26b
	F₃-SS	527 ± 158a	1008 ± 271a	951 ± 273a	4.02 ± 0.21b
Note: Data presented are means ± SD, means with different superscripts in the same column are significantly different (Tukey’s test, P < 0.05). GM genetically modified, RR homozygous resistant, RS heterozygous resistant, SS homozygous susceptible.

CP4-EPSPS protein expression levels in samples

The expression levels of the CP4-EPSPS gene in plant leaf samples were assessed during different growth stages of soybean. The results showed that all wild soybean samples and SS plants were negative for EPSPS expression. In contrast, EPSPS was detectable at different stages in F₁, F₂ RR, F₂ RS, F₃ RR, F₃ RS, and GM plants, and the protein levels in both hybrids and GM soybean were influenced by growth stages. The expression of EPSPS declined significantly as plants matured (Fig. 3). The levels of EPSPS in GM plants ranged between 364.28 and 747.79 µg/g; in F₂ plants, they ranged between 124.15 and 247.89 µg/g, and the protein levels were highest in the R2 stage (230.07 µg/g) and lowest in the R7 stage (74.29 µg/g) in F₃. In addition, similar levels of relative EPSPS expression were observed for F₂ and F₃ RR and RS plants, and there were no significant differences between RR and RS in different plant generations.

Crop-wild/weed hybridization has generated great concerns simply because gene flow can be an avenue for transgene escape, which could alter the genetic make-up of both populations [27, 28]. Evaluation of the fitness of crop-wild hybrids and their parents, especially the wild parents, is a direct way to investigate the potential consequences of crop-to-wild gene flow [29]. In this study, agronomic comparisons were evaluated among GM soybean, wild soybean and their F₁, F₂ and F₃ progenies, with implications for transgene escape from GM soybean varieties, resulting in a better understanding of its consequences.

Seed germination and the viability of ungerminated seeds

Seed dormancy is an important component of plant fitness that causes a delay in germination until the arrival of a favorable growth season [30]. The high seed dormancy of wild soybean is very important for seed survival in the soil and delays seed germination until environmental conditions are correct [12]. If seeds of hybrids between wild and GM soybean could have stronger dormancy like their wild relatives, it may favor the formation of a longer-lived seed bank enriched with the transgenic seeds.

In the present study, 21-day seed germination results showed that, although F₁, F₂ and F₃ hybrid seed germination was significantly higher than that of wild soybean, about half of the F₁, F₂ and F₃ seeds did not germinate, and most ungerminated F₁, F₂, F₃ seeds were deemed normal, i.e., not changed in shaped, size or color. After their partial seed coats were removed, almost all the ungerminated seeds were viable, and the five-day seed germination of all observed hybrid seeds was above 87.5%, suggesting that hybrid derivatives between wild and GM soybean had similar germination characteristics as wild soybean, F₁, F₂ and F₃ hybrid seeds can persist for considerable time in the soil seed bank.

Aboveground biomass

In this study, no significant differences were found in the aboveground biomass between wild soybean and F₁ plants, while the aboveground biomass of the F₂ population and F₃ population was significantly higher than that of their female parent; thus, hybrids between wild soybean and GM soybean, especially F₂ and F₃, had stronger vegetative growth vigor than wild soybean. A similar conclusion was reported by Guan et al. [24], who measured the F₁ and F₂ hybrids of two wild soybeans and glyphosate-resistant soybean under greenhouse and field conditions and found that GM F₁ hybrids had similar dry weights of the aboveground biomass, while both GM and non-GM F₂ had a significantly higher aboveground biomass than wild soybean in the field. Hybrid plants with higher biomass were also observed in Brassica rapa [31, 32], rice [33] and sunflower [34], and the increased growth of hybrids compared with that of wild plants might be due to the paternal parents enhancing the plant performance of the hybrid [34].

Fecundity

F₁, F₂, and F₃ hybrids mainly grew well and produced more pods and more seeds than GM soybean, and their fertility increased similarly to that of wild soybeans. Importantly, there were no significant differences in F₂ and F₃ RR, RS or SS plants in pod and seed numbers per plant, the EPSPS gene and its copy number did not significantly affect the fecundity of the hybrids. In a two-year field experiment, Yook et al. [13] reported that F₁ and F₂ hybrids had a similar number of pods and seeds as wild soybean, and no differences were found for 100-seed weight between F₁ hybrid and wild soybeans; however, F₂ hybrids had a higher 100-seed weight than their wild soybean counterparts. Similar to those of the studies described previously [13], our results also showed that F₂ and F₃ hybrids had significantly higher 100-seed weights than their wild soybean counterparts, and no parameters significantly differed among RR, RS and SS in the F₂ or F₃ population. Our findings and those of previous studies suggest that hybrids possess higher seed production potential [13, 23, 24], the fecundity benefit could confer hybrid more competitive for natural selection than their wild parents.

CP4-EPSPS protein expression levels

To facilitate the biosafety assessment of transgene escape to populations of wild relative species, it is important to conduct scientific research to properly estimate the expression levels of transgenes in wild individuals as well as the inheritance of the transgenes in wild populations [25, 35, 36]. In the present study, ELISA was used to detect CP4-EPSPS protein expression levels at different soybean growth stages, while EPSPS protein was detectable in F₁₋, F₂₋ and F₃-resistant plants. This observation was consistent with the findings of Kubo et al. [26], who also showed that the gene was stably expressed and produced functional protein. Our study and the studies mentioned previously [26] suggest that the transgene will be able to confer tolerance to glyphosate in the new host wild population. In addition, it is worth noting that a significant decline in the total protein content in both hybrids was observed compared to that in GM soybean. Since tolerance to glyphosate is very dependent on EPSPS protein expression levels in plant tissues, a reduction in the amount of endotoxin proteins in hybrids may contribute to the variability in tolerance. Consistent with our results, a similar conclusion was reported by Zhu et al. [35], who also reported a decrease in Bt protein content in transgenic Brassica rapa and crop-weed hybrids. This difference may be associated with a weedy genetic background, positional effects, and the number of transgenes inserted per event [31].

Our study confirmed that the CP4-EPSPS protein was stably expressed in the hybrid soybean line, endowing these hybrid soybeans with herbicide tolerance, and the RR, RS and SS of F₂ or F₃ populations had similar seed germination, aboveground biomass, pod and seed number per plant and 100-seed weight, which indicated that the presence and absence of EPSPS or the copy number of the EPSPS gene were not significantly correlated with vegetative growth and fecundity. In contrast, heterosis between GM and wild soybean raises new competitive advantages for hybrids, allowing hybrids to obtain some similar growth characteristics as female wild soybean, such as seed dormancy, a higher stable grain weight, and greater pod and seed numbers per plant; these growth characteristics could increase the possibility of dispersal of transgenes through seed systems and may adversely affect genetic and species diversity of wild soybean. Thus, it is critical to build effective risk management and control measures for the gene flow of transgenes from GM soybean to wild soybean before commercial planting of GM soybean in China.

In conclusion, the present study was conducted to investigate the agronomic performance of different generation hybrids between GM soybean and wild soybeans as well as inheritance of the EPSPS transgene and its effects on the seed germination rate, aboveground biomass, and fecundity in F₁, F₂ and F₃ populations. Furthermore, the expression of transgenic proteins in various hybrids was also investigated, this is the first study that report on hybrids of higher generation (F₃) and investigate seed dormancy and the protein expression level of the transgene.

Based on the results from this study, we suggest that hybrids between GM soybean and wild soybean had similar germination characteristics and seed productivity as wild parent, such characteristics may increase hybrid plant reproductive success and population viability. Our results provide valuable information regarding environmental risk of GM soybean in China.

Plant materials

Glyphosate-resistant (GR) transgenic soybean 40-3-2 (labeled GM) and wild soybean Jiang pu were used in this study, seeds of both varieties were kindly provided by weeds research laboratory of Nanjing Agricultural University (Nanjing, China). The GM soybean expressing synthetic CP4-EPSPS gene confer tolerance against glyphosate herbicide, and wild soybean accessions used in these crosses were obtained in Jiang pu (32.05°N, 118.62°E), Nanjing, China. The experiment was carried out over four consecutive years, 2017-2020, in a greenhouse at the Key Laboratory on Biosafety of Nanjing Institute of Environmental Sciences. In 2017, using GM plants as the male parent (the pollen donor) and wild soybean as the female parent (the pollen recipient), crosses were performed in July by artificial pollination, and 54 F₁ hybrid seeds were collected in mid-October. The next year (2018), 23 out of 54 F₁ seeds germinated and were subsequently transplanted, and the hybridity of F₁ plants was double checked by spraying with glyphosate (14.4 g/L) and PCR analysis as reported by previous studies [37]. Among these 23 F₁ individuals, 11 plants were glyphosate resistant and were grown in a greenhouse with their parental lines to examine their characteristics and produce second filial generation (F₂) seeds by self-pollination. F₂ hybrids were examined for their characteristics and harvested separately to obtain third filial generation F₃ seeds by self-pollination in 2019, and F₃ individuals were planted to evaluate their traits in 2020.

Seed germination and plant management

In 2018, the 300 seeds from GM and wild soybean samples were grouped into three replicates, and three replicates of 100 seeds each and all 54 F₁ seeds were then placed individually in a 12-well cell culture plate (Corning Costar, New York, USA) with two layers of filter paper. Finally, 400 μL sterile distilled water was added to each well, and plates were kept in climate chambers (Binder model KBF 720, Tuttlingen, Germany) under 55% RH, 25 ± 2 °C and continuous dark conditions for 21 days. The number of germinated seeds per day was recorded (i.e., radicle protrusion > 5 mm) and was expressed as a percentage of the total number of tested seeds (germination percentage). The germinated seeds were removed immediately once they were counted to prevent any counting errors. Germination experiments of GM soybean, wild soybean, hybrid F₂ and hybrid F₃ seeds were carried out under the same experimental conditions in 2019 and 2020.

The germinated seeds were each transplanted and grown in a plastic pot (730 mm × 560 mm × 230 mm) filled with mixed soil containing farmland soil and soil composite (25% peat, 25% compost, 25% perlite, 25% vermiculite) at a ratio of 1:1. A bamboo pole (diameter of 1.5 cm and height of 230 cm) was inserted into the pot and carefully fixed to allow for plant climbing. During the plant growing season, weeds were manually removed from cultivation pots, and agricultural agents such as plant growth regulators, insecticides, and fertilizers were not applied.

Genotyping assay for F₂ and F₃generations

The genomic DNAs of the fresh leaf samples from GM, wild, F₂ and F₃were extracted and purified using a DNeasy® Plant Mini Kit (Qiagen, Hilden, Germany). according to the manufacturer’s instructions. The quality and quantity of the extracted DNAs were determined using absorbance measurements at 260 nm and 280 nm wave lengths and gel electrophoresis with 1% agarose, respectively. High quality genomic DNA (260/280 ratio of ≥ 1.8) were used as a template for qPCR to determine the relative EPSPS gene copy number, and the lectin was used as an endogenous reference gene of soybean in the PCR detection, the sequences of the primers and probes used in the present study are shown in Table 3.

Table 3 Sequences of primers and probes used for the lectin and EPSPS genes

Target gene	Primer	Primer sequence（5'-3'）	Product size
lectin	lectin-F	GCCCTCTACTCCACCCCCA	118 bp
	lectin-R	GCCCATCTGCAAGCCTTTTT
	lectin-P	FAM AGCTTCGCCGCTTCCTTCAACTTCAC-BHQ1
EPSPS	EPSPS-Q-1F	TTCATTCAAAATAAGATCATACATACAGGTT	84 bp
	EPSPS-Q-2R	GGCATTTGTAGGAGCCACCTT
	EPSPS-Q-1P	FAM-CCTTTTCCATTTGGG-BHQ

TaqMan real-time PCR

TaqMan real-time PCR assays were performed using an ABI 7900HT thermocycler (Applied Biosystems, United States). 25 μL of PCR mixture for each reaction contained 12.5 HR qPCR Master Mix (Huirui biotechnology, China),0.4 μL of 10 μM forward and reverse primers, 0.2 μL of 10 μM probe, 6.5 μL of nuclease free water, and 5 μL of test sample DNA. The cycling conditions were amended to 95°C for 15 s, followed by 45 cycles of 95°C for 15 s and 60°C for 60 s. To obtain reliable results, Ct values and the ∆Ct between the Ct for the transgene and the Ct for the endogenous control were used to determine which plants contained the transgene. Samples were considered positive for amplicon production when the lectin gene Ct values and EPSPS gene Ct values were both < 35, and the amplification plot clearly demonstrated an exponential increase in the reporter signal in duplicate PCRs. A negative result was assigned when lectin gene Ct values < 35 and no amplification of the EPSPS gene occurred. Samples with lectin gene Ct values < 35 and EPSPS gene Ct values > 35 were considered indeterminant and required repeat testing.

Digital PCR

Samples testing positive by real-time PCR were analyzed for lectin and EPSPS copy number by digital PCR. The digital PCR reaction mixtures were prepared as 20 μL total volumes, which included 10 μL 2 × ddPCR Supermix (Bio-Rad Laboratories, Hercules, CA), 0.4 μL each of the forward and reverse primers, 0.2 μL probe, 1 μL DNA (20 ng/μL), and 8 μL RNase/DNase-free water. Droplets were generated using 20 uL reaction mixture and 70 uL oil with the QX200 Droplet Generator (Bio-Rad Laboratories). Droplet-partitioned samples were then transferred to a 96-well PCR plate, sealed and cycled in a T100 Thermal Cycler (Bio-Rad) under the following cycling protocol: 95℃ for 10 min (1 cycle); then 40 cycles of 95℃ for 15 s and 57.7℃ for 1 min; 98℃ for 10 min, and then held indefinitely at 4℃. After thermal cycling, droplets were analyzed for positive and negative signals using the QX200 droplet reader (Bio-Rad Laboratories). For each digital PCR sample, the same process was performed in triplicate. Data analysis was performed when the number of droplets produced was more than 8000. The copy number ratio, which is expressed as a ratio between target and reference lectin genes for each DNA sample, was calculated and directly used as an indicator for identifying heterozygous and homozygous individuals. A copy number ratio close to 1 would suggest that the sample is a homozygous individual, and a copy number ratio close to 0.5 would suggest a heterozygous individual.

Investigation of plant characteristics

Recycling of ungerminated seeds for viability tests

At the end of the germination test, all ungerminated seeds were carefully collected and dried again at 25 °C to evaluate the seed’s ability to germinate. All normal-shaped seeds were selected, partial seed coats were removed by scraping a small portion of the seed coat with a knife, and seed germination was examined as previously described.

Aboveground biomass

Before the pod color turned from green to brown or blank, each plant was bagged loosely with a 1-mm nylon mesh to prevent seeds from splashing. At maturity, 10 plants of each material were randomly selected and then dried for one week at 70 °C, and total biomass was recorded using a balance (PB602-N, Mettler Toledo, Nänikon-Uster, Switzerland).

Fecundity

Ten competitive plants were selected from each genotype at random for recording the number of pods per plant, number of seeds per plant, number of full seeds per plant and 100-seed weight.

CP4-EPSPS protein expression levels in samples

Leaf samples were collected at the vegetative growth stage (V2) [38], flowering stage (R1), podding stage (R3) and mature stage (R7). All samples were quick-frozen with liquid nitrogen and stored at -70 °C for the estimation of EPSPS protein.

The protein was determined by ELISA using EPSPS detection kits (Envirologix, Portland, USA). Ten milligrams of each leaf sample were suspended in 1 mL of phosphate-buffered saline containing Tween 20 (PBST buffer), which was supplied as part of the kit, and all procedures were performed according to the manufacturer's instructions. The absorption was measured on a microplate reader (Infinite M200, Tecan Group Ltd., Männedorf, Switzerland) at 450 nm.

Statistical analysis

SPSS 20.0 software was used for statistical analyses. One-way ANOVA was used for comparison of the groups. Tukey's multiple comparison test was used to determine the significance of the differences between groups, which were considered significant at P < 0.05.

GM

genetically modified

RR

homozygous resistant

RS

heterozygous resistant

SS

homozygous susceptible

Ethics approval and consent to participate

All experiments and methods were performed in accordance with relevant guidelines and regulations.

Consent for publication

Not applicable.

Availability of data and materials

The data used in this study are available from the corresponding author on reasonable request.

Competing interests

The authors declare that there are no conflicts of interest.

Funding

The present research was supported by the National Natural Science Foundation of China (32171656), the National Special Transgenic Project of China (2019ZX08013011-001-006, 2016ZX08012005), and the Basic Scientific Research Program of National Nonprofit Research Institutes (GYZX200103).

Author’s contributions

LZ conducted the experiments, analyzed the data, and wrote the manuscript. LZ and BL designed research. LPL, ZXF, WJS and YD participated in the experiments and assisted in analyzing the data. RZJ, JGL and BL reviewed and revised the manuscript. All authors read and approved the final manuscript.

Acknowledgments

Not applicable.

ISAAA (The International Service for the Acquisition of Agribiotech Applications). Global status of commercialized biotech/GM crops: 2018. China Biotechnol. 2019;39(8):1–6.
Kamthan A, Chaudhuri A, Kamthan M, Datta A. Genetically modified (GM) crops: milestones and new advances in crop improvement. Theor Appl Genet. 2016;129(9):1639–55.
Raman R. The impact of Genetically Modified (GM) crops in modern agriculture: A review. GM Crops and Food. 2017;8:195–208.
Romeis J, Bartsch D, Bigler F, Candolfi MP, Gielkens MMC, Hartley SE, et al. Assessment of risk of insect-resistant transgenic crops to nontarget arthropods. Nat Biotechnol. 2008;26:203–8.
Lazebnik J, Dicke M, Braak CT, Loon-Van JJA. Biodiversity analyses for risk assessment of genetically modified potato. Agr Ecosyst Environ. 2017;249:196–205.
Song XL, Wei ZH, Zuo J, Huangfu CH, Qiang SH. Potential gene flow of two herbicide-tolerant transgenes from oilseed rape to wild B. juncea var. gracilis. Theor Appl Genet. 2010;120(8):1501–10.
Devos Y, Ortiz-García S, Hokanson KE, Raybould A. Teosinte and maize × teosinte hybrid plants in Europe-Environmental risk assessment and management implications for genetically modified maize. Agr Ecosyst Environ. 2018;259(1):19–27.
Peng C, Yan K, Shao H, Zhao SJ. Physiological mechanisms for high salt tolerance in wild soybean (Glycine soja) from yellow river delta, China: photosynthesis, osmotic regulation, ion flux and antioxidant capacity. PLoS ONE. 2013;8:e83227.
Nakayama Y, Yamaguchi H. Natural hybridization in wild soybean (Glycine max ssp. soja) by pollen flow from cultivated soybean (Glycine max ssp. max) in a designed population. Weed Biol Manag. 2002;2(1):25–30.
Mizuguti A, Yoshimura Y, Matsuo K. Flowering phenologies and natural hybridization of genetically modified and wild soybeans under field conditions. Weed Biol Manag. 2009;9(1):93–6.
Liu B, Xue K, Liu LP, Shen WJ, Guo H. Research on the gene flow from transgenic EPSPS + PAT soybean S4003.14 to non-transgenic soybeans. J Ecol Rural Environ. 2020;36(7):367–73.
Wang KJ, Li XH. Fundamental strategies and methods for collection of wild soybean germplasm resources in China. J Plant genetic Resour. 2012;013(3):325–34.
Yook MJ, Park HR, Zhang CJ, Lim SH, Kim DS. Environmental risk assessment of glufosinate-resistant soybean by pollen-mediated gene flow under field conditions in the region of the genetic origin. Sci Total Environ. 2020;762(2):143073.
Snow AA. Transgenic crops-why gene flow matters. Nat Biotechnol. 2002;20:542.
Lu BR, Xia H. Environmental biosafety of transgenic plants: research and assessment of transgene escape and its potential ecological impacts. Chin Sci Bull. 2011;23(2):186–94.
Hails RS, Morley K. Genes invading new populations: a risk assessment perspective. Trends Ecol Evol. 2005;20(5):245–52.
Weis AE. Assessing the ecological fitness of recipients. In: Poppy GM, Wilkinson MJ. Gene flow from GM plants. Oxford: Blackwell; 2005. p.143 – 68.
Allainguillaume J, Alexander M, Bullock JM, Saunders M, Allender CJG, King CSF, et al. Fitness of hybrids between rapeseed (Brassica napus) and wild Brassica rapa in natural habitats. Mol Ecol. 2010;15(14):1175–84.
Burke JM, Rieseberg LH. Fitness effects of transgenic disease resistance in sunflowers. Science. 2003;300(5623):1250.
Snow AA, Pilson D, Rieseberg LH, Paulsen MJ, Pleskac N, Reagon M, et al. A Bt transgene reduces herbivory and enhances fecundity in wild sunflowers. Ecol Appl. 2003;13(2):279–86.
Halfhill MD, Sutherland JP, Moon HS, Poppy GM, Warwick SI, Weissinger AK, et al. Growth, productivity, and competitiveness of introgressed weedy Brassica rapa hybrids selected for the presence of Bt cry1AC and gfp transgenes. Mol Ecol. 2005;14(10):3177-89.
Yang X, Xia H, Wang W, Wang F, Su J, Snow AA, et al. Transgenes for insect resistance reduce herbivory and enhance fecundity in advanced-generations of crop-weed hybrids of rice. Evol Appl. 2011;4:672–84.
Kan GZ, Tong ZF, Hu ZB, Ma DY, Zhang GZ, Yu DY. Fitness of hybrids between wild soybeans (Glycine soja) and the glyphosate-resistant transgenic soybean (Glycine max). Soyb Sci. 2015;34:177–84.
Guan ZJ, Zhang P, Wei W, Mi XC, Kang DM, Liu B. Performance of hybrid progeny formed between genetically modified herbicide-tolerant soybean and its wild ancestor. Aob Plants. 2015;7:plv121.
Lu BR. Transgene escape from GM crops and potential biosafety consequences: an environmental perspective. Int Centre Genetic Eng Biotechnol Collect Biosaf Reviews. 2008;4:66–141.
Kubo A, Aono M, Nakajima N, Nishizawa T, Tamaoki M, Saji H. Characterization of hybrids between wild and genetically modified glyphosate-tolerant soybeans. Plant Biotechnol-Nar. 2013;30(4):335–45.
Ellstrand NC, Holfman CA. Hybridization as an avenue of escape for engineered genes. Bio Sci. 1990;40(6):438–42.
Song ZP, Lu BR, Bin W, Chen JK. Fitness estimation through performance comparison of F₁ hybrids with their parental species Oryza rufipogon and O. sativa. Ann Bot-London. 2004;3:311–16.
Snow AA, Moran-Palma P, Rieseberg LH, Wszelaki A, Seiler GJ. Fecundity, phenology, and seed dormancy of F₁ wild-crop hybrids in sunflower (Helianthus annuus, Asteraceae). Am J Bot. 1998;85(6):794–801.
Graeber K, Nakabayashi K, Miatton E, Leubner-Metzger G, Soppe WJJ. Molecular mechanisms of seed dormancy. Plant Cell and Environ. 2012;35:1769–86.
Moon HS, Halfhill MD, Good LL, Raymer PL, Stewart CN. Characterization of directly transformed weedy Brassica rapa and introgressed B. rapa with Bt cry1Ac and gfp genes. Plant Cell Rep. 2007;26(7):1001–10.
Stewart C, All JN, Raymer PL, Ramachandran S. Increased fitness of transgenic insecticidal rapeseed under insect selection pressure. Mol Ecol. 2010;6(8):773–79.
Langevin SA, Clay K, Grace JB. The incidence and effects of hybridization between cultivated rice and its related weed red rice (Oryza sativa L.). Evolution. 1990;44(4):1000–08.
Mercer KL, Andow DA, Wyse DL, Shaw RG. Stress and domestication traits increase the relative fitness of crop-wild hybrids in sunflower. Ecol Lett. 2007;10(5):383–93.
Zhu B, Lawrence JR, Warwick SI, Mason P, Stewart CN. Stable Bacillus thuringiensis (Bt) toxin content in inter specific F₁ and backcross populations of wild Brassica rapa after Bt gene transfer. Mol Ecol. 2004;13(1):237–41.
Lu BR, Snow AA. Gene flow from genetically modified rice and its environmental consequences. Bioscience. 2005;55(8):669–78.
Sumarji S. Detektion soybean (Glycine Max L Merrill) transgenic GTS 40-3-2 herbiside resistant active based glyphosate PCR using. Int J Environ Sci Te. 2017;12(4):563–76.
Fehr WR, Caviness CE, Burmood DT, Pennington JS. Stage of development description for soybeans, Glycine max (L.) Merrill. Crop Sci. 1971;11:929–31.

supplementaryinformation.docx

Risk assessment of transgene introgression from genetically modified soybean into its wild relatives

Status:

Journal Publication

Version 1

Abstract

Figures

Background

Results

Genotyping assay for F₂ and F₃ generations

Seed germination and vitality of ungerminated seeds

Aboveground biomass

Fecundity

CP4-EPSPS protein expression levels in samples

Discussion

Seed germination and the viability of ungerminated seeds

Aboveground biomass

Fecundity

CP4-EPSPS protein expression levels

Conclusions

Methods

Abbreviations

Declarations

References

Supplementary Files

Status:

Journal Publication

Version 1

Risk assessment of transgene introgression from genetically modified soybean into its wild relatives

Status:

Journal Publication

Version 1

Abstract

Figures

Background

Results

Genotyping assay for F2 and F3 generations

Seed germination and vitality of ungerminated seeds

Aboveground biomass

Fecundity

CP4-EPSPS protein expression levels in samples

Discussion

Seed germination and the viability of ungerminated seeds

Aboveground biomass

Fecundity

CP4-EPSPS protein expression levels

Conclusions

Methods

Abbreviations

Declarations

References

Supplementary Files

Status:

Journal Publication

Version 1

Genotyping assay for F₂ and F₃ generations