Virulence of Beauveria sp. and Metarhizium sp. fungi towards Fall armyworm (Spodoptera frugiperda)

doi:10.21203/rs.3.rs-1833011/v1

Download PDF

Research Article

Virulence of Beauveria sp. and Metarhizium sp. fungi towards Fall armyworm (Spodoptera frugiperda)

https://doi.org/10.21203/rs.3.rs-1833011/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Since 2016, the fall armyworm (Spodoptera frugiperda, J.E. Smith) has spread from the Americas to invade many regions of the world, including Australia in early 2020. The development of effective pest management strategies for S. frugiperda is a high priority for crop protection. In the invasive range, the degree to which endemic biological control agents can constrain S. frugiperda remains sparsely investigated. This study examines 11 isolates of fungi including six Beauveria isolates and five Metarhizium isolates from Oceania for their potential as S. frugiperda biocontrol. Two Beauveria isolates (B-0571, B-1311) exhibited high virulence toward S. frugiperda caterpillars and adults. The overall mortalities over seven days in 3^rd and 6^th instar caterpillars and moths (respectively) for B-0571 was 82.81±5.75, 61.46±6.83, and 93.75±3.61, and for B-1311 was 73.72±2.51, 71.88±5.41, and 97.92±2.08%. The majority of deaths in the caterpillars occurred within the first 24 hours (3^rdinstar control 0.74±0.33%, B-0571 73.96±7.85 and B-1311 62.08±3.67%; 6^thinstar control 0%, B-0571 66.67±11.02% and B-1311 62.5±9.55%). Infection from both isolates fully prevented reproduction in surviving S. frugiperda females. The two isolates, however, cause a significantly lower mortality in a native noctuidae species: Helicoverpa armigera (3^rd instar B-0571 44.79±4.54% and B-1311 19.80±7.51%). The discovery of two fungal isolates with high virulence to S. frugiperda caterpillars and adults opens new avenues for the development of biological control tools for this invasive moth pest. Such tools may also provide additional options for control of native pest lepidoptera, and reduce selection pressure for resistance to Bt and synthetic insecticides.

entomopathogenic fungi

agricultural pest

biocontrol

sustainable pest management

bioassay

- Two isolates of Beauveria sp. (B-0571 and B-1311) show high virulence against S. frugiperda 3^rd and 6^th instar caterpillars and moths

- The majority of deaths in S. frugiperda caterpillars occurred in the first 24 hours

- Infection of B-0571 and B-1311 inhibits S. frugiperda moths from producing offspring

- B-0571 and B-1311 manifest significantly lower virulence against 3^rd instar H. armigera

The fall armyworm, Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae), is an invasive moth species that was detected in the Torres Strait Islands, Australia, in late January 2020 (Victoria State Government 2020). By the end of 2020, it had been detected widely across mainland Australia (International Plant Protection Convention 2020; Government of Western Australi 2021). Spodoptera frugiperda is native to the tropical regions of the American continents (Southern United States to Argentina) where it is a serious pest of agricultural production (Capinera 1969; Andrews 1980). In 2016, S. frugiperda was confirmed outside of its native range in West Africa, where and significant economic damage followed quickly. In 2017, 12 African countries lost approximately 8.3-20.6M tonnes of maize (2.5-6.2B USD) to this species (Day et al. 2017). Although the preferred host of S. frugiperda caterpillars is maize, it has been recorded on over 350 plant species and commonly feeds on sorghum, wheat, cotton, sugarcane, and various vegetables (Montezano et al. 2018). Spodoptera frugiperda has a high reproductive rate; a single female can lay more than 2,000 eggs in her lifetime (Capinera 1969). It is also able to disperse over long distances, especially with prevailing winds, when hosts are limiting (Westbrook et al. 2016), and in response to season and weather (Westbrook et al. 2019). Due to economic damage, polyphagy, fecundity, and dispersion from mobility, and transportation of infested product (Tay et al. 2022b), S. frugiperda has quickly become a major threat to agricultural production in many countries in Africa (Goergen et al. 2016; Cock et al. 2017; Agboyi et al. 2020; Fan et al. 2020), Asia (Ganiger et al. 2018; Trisyono et al. 2019; Baloch et al. 2020; Lee et al. 2020; Kandel and Poudel 2020; Zaimi et al. 2021; Zhou et al. 2021; Wu et al. 2022), and Australasia (Piggott et al. 2021; Tay et al. 2022a). There is now high demand for effective and sustainable management tools to reduce economic impact across its invasive range.

Globally, pest management strategies to control S. frugiperda have relied heavily on synthetic insecticides and genetically modified Bt crops, which has promoted the development of insecticide resistance (Togola et al. 2018). Spodoptera frugiperda populations have developed resistance to several synthetic insecticides in both their native range (Yu et al. 2003; León-García et al. 2012; Garlet et al. 2021) and recently colonised regions (e.g., indoxacarb, chlorpyrifos, and malathion) (Zhao et al. 2020; Zhang et al. 2020; Kulye et al. 2021). Additionally, resistance to Bt proteins including various Cry1 proteins (Storer et al. 2010; Jakka et al. 2014; Huang et al. 2014; Gutierrez et al. 2015; Monnerat et al. 2015; Leite et al. 2016), Cry2Ab2 (Niu et al. 2016), and Vip3Ac (Yang et al. 2018) have also been detected in their native range. Resistance to Bt proteins has not yet been detected in invasive S. frugiperda populations (Botha et al. 2019; Liang et al. 2021; Tay et al. 2022b). However, the rapid spread of S. frugiperda across the recent invasive range appears to reflect multiple introduction events (Schlum et al. 2021; Tay et al. 2022b). It is likely that the invasive S. frugiperda populations carry varying levels of susceptibility towards synthetic insecticides and Bt transgenic plants (Eriksson 2019; Worku Bogale and Andargie 2019; Boaventura et al. 2020; Zhao et al. 2020; Lv et al. 2021; Zhang et al. 2021; Kulye et al. 2021; Tay et al. 2022a). Current pest control strategies would benefit from incorporation of alternative biological control options both to improve overall control and to reduce selection pressure for insecticide resistance.

Biological control, which utilises a pest’s natural enemies including predators, parasites (e.g., parasitic wasps, parasitic nematodes), competitors and pathogens (e.g., fungi, bacteria, and viruses) to suppress populations (Flint et al. 2002), is a pillar of integrated pest management (IPM) strategies. Unlike most synthetic insecticides, biological control agents are often host specific and hence tend to have less effect on non-target species and the broader environment (Dodd 1959; Muthukumar et al. 2007; Geiger et al. 2010; Kumar and Singh 2015; Mills et al. 2016; Blossey et al. 2018; Cernava et al. 2019; Nawaz et al. 2021). There are many examples of successful biological control agents globally including parasitic wasps (Trichogramma spp.) to control lepidopteran pests in China (Liu et al. 2014; Wang et al. 2014), cactus moth (Cactoblastis cactorum) to control prickly pear in Australia (Dodd 1959), and entomopathogenic fungus (Beauveria bassiana) to control coffee berry borer (Hypothenemus hampei) in Colombia (Aristizábal et al. 2016) and many more (van Lenteren et al. 2018). In India and Uganda, various species of parasitic wasps and nematodes, predatory insects, and fungi have been implicated as playing important roles in suppressing S. frugiperda populations (Firake and Behere 2020; Visalakshi et al. 2020; Otim et al. 2021), highlighting the potential value of biological control, particularly within broader IPM systems.

With respect to efficiency, sustainability, and economic perspectives, entomopathogenic fungi (EPF) that can infect and utilise insects as a host for development as part of their life cycle (Shah and Pell 2003; Dillman et al. 2012), are well-suited as biological control tools. Under ideal conditions, EPF can cause epizootics to significantly reduce the population of insect pests by up to 90% (Lovett and St. Leger 2018). The majority of EPF infect insects by enzymatically degrading the insect cuticle follow by penetrating the hemocoel, where they often cause nutritional deficiency and host death (Shah and Pell 2003; Trakimas et al. 2019). In some cases, EPF also produce bioactive compounds that accelerate infection by suppressing the host’s immune system and/or being toxic to the host itself or microbial competitors (Donzelli and Krasnoff 2016; Mondal et al. 2016). They then germinate from the insect carcass and disperse to other insect hosts. EPF can provide an excellent alternative to synthetic insecticides as both a standalone tool or as an IPM component (Roberts and Hajek 1992). As of 2016, there are approximately 1,604 species and isolates of EPF that have been identified globally (St Leger and Wang 2010; Araújo and Hughes 2016), and more than 170 EPF-based biopesticides that have been commercially developed (both registered and unregistered) worldwide to combat diverse insect pests (e.g., beetles, weevils, termites) (Clifton et al. 2020).

Numerous EPF are known to affect Australian insects in nature. However, S. frugiperda is a recently established species, and the ability of regional EPF to infect this species is currently unknown. There is a high probability that some locally available EPF that infect other lepidopteran species will also be pathogenic to S. frugiperda. The present study assesses the virulence of both Australian and regional endemic EPF isolates from the Commonwealth Scientific and Industrial Research Organisation (CSIRO) fungal collection (established by Dr Richard J. Milner) towards S. frugiperda, with the ultimate goal of identifying EPF that might be suitable for development as biological control agents to protect crops from this pest.

2.1 Fungal isolates

Eleven fungal isolates were obtained from the CSIRO fungal collection (Black Mountain Laboratories, Canberra, Australia). These included six isolates of Beauveria sp. (B-0016, B-0077, B-0079, B-0571, B-0698 and B-1311) and five isolates of Metarhizium sp. (M-0121-0123 and M-0999-1000) that originated from lepidopteran hosts (Table 1, Figure 1). The spores of these isolates were freeze dried and preserved at -80°C. The fungi were revived and cultured on Sabouraud dextrose agar media with 1% yeast extract (SDAY; pH 5.6) and incubated at 28±1°C, 50±10% relative humidity and under dark conditions.

Table 1. The fungal isolate code, fungal species, lepidopteran host species, geographic origin, and collection date of the fungal isolates from the CSIRO Black Mountain fungal collection.

Isolate code	Species	Host species	Geographic origin	Collection date
B-0016	Beauveria sp.	Oncopera alboguttata	Ebor, NSW, Australia	13/02/1980
B-0077	Beauveria sp.	Australian native budworm (Helicoverpa punctigera)	Geraldton, WA, Australia	18/09/1984
B-0079	Beauveria sp.	Monarch butterfly (Danaus plexippus)	QLD, Australia	11/10/1984
M-0121	Metarhizium sp.	Oncopera alboguttata	Ebor, NSW, Australia	17/12/1985
M-0122	Metarhizium sp.	Oncopera alboguttata	Ebor, NSW, Australia	17/12/1985
M-0123	Metarhizium sp.	Oncopera alboguttata	Ebor, NSW, Australia	15/01/1986
B-0571	Beauveria sp.	Helicoverpa sp.	Lucerne, Gatton, QLD, Australia	24/01/1990
B-0698	Beauveria sp.	Oxycanus sp.	Canterbury Plains, SI, New Zealand	8/10/1990
M-0999	Metarhizium sp.	Spodoptera sp.	Cameron Highland, Pahang, Malaysia	11/05/1993
M-1000	Metarhizium sp.	Spodoptera sp.	Cameron Highland, Pahang, Malaysia	11/05/1993
B-1311	Beauveria sp.	Emperor gum moth (Opodiphthera eucalypti)	Dorrigo, NSW, Australia	10/03/1999

2.2 Fungal identification

To extract fungal genomic DNA (gDNA) for species identification, a mass of the fungal colony was collected from the SDAY plate and transferred into 300μl cell lysis buffer. Following this, 20μl of proteinase K was added and incubated at 58°C for 16-20 hours overnight. The rest of the DNA extraction process was performed using a JetFlex™ Genomic DNA Purification Kit (Cat. no. A30701) following the manufacturer’s tissue extraction protocol. gDNA was re-suspended by 30μl adding TE buffer and incubated at 25±1℃ for 16-20 hours overnight. The purity and quantification of gDNA results were assessed using gel electrophoresis and on the Qubit 2.0 fluorometer (Life Technologies Corporation). The extracted DNA from each isolate was then stored at -20°C.

To determine genera/species of fungal candidates, the ITS1-5.8-ITS2 region of the nuclear ribosomal DNA (rDNA) was amplified via polymerase chain reactions (PCR) using universal primers ITS1 (5’TCCGTAGGTGAACCTGCGG) and ITS4 (5’TCCTCCGCTTATTGATATGC) (Raja et al. 2017). The PCRs were conducted using Platinum™ Taq DNA Polymerase kits (ThermoFisher, 10966018), 10mM dNTP set (ThermoFisher, 10297117), 0.2µM of each universal ITS1 and ITS4 primers, 2mM of MgCl_2,and 2µL of extracted genomic DNA, made up to a final 50µL PCR volume with UltraPure™ DNase/RNase-Free Distilled Water (ThermoFisher, 10977015). The PCR reaction was prepared by following Platinum™ Taq DNA Polymerase protocols. A temperature gradient PCR was conducted following the protocol described by (Oliveira et al. 2012). This began with an initial denaturation step at 94°C for 3 mins, followed by 35 cycles of 30 seconds at 94°C, then 30 seconds at 55°C for the annealing process, the template extension step at 72°C for 1 min, and a final 10-min extension cycle at 72°C. The PCR was carried out on a C1000 Touch™ Thermal Cycler (BIO-RAD).

The purification used 10µL of the PCR product and followed the manufacturer’s instructions using a QIAquick PCR purification kit (Qiagen, 28106). The purified PCR product was diluted with 30µL of UltraPure™ DNase/RNase-Free Distilled Water (ThermoFisher, 10977015) and stored at -20˚C. For Sanger sequencing, PCR amplicons were sent to the Biomolecular Resource Facility at John Curtin School of Medical Research, Australian National University (ANU), Canberra, Australia.

The fungal ITS sequences analysed were edited using Pregap and Gap4 (Staden package 2.0.0b11-2016 (Staden et al. 1999) and Geneious Prime 2021.2 (Biomatters Inc., Auckland, New Zealand). Sequences were aligned using MUSCLE (multiple sequence comparison by log-expectation) 3.8.425 (Edgar 2004) within Geneious based on default parameters (group sequences by similarity with eight iterations) prior to trimming to 538bp (Beauveria spp.) and 534bp (537bp with gaps) (Metarhizium spp.). Sequences were identified by homology using Basic Local Alignment Search Tool (BLAST (Madden 2003) via Geneious (2022.1.1) with default settings (NCBI Nucleotide collection with Megablast). The species of each isolate was tentatively identified based on the likelihood (% nucleotide identity) against the reported reference sequences from GenBank.

The maximum-likelihood (ML) phylogenetic trees of the CSIRO Beauveria and Metarhizium isolates were aligned using MAFFT (Katoh and Standley 2013) within Geneious v11.1.5 and gaps were visually re-aligned where necessary prior to being constructed using IQ-Tree (Trifinopoulos et al. 2016) with automatic evolutionary model selection, and node confidence estimated using 1,000 bootstrap resamplings via UF-Boot (Minh et al. 2013). The ITS sequences of Beauveria spp. and Metarhizium spp. for comparison were obtained from the NCBI GenBank DNA database (Table 2) with the sequences having ≥97% identical sites (following the number of identical sites in previous studies (Izzo et al. 2005; Smith et al. 2007; Ryberg et al. 2008; Giusti et al. 2021)) to the CSIRO fungal isolates. Visually re-aligned ITS sequences of Beauveria and Metarhizium spp. are provided as Suppl. Data 1 and 2, respectively. IQ-Tree output consensus tree files were exported in Newick format for manually manipulation and presentation using Dendroscope (Huson et al. 2007).

Table 2. Reference ITS sequences from related Beauveria and Metarhizium species and their respective GenBank accession numbers used in the PhyML phylogenetic analyses.

NCBI Accession number	Species	References
MN833071	B. felina	(Ramanujam et al. 2021)
OL375169	B. bassiana	(Rajula et al. 2021)
OL375165	B. bassiana
OL375168	B. bassiana
OL375170	B. bassiana
OL375173	B. bassiana
OL375167	B. bassiana
JF837121	B. bassiana	(Ramanujam et al. 2020)
MN602591	M. rileyi
MN907775	M. rileyi
JF837146	M. anisopliae
JF837154	M. anisopliae
KJ728726	N. rileyi	(Visalakshi et al. 2020)
KJ728725	N. rileyi
MH860365	M. rileyi
JQ686668	N. rileyi
KY436756	M. rileyi
MF681620	M. robertsii	(Hernandez-Trejo et al. 1970)

2.3 Insect samples

The research was conducted using lab colonies of two pest noctuids: the recently established S. frugiperda and the endemic H. armigera (subspecies ‘conferta’ (Hardwick 1965; Anderson et al. 2016; Pearce et al. 2017; Zhang et al. 2022); hereafter as ‘H. armigera’). The S. frugiperda colony was initially collected from Walkamin, Queensland, Australia (Tay et al. 2022a, b), while the H. armigera colony was originally established from cotton fields in the Namoi Valley, northern NSW Australia. Both have been reared at CSIRO in Canberra from 6^th of March 2020 (S. frugiperda) and the mid-1980s (H. armigera).

Fertilised eggs were collected and transferred to a plastic bag and allowed to hatch overnight under standard rearing conditions (25±1℃, 50±10% relative humidity, and 14:10 day-night lighting). After 24-48 hours, 1^st instar caterpillars were gently placed into 45-well plates filled with the respective S. frugiperda (see Suppl. data 1) and H. armigera artificial diet (Apirajkamol et al. 2020). Once the caterpillars reached the 3^rd instar stage, they were transferred into 32-well plates filled with an S. frugiperda or H. armigera artificial diet. Upon pupation, 40 pupae were randomly selected and transferred to a moth rearing basket that contained a honey solution (Apirajkamol et al. 2020) for nutrition. After approximately two weeks, the moths emerged, mated, and began to lay fertilised eggs. To maintain the population, those eggs were collected and reared through to adult following the steps described above.

2.4 Spore collecting, concentration, and viability

To collect fungal spores, 10ml of 0.1(v/v) % Tween 80^® solution was poured onto a culture plate and the surface of the fungal colony gently scraped to release the spores. The spore suspension was collected using a single channel automatic micropipette and stored at 4°C for 3-5 days. The spore concentration was estimated using Haemocytometer (Bright-Line^®, Z359629) and a light microscope (Olympus, CX40-PH).

Spore viability was analysed following a protocol modified from (98). The spore suspensions were diluted into 1-3x10^-3 spore/ml concentration with 0.1%(v/v) Tween 80^® solution, then the diluted spore suspension was plated (100µL) onto SDAY media. After 2-5 days of incubation the number of colonies were counted, and spore viability was calculated. For the bioassay, we ensured that the spore concentration was ≥ than 10⁷ conidia/ml and ≥85% viable. To generate reliable data, the spore count and viability was performed in three technical replications.

2.5 Insect bioassays

The development of study samples was closely monitored and randomly collected for use in the bioassay experiments upon reaching early-3^rd instar, 6^th instar caterpillars, pupae (within three days of pupation), and moths (within a day of emergence).

Third instar S. frugiperda and H. armigera grow at variable rates, which could lead to misleading results if insects varied in size between treatments and if there is an association between size and susceptibility to pathogens. To check for size differences in samples of different treatments, a quarter of the samples in each treatment were randomly selected, weighed and compared.

To infect the study samples, 3^rd instar caterpillars (N = 32), 6^th instar caterpillars (N = 16), pupae (N = 16 unsexed), and moths (eight females and eight males) were submerged for three seconds in 0.1% Tween 80^® (control) or fungal suspensions. Infected samples were placed into 32-well plates filled with artificial diet for caterpillars and clean 32-well plate for pupae. Moths were transferred to a cylinder-shaped plastic container with a honey solution provided to allow them to mate (one pair per container). Infected and control samples were then reared under standard insect rearing conditions (see above) for 7 – 14 days. Mortality of the treated and control samples was recorded daily for caterpillars and moths, and two weeks following infection for pupae. Fecundity, and fertility of treated and control adult S. frugiperda was also recorded daily following infection.

2.6 Statistical analysis

To estimate overall mortality caused by the candidate EPF treatments, the number of dead insects in treated samples was subtracted from the number of dead insects in respective control samples. While the cumulative and daily mortality are presented as is. The bioassay experiments were conducted with at least three biological replications, and the means were statistically compared.

Overall and daily mortality were statistically analysed using R version 4.1.0 (released 18-5-2021). One-way ANOVA was used to identify group differences, and the Tukey HSD (Honestly Significant Difference) post-hoc test with a 95% confidence interval was used to determine significant differences between treatments while taking into account the ≥3 replications. Tukey’s HSD was chosen to reduce the possibility of accepting false null hypothesis (false negative) from a high standard deviation or rejecting a true null hypothesis (false positive) from a high familywise error rate because of the number of treatments.

The R Packages used to perform the analyses included tidyverse for data manipulation (Wickham 2011), TukeyC (Faria et al. 2014) for the Tukey HSD analysis and homogenous subset result output, ggplot2 (part of the tidyverse metapackage), and ggtext (Wickham 2011) for graph creation.

3.1 Fungal Isolate Species identification

The ITS sequence results suggest that the six candidate Beauveria fungal isolates (B-0016, B-0077, B-0079, B-0571, B-0698, and B-1311) have a high percentage of nucleotide identity (97-100%) to the many Beauveria spp. reference sequences. The six CSIRO Beauveria isolates were clustered with both B. bassiana and B. brongniarti with strong bootstrap support (88%) based on ITS sequence phylogeny (Figure 2) as indicated by blue dashed-line box (note that Cordyceps bassiana and C. brongniartii are anamorphs of B. bassiana (Sung et al. 2006) and B. brongniartii (Shimazu et al. 1998; Sasaki et al. 2007), respectively). The phylogenetic position of B. brongniattii is also less certain with NR_111595 being found outside of this main clade (Figure 2).

The ITS sequences of the five CSIRO Metarhizium fungal isolates (M-0121-123 and M-0999-1000) matched GenBank deposited ITS sequences (97-100% identical sites) of various Metarhizium and Metacordyceps species. The phylogenetic tree constructed with ITS sequences from the five CSIRO Metarhizium isolates suggests that M-0121 and M-0122 are closely related (both isolates have identical ITS nucleotide identity), and together with M-0123, loosely clustered with three M. anisopliae (AJ608970, KX809519, KP294313). Isolate M-0999 clustered with M. majus (LR792762) and Metacordyceps indigotica (JN049875; anamorph of M. indigoticum (Kepler et al. 2012, 2014) with a relatively high node support value (82%). Isolate M-1000 appeared to be unique and having a phylogenetic position away from the branches that have the various M. anisopliae ITS sequences. Interestingly, Metacordyceps brittlebankisoides (KM371264) (anamorph of M. brittlebankisoides (Kepler et al. 2012), and M. guizhouense (LR792761) appeared to share the same ITS sequence identity as indicated by the blue coloured branches (Figure. 3; Suppl. Data 2), highlighting a need for taxonomic revision and the limitations of molecular taxonomy based on the widely applied ITS gene marker. The GenBank accession numbers of the CSIRO Beauveria and Metarhizium ITS sequences are OM865403 - OM865413.

3.2 Mortality of Spodoptera frugiperda 3^rd instar caterpillars

A subsample of the population used in bioassays was weighed to compare their development and the results suggests that there is no significant difference in size among the samples between treatments (F_71,504 = 1.30, P = 0.062).

Seven days following infection, three isolates (B-0016, B-0571, and B-1311) of Beauveria sp. induce the highest overall mortality in 3^rd instar caterpillars (F_10,28 = 25.51, P < 0.001, 60.01±3.66, 82.81±5.75, and 73.72±2.51 respectively, Figure 4), followed by the Metarhizium isolate M-0121 (53.13±3.61%) and the Beauveria isolate B-0698 (55.21±7.29%). Mortality induced by the two remaining Beauveria isolates (B-0077 and B-0079) and four Metarhizium isolates (M-0122, M-0123, M-0999, and M-1000) was significantly lower.

Daily mortality and cumulative daily mortality of the study samples after infection were recorded to assess killing speed. The results suggest that mortality in 3^rd instar S. frugiperda caterpillars treated with B-0571, B-0698, B-1311, M-0123, M-0999, and M-1000 occurred predominantly within the first two days following infection, particularly on the first day (Figure 5 and Suppl. Data 3 Figures S1a, and S1b). The other EPF candidates including B-0016, B-0077, B-0079, M-0121, and M-0122 induced mortality more gradually from day one to day seven.

Because the first day is when the most deaths occur, results were statistically analysed to ascertain which isolates induced the highest Day one mortality (causing high mortality within 24 hours of infection). Samples infected with B-0571 and B-1311 had the highest Day one mortality following infection (73.96±7.85 and 62.08±3.67%, F_11,44 = 36.23, P < 0.001, Figure 6), followed by B-0698 (48.96±9.08%) and M-0121 (38.54±2.75%). Although B-0016 treated samples are one of the three that have highest overall mortality after seven days, its Day one mortality is significantly lower than B-0571 and B-1311 (35.79±6.32%, statistical results mentioned above). Day one mortality induced by other fungal candidates was significantly lower than those five isolates, but not significantly different to each other, with the Day one mortality of the control samples (first 24 hours post 0.1% (v/v) Tween 80^® application) being the lowest of all (0.74±0.33%).

3.3 Mortality of Spodoptera frugiperda 6^th instar caterpillars, pupae, and moths

The effectiveness of the two most virulent strains of Beauveria sp. against 3^rd instar S. frugiperda caterpillars (B-0571 and B-1311) was assessed against 6^th instar caterpillars, pupae, and adult of S. frugiperda. B-0571 and B-1311 induced overall mortality of 61.46±6.83 and 71.88±5.41% respectively in 6^th instar S. frugiperda caterpillars seven days following infection (F_1,4 = 1.429, P = 0.298); 16.67±2.08 and 18.75±3.61% respectively in pupae (at day 14) (F_{1, 4}= 0.25, P = 0.643); and 93.75±3.61 and 97.92±2.08% respectively in moths (at day seven) (F_{1, 4}= 1, P = 0.374) (Figure 7).

Daily mortality of 6^th instar S. frugiperda infected with B-0571 and B-1311 was highest on the first day following infection (Control samples: 0%, B-0571: 66.67±11.02% and B-1311: 62.5±9.55%, Suppl. Data 3 Figure S2a). No deaths were observed after day two following infection in the B-0571 treated samples and after day five in the B-1311 treated samples (Figure 8). Mortality at the adult stage mainly occurred within the first three days following infection (Figure 9 and Suppl. Data 3, Figure S2b, cumulative mortality at day three: 91.67±4.17 for B-0571 female, 83.33±4.17 for B-0571 male, 75±7.22 for B-1311 female, and 100±0% for B-1311 male).

To determine the reproductive potential of infected moths, the number of females which produced eggs was recorded. Only 4.17±1.47% of the adult females that were infected with B-0571 produced eggs, of which none hatched. None of the adult females that were infected with B-1311 laid any egg masses. As a result, none of the S. frugiperda infected with B-0571 and B-1311 isolates produced first-generation offspring. In contrast, 66.67±1.47% of female control moths produced eggs and 75.56±1.57% of these females produced offspring.

Comparing overall mortality across life stages at seven days after infection (F_{7, 22}= 39.01, P < 0.001, Figure 7) highlights that isolates B-0571 and B-1311 were particularly effective against moths. Isolate B-0571 also induced high mortality in 3^rd instar caterpillars that was not significantly different from the mortality in moths or 6^th instar caterpillars. Mortality induced by isolate B-1311 in 3^rd instar caterpillars, however, was significantly lower than in moths but was not significantly different from 6^th instar caterpillars. For both B-0571 and B-1311, mortality was much lower in pupae than in other life stages.

3.4. Mortality of 3^rd instar Spodoptera frugiperda vs Helicoverpa armigera

Weight of representative samples did not differ significantly across treatments and between S. frugiperda and H. armigera (F_17,126 = 0.7812, P = 0.71), and as such any size- or development-associated effects can be excluded.

Overall mortality (%) of 3^rd instar S. frugiperda and H. armigera after being infected with B-0571 and B-1311 at day 14 suggested that both isolates induced significantly higher mortality in S. frugiperda than in H. armigera (F_3,8 = 41.72, P < 0.001, Figure 10). Isolate B-0571 induced 91.67±2.08% mortality in S. frugiperda but only 44.79±4.54% in H. armigera. Similarly, isolate B-1311 induced 72.92±3.75% mortality in S. frugiperda but only 19.80±7.51% in H. armigera.

Spodoptera frugiperda caterpillars predominantly died within the first few days after infection. In contrast, while many of the treated H. armigera caterpillars died within two days after infection, mortality also progressed gradually throughout the 14-day period (Figure 11 and Suppl. Data 3 Figure S3).

We assessed mortality induced by 11 EPF candidates from Australia, New Zealand, and Malaysia that were in CSIRO’s fungal collection against the recently established lepidopteran pest S. frugiperda. Two Australian isolates of Beauveria sp. (B-0571 and B-1311) induced the highest mortality in 3^rd instar S. frugiperda caterpillars, with mortality induced predominantly in the first day after infection. These two isolates also induced high mortality in S. frugiperda moths and 6^th instar caterpillars, but not in pupae. Additionally, we examined mortality induced by B-0571 and B-1311 in an Australian native lepidopteran pest, H. armigera, for which both strains were less effective than in S. frugiperda.

4.1 Fungal Isolate Species identification

The candidate fungal species were identified via sequencing of the ribosomal 16S ITS region. Sequence results indicated that of the 11 fungal candidates, five Beauveria isolates matched the ITS of six species of Beauveria with high nucleotide identity (100-97%, B-0016, B-0077, B-0079, B-0571, B-0698, and B-1311), and five Metarhizium isolates matched the ITS regions of various Metarhizium species (M-0121, M-0122, M-0123, M-0999 and M-1000). The general consensus divergence for cut-off for delimitating across Fungi kingdom is approximately 3-5% for ITS sequences (intraspecific ITS variability in fungi is 2.51±4.57%) with ≥80% query coverage and based on 500-800bp (Schoch et al. 2012; Raja et al. 2017). In the phylum Ascomycota (which includes Beauveria and Metarhizium), the average variability in weight of infraspecific ITS has been reported to be 1.96±3.73% (Nilsson et al. 2008; Raja et al. 2017). Hence, although the genera of CSIRO fungal isolates were inferred by ITS sequences analysis (six isolates of Beauveria sp. and five isolates of Metarhizium sp.), the species of all candidates remain unknown. This is because the ITS regions of those isolates have ≥97% identical sites to more than one species from the reference sequences.

Based on the ITS sequence phylogeny, six of the CSIRO Beauveria fungal isolates clustered with high confidence (Fig. 2; node support value 88% (in red)) with B. bassiana and B. brongniarti, suggesting that resolving the taxonomic status of both B. bassiana and B. brongniarti as well as the CSIRO Beauveria isolates could not rely solely on the ITS region. Some isolates of B. bassiana and B. brongniarti as well as various CSIRO Beauveria isolates also have identical ITS sequences (e.g., OM131742, LN886699, B-0077, B-0571, B-1311), while many Beauveria species shared highly similar (>97%) ITS nucleotide identity. Similarly, the five CSIRO Metarhizium isolates were clustered in the same clade, albeit less confidently, with many species of Metarhizium (Fig. 3). This is due to high nucleotide similarity in Metarhizium ITS sequences both within the M. anisopliae complex (M. anisopliae, M. guizhouense, M. pingshaense, M. robertsii, and M. acridum) and other Metarhizium spp. (Metacordyceps indigotica M. gryllidicola, and Metacordyceps brittlebankisoides). There is currently insufficient data for molecular diagnostics of the various Beauveria and Metarhizium isolates based on the ITS regions, and multilocus sequence typing (MLST)/whole genome sequencing approach may offer greater resolution power to aid in the molecular taxonomy and assist with molecular diagnostics of these important fungal groups.

Phenotypic characters such as macro-and micro-morphology, production of certain chemicals, and host specificity are also used to help identify fungal species. These phenotypic characters, however, can be affected by external factors (e.g., growth conditions) and the strain of fungus (Francisco et al. 2006; Fernandes et al. 2010; Sepúlveda et al. 2016; Bridge et al.). For example, although B. brongniarti has been reported to mainly attack cockchafer (i.e., Melolontha spp.) and other coleopteran insects (Vestergaard et al. 2003; Shah and Pell 2003; Imoulan et al. 2017; Rohrlich et al. 2018), Wu and colleagues (Wu et al. 2019) demonstrate that B. brongniartii SB010 also infects lepidopteran species (Spodoptera litura). Molecular diagnostics and the molecular taxonomic status of CSIRO Beauveria and Metarhizium isolates used in this study will require further investigation, either through the whole genome sequencing approach or via a MLST approach involving other widely used DNA markers (i.e., TEF1α, RPB1, RPB2, β-tubulin, CaM, Bloc) (Bischoff and Rehner 2009; Hernández and Guzman-Franco 2017; Dizkirici and Kalmer 2019; Hoang et al. 2019; Bustamante et al. 2019; Castro-Vásquez et al. 2021).

4.2 Mortality of Spodoptera frugiperda 3^rd instar caterpillars

The overall and daily mortality of 3^rd instar caterpillars was investigated to determine mortality induced by each fungal candidate. Two isolates of Beauveria sp., B-0571 and B-1311, induced the highest mortality. The higher mortality levelsinduced by B-0571 and B-1311 could be because of the strength of spore adhesion, spore gemination rates, the production of enzymes and/or secondary metabolites, and growth conditions that support their development (see below).

The strength of spore adhesion is one of the crucial factors that indicates the virulence of EPF. Spore adhesion is the very first stage of fungal infection, and mostly relies on kinetic mechanisms (e.g., hydrophobic and/or electrostatic) (Boucias and Pendland 1991). Some strains of EPF may employ carbohydrate substances or specific receptors/ligands to strengthen the adhesion force (Boucias et al. 1988). A weakened adhesion strength could result in the spores being washed off from the surfaces of insects (Holder and Keyhani 2005) thus preventing them from infecting the host species (Wang and St Leger 2007). Herein, a diverse isolate of fungi may manifest different level of hydrophobicity and biochemistry. This may result in a fluctuation in virulence. The two most pathogenic isolates of Beauveria sp. (B-0571 and B-1311) may exhibit stronger spore adhesion strength than other tested fungal candidates.

Conidial germination rates are also frequently associated with the virulence of EPF (Heale et al. 1989; Yeo et al. 2003; Safavi et al. 2007; Tseng et al. 2014). After attaching to the insect cuticle, to infect the target insect the spores must germinate and form an appressorium to penetrate through the insect’s chitinous exoskeleton. A faster germination rate is speculated to not only quicken the killing process but also reduce the possibility of losing spores from the insect moving and moulting (Altre et al. 1999). Faria et al. (2015) found that fast-germination strains of B. bassiana exhibit higher virulence towards S. frugiperda than do slow-germination strains. In the present study, the two fungal isolates that induced the highest overall mortality (B-0571 and B-1311) also have the highest Day one mortality, which suggests that these fungal strains may have higher germination rates. At this time, germination rates of the candidate fungi have not been measured and so the contribution of germination rate to the observed mortality patterns remains unknown.

The production of hydrolytic enzymes has also been proposed as one determinant of EPF virulence. The arthropod exoskeleton is composed of various compounds including chitin, lipid, protein, and phenolic compounds that act as a barrier to protect the insect from desiccation and entomopathogens (Petrisor and Stoian 2017). EPF secrete a wide range of cuticle-degradation enzymes in order to infect the insect (e.g., chitinase, protease, and lipase) (Cheong et al. 2016). Consequently, fungal candidates that possess higher virulence may have higher enzyme activities. Further investigation is also required to verify this hypothesis for our high-performing Beauvaria candidates B-0571 and B-1311.

Growth conditions of the fungal candidates could play significant roles in fungal virulence. Culture media and growth temperature have been shown to greatly influence the strength of spore adhesion (Ibrahim et al. 2002; Rangel et al. 2008), production of cuticle-degrading enzyme protease (Butt et al. 1996; Safavi et al. 2007; Rangel et al. 2008), conidial gemination rates (Yeo et al. 2003; Safavi et al. 2007; Rangel et al. 2008), and production of secondary metabolites (Asai et al. 2012; VanderMolen et al. 2013). Therefore, some of those isolates which exhibit a low killing ability may simply require different culture media or/and growth conditions to improve virulence.

Some EPF have the ability to secrete secondary metabolites that could contribute to the outcome of fungal-insect interaction. This is because secondary metabolites could assist EPF to overcome insects’ immune systems and quicken mycosis (Zimmermann 2007). There is evidence that some strains of B. bassiana are able to produce host-specific secondary metabolites that can cause 50% mortality at very low concentrations (3.3µg/g body wt; Bassiacridin, infected Locusta migratoria) (Quesada-Moraga and Vey 2004). Regarding the high mortality induced by B-0571 and B-1311, these strains may produce bioactive compounds that have insecticidal activities toward S. frugiperda. Understanding and being able to produce these compounds could open new avenues for controlling invasive pest species, however further investigation is required to confirm these hypotheses.

4.3 Mortality of Spodoptera frugiperda 6^th instar caterpillars, pupae, and moths

Isolates B-0571 and B-1311 which induced the highest mortality in S. frugiperda 3^rd instar caterpillars also induced high morality in moths and 6^th instar caterpillars, but not in pupae. Differences in the susceptibility of S. frugiperda at different developmental and life stages may be linked to the strength of the insect’s immune system, thickness, profile, and availability of susceptible locations on the exoskeleton, and pathogen defences (see below).

A more developed immune system could enhance the resistance of S. frugiperda toward fungal infection. In the present study, 6^th instar caterpillars generally were less susceptible to pathogens than were 3^rd instar caterpillars. Similarly, 5^th instar S. frugiperda caterpillars are less susceptible to nematode (Steinernema feltiae) than 1^st and 3^rd instar caterpillars (Fuxa et al. 1988). The increasing of resistance in older caterpillars is believed to be strongly associated with the development of their immune system. Haemocytes tend to be much more abundant in older caterpillars than in younger caterpillars (Carper et al. 2019). This suggests that caterpillars increase their immunometabolism as they progress through their developmental stages. The stronger immune system would imbue older S. frugiperda with greater resistance against EPF (and/or insecticides) leading to reduced susceptibility to infection (or reduced mortality from exposure to insecticides).

The physical aspects of S. frugiperda at each life stage could also contribute to the outcome of fungal infection. Regarding the mode of action of Beauveria species, the spores infect the target host by penetrating through its external exoskeleton. Thus, the insect’s cuticular thickness and profile could be important factors in preventing penetration. According to Wrońska et al. (2018), the cuticles of caterpillars and the thorax of moths are the most susceptible areas to be digested by proteases and lipase (commonly produced by many EPF) (Erlacher et al. 2006; Hussein et al. 2012; Dhawan and Joshi 2017). This makes caterpillars and moths highly vulnerable to fungal infection. Additionally, the spores of EPF generally accumulate around the spiracles, hairs, pores of the wax glands, eyes, antennal segment, and legs articulating membranes and germinate from those areas (Toledo et al. 2010). Hence, thinner/weaker exoskeletons and/or higher availability of susceptible areas potentially provides the fungi with greater chances to successfully infect host species.

Spodoptera frugiperda commonly pupate in the soil and are therefore likely to encounter entomopathogenic microbes more than are caterpillars and moths. Thus, pupae may have evolved defence mechanisms, such as melanisation of the exoskeleton, to defend against soil-borne entomopathogens. Melanisation is a process that the insect employs to enhance cuticle pigmentation, cuticular sclerotization, wound healing, and its innate immune system (Sugumaran and Barek 2016). The darkness of the insect cuticle (higher concentrated melanin indicator) could, in some cases, indicate immune status (Nappi et al. 1995; Reeson et al. 1998; Barnes and Siva-Jothy 2000). Melanisation is likely to be a key mechanism that protects pupae from fungal infection. In addition, pupal cells of some insect species (e.g., Curculio caryae) have been shown to possess the antimicrobial properties which can suppress the growth and germination of B. bassiana (Shapiro-Ilan and Mizell 2015). Whether S. frugiperda also evolved a similar mechanism to protect themselves from B-0571 and B-1311 at the pupal stage is not known.

4.4. Mortality of 3^rd instar Spodoptera frugiperda vs Helicoverpa armigera

The overall mortality of 3^rd instar S. frugiperda caterpillars infected with isolates B-0571 or B-1311 are higher than that of H. armigera. This suggests that either H. armigera has a higher resistance to fungal infection or it is not a target species of B-0571 and B-1311. A similar scenario was reported by Gutierrez et al. (2015) who showed M. anisopliae to be highly pathogenic towards oriental cockroach (Blatta orientalis), but not to other cockroach species (e.g., German cockroach Blattella germanica). The authors reported at least 19 fatty acids on the outer layer surface of B. orientalis but not on B. germanica. The fatty acids were speculated to be a determinant of fungus virulence; however, the mechanism of how they facilitated M. anisopliae was not reported. Therefore, the lower susceptibility of H. armigera could be due to it lacking specific signals (e.g., fatty acids) on the cuticle such that the germination process is not triggered. Other factors that could contribute to the lower susceptibility of H. armigera may include the activation of antifungal mechanisms to increase protection against fungal infection, or production of secondary metabolites by B-0571 and B-1311 that better suited species within the Spodoptera genus, including S. frugiperda. This hypothesis could be tested by including endemic Spodoptera species e.g., S. litura and Australian S. exigua (a potentially cryptic species from African S. exigua; see (Agarwal et al. 2022)).

Eleven fungal candidates from the CSIRO fungal collection were assessed for mortality induced in 3^rd instar S. frugiperda caterpillars in order to guide selection of isolates of Australian EPF that showed promise for combating this newly arrived pest species. This could open up opportunities to develop alternative S. frugiperda pest management strategies, as well as to limit the usage and hence reduce negative environmental impacts of synthetic insecticides. The two most effective isolates, B-0571 and B-1311, were also effective against 6^th instar caterpillars and moths of S. frugiperda, indicating that biological insecticides using these isolates could be used to target both larval and adult life stages. Isolates B-0571 and B-1311 were both less effective against Australian endemic H. armigera than against S. frugiperda. Understanding how these fungal isolates impact other pest species could help to ascertain mechanisms of host specificity. This could assist in developing and planning of best practice control strategies to limit damage on agricultural crops affected by S. frugiperda and H. armigera.

Conflict of interest

The authors declare no conflicts of interest.

Ethics approval and consent to participate: This study involved entomopathogenic fungi and two Lepidopteran species, neither of which require ethical approval.

Consent for publication: All authors read and approved the manuscript.

Availability of data and materials: Raw data generated during and/or analysed in the present study and the statistically analysis code are available upon the request, the ITS sequences are available in GenBank (OM865403 - OM865413).

Competing Interests: The authors have no competing interests to declare

Funding: This work has been conducted as part of a PhD project of NBA with funding provided by Macquarie University through the International Macquarie University Research Excellence Scholarship (iMQRES). TW, WTT, and the biopesticides for control of fall armyworm project are supported by CSIRO – Land & Water and Heath & Biosecurity.

Author Contributions: NBA, BM, PWT, TKW, and WTT (lead) conceptualised the research. NBA (lead), TKW, and WTT designed the methodology. NBA conducted the experiment and curated the data. NBA and WTT analysed the data. TMH contributed the insect colony. NBA wrote the manuscript. BM, PWT, TKW, and WTT reviewed and edited the manuscript.

Acknowledgements: Dr Oliver Mead (CSIRO) and Mark Rullo (University of Adelaide/CSIRO) provided discussion on experiment design. Dr Egi Kardia (CSIRO) assisted with spore concentration and viability tests. Andy Bachler (ANU/CSIRO) and Grace Fang (University of Canberra (UC)/CSIRO) assisted with molecular-related discussions. William James (CSIRO), Andy Bachler, Grace Fang, Ray Yang (CSIRO), and Dr Chengcheng Zhong (CSIRO) assisted with the insect rearing. Dr Stephen Pearce (CSIRO) provided guidance on data manipulation and presentation via the R-package. Theodore Colls (UC/CSIRO) assisted on statistical analysis and data display.

Agarwal A, Rako L, Schutze MK, et al (2022) A diagnostic LAMP assay for rapid identification of an invasive plant pest, fall armyworm Spodoptera frugiperda (Lepidoptera: Noctuidae). Sci Rep 12:1116. https://doi.org/10.1038/s41598-021-04496-x
Agboyi LK, Goergen G, Beseh P, et al (2020) Parasitoid Complex of Fall Armyworm, Spodoptera frugiperda, in Ghana and Benin. Insects 11:68. https://doi.org/10.3390/insects11020068
Altre JA, Vandenberg JD, Cantone FA (1999) Pathogenicity of Paecilomyces fumosoroseus isolates to diamondback moth, Plutella xylostella: correlation with spore size, germination speed, and attachment to cuticle. J Invertebr Pathol 73:332–338. https://doi.org/10.1006/jipa.1999.4844
Anderson CJ, Tay WT, McGaughran A, et al (2016) Population structure and gene flow in the global pest, Helicoverpa armigera. Mol Ecol 25:5296–5311. https://doi.org/10.1111/mec.13841
Andrews KL (1980) The Whorlworm, Spodoptera frugiperda, in Central America and Neighboring Areas. Fla Entomol 63:456–467. https://doi.org/10.2307/3494530
Apirajkamol N (Beatrice), James B, Gordon KHJ, et al (2020) Oxidative stress delays development and alters gene expression in the agricultural pest moth, Helicoverpa armigera. Ecol Evol 10:5680–5693. https://doi.org/10.1002/ece3.6308
Araújo JPM, Hughes DP (2016) Diversity of Entomopathogenic Fungi: Which Groups Conquered the Insect Body? Adv Genet 94:1–39. https://doi.org/10.1016/bs.adgen.2016.01.001
Aristizábal LF, Bustillo AE, Arthurs SP (2016) Integrated Pest Management of Coffee Berry Borer: Strategies from Latin America that Could Be Useful for Coffee Farmers in Hawaii. Insects 7:E6. https://doi.org/10.3390/insects7010006
Asai T, Luo D, Obara Y, et al (2012) Dihydrobenzofurans as cannabinoid receptor ligands from Cordyceps annullata, an entomopathogenic fungus cultivated in the presence of an HDAC inhibitor. Tetrahedron Letters 53:2239–2243. https://doi.org/10.1016/j.tetlet.2012.02.088
Baloch MN, Fan J, Haseeb M, Zhang R (2020) Mapping Potential Distribution of Spodoptera frugiperda (Lepidoptera: Noctuidae) in Central Asia. Insects 11:172. https://doi.org/10.3390/insects11030172
Barnes AI, Siva-Jothy MT (2000) Density-dependent prophylaxis in the mealworm beetle Tenebrio molitor (Coleoptera: Tenebrionidae): cuticular melanization is an indicator of investment in immunity. Proc Biol Sci 267:177–182. https://doi.org/10.1098/rspb.2000.0984
Bischoff J, Rehner S (2009) A multilocus phylogeny of the Metarhizium anisopliae Mycologia 101:512–30. https://doi.org/10.3852/07-202
Blossey B, Häfliger P, Tewksbury L, et al (2018) Host specificity and risk assessment of Archanara geminipuncta and Archanara neurica, two potential biocontrol agents for invasive Phragmites australis in North America. BioControl 125:98–112. https://doi.org/10.1016/j.biocontrol.2018.05.019
Boaventura D, Bolzan A, Padovez FE, et al (2020) Detection of a ryanodine receptor target-site mutation in diamide insecticide resistant fall armyworm, Spodoptera frugiperda. Pest Manag Sci 76:47–54. https://doi.org/10.1002/ps.5505
Botha AS, Erasmus A, du Plessis H, Van den Berg J (2019) Efficacy of Bt Maize for Control of Spodoptera frugiperda (Lepidoptera: Noctuidae) in South Africa. J Econ Entomol 112:1260–1266. https://doi.org/10.1093/jee/toz048
Boucias DG, Pendland JC (1991) Attachment of Mycopathogens to Cuticle. In: Cole GT, Hoch HC (eds) The Fungal Spore and Disease Initiation in Plants and Animals. Springer US, Boston, MA, pp 101–127
Boucias DG, Pendland JC, Latge JP (1988) Nonspecific factors involved in attachment of entomopathogenic deuteromycetes to host insect cuticle. Appl Environ Microbiol 54:1795–1805. https://doi.org/10.1128/aem.54.7.1795-1805.1988
Bridge PD, Williams MAJ, Prior C, Paterson RRMY 1993 Morphological, biochemical and molecular characteristics of Metarhizium anisopliae and M. flavoviride. J Gen Microbiol 139:1163–1169. https://doi.org/10.1099/00221287-139-6-1163
Bustamante DE, Oliva M, Leiva S, et al (2019) Phylogeny and species delimitations in the entomopathogenic genus Beauveria (Hypocreales, Ascomycota), including the description of peruviensis sp. nov. MycoKeys 58:47–68. https://doi.org/10.3897/mycokeys.58.35764
Butt TM, Hajek AE, Humber RA (1996) Gypsy Moth Immune Defenses in Response to Hyphal Bodies and Natural Protoplasts of Entomophthoralean Fungi. J Invertebr Pathol 68:278–285. https://doi.org/10.1006/jipa.1996.0097
Capinera JL (1969) Fall Armyworm, Spodoptera frugiperda (J.E. Smith) (Insecta: Lepidoptera: Noctuidae). EDIS 2002:. https://doi.org/10.32473/edis-in255-2000
Carper AL, Enger M, Bowers MD (2019) Host Plant Effects on Immune Response Across Development of a Specialist Caterpillar. Front Ecol Evol 7:208. https://doi.org/10.3389/fevo.2019.00208
Castro-Vásquez RM, Molina-Bravo R, Hernández-Villalobos S, et al (2021) Identification and phylogenetic analysis of a collection of Beauveria Isolates from Central America and Puerto Rico. J Invertebr Pathol 184:107642. https://doi.org/10.1016/j.jip.2021.107642
Cernava T, Chen X, Krug L, et al (2019) The tea leaf microbiome shows specific responses to chemical pesticides and biocontrol applications. Sci Total Environ 667:33–40. https://doi.org/10.1016/j.scitotenv.2019.02.319
Cheong P, Glare TR, Rostás M, Haines SR (2016) Measuring Chitinase and Protease Activity in Cultures of Fungal Entomopathogens. Methods Mol Biol 1477:177–189. https://doi.org/10.1007/978-1-4939-6367-6_14
Clifton EH, Jaronski ST, Hajek AE (2020) Virulence of Commercialized Fungal Entomopathogens Against Asian Longhorned Beetle (Coleoptera: Cerambycidae). J Insect Sci 20:1. https://doi.org/10.1093/jisesa/ieaa006
Cock MJW, Beseh PK, Buddie AG, et al (2017) Molecular methods to detect Spodoptera frugiperda in Ghana, and implications for monitoring the spread of invasive species in developing countries. Sci Rep 7:4103. https://doi.org/10.1038/s41598-017-04238-y
Day R, Abrahams P, Bateman M, et al (2017) Fall Armyworm: Impacts and Implications for Africa. Outlooks Pest Manag 28:196–201. https://doi.org/10.1564/v28_oct_02
Dhawan M, Joshi N (2017) Enzymatic comparison and mortality of Beauveria bassiana against cabbage caterpillar Pieris brassicae Braz J Microbiol 48:522–529. https://doi.org/10.1016/j.bjm.2016.08.004
Dillman AR, Chaston JM, Adams BJ, et al (2012) An Entomopathogenic Nematode by Any Other Name. PLOS Pathog 8:e1002527. https://doi.org/10.1371/journal.ppat.1002527
Dizkirici A, Kalmer A (2019) Utility of various molecular markers in fungal identification and phylogeny. Nova Hedwigia 109:187–224. https://doi.org/10.1127/nova_hedwigia/2019/0528
Dodd AP (1959) The Biological Control of Prickly Pear in Australia. In: Keast A, Crocker RL, Christian CS (eds) Biogeography and Ecology in Australia. Springer Netherlands, Dordrecht, pp 565–577
Donzelli BGG, Krasnoff SB (2016) Molecular Genetics of Secondary Chemistry in Metarhizium Adv Genet 94:365–436. https://doi.org/10.1016/bs.adgen.2016.01.005
Edgar RC (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 32:1792–1797. https://doi.org/10.1093/nar/gkh340
Eriksson J (2019) Toxicity bioassays with insecticide formulations used for control of Spodoptera frugiperda (Lepidoptera: Noctuidae). Diseertation, the Noth West University
Erlacher A, Sousa F, Schroeder M, et al (2006) A new cuticle scale hydrolysing protease from Beauveria brongniartii. Biotechnol Lett 28:703–10. https://doi.org/10.1007/s10529-006-9047-1
Fan J, Wu P, Tian T, et al (2020) Potential Distribution and Niche Differentiation of Spodoptera frugiperda in Africa. Insects 11:383. https://doi.org/10.3390/insects11060383
Faria JC, Jelihovschi EG, Allaman IB (2014) Conventional Tukey Test
Faria M, Lopes RB, Souza DA, Wraight SP (2015) Conidial vigor vs. viability as predictors of virulence of entomopathogenic fungi. J Invertebr Pathol 125:68–72. https://doi.org/10.1016/j.jip.2014.12.012
Fernandes EKK, Keyser CA, Chong JP, et al (2010) Characterization of Metarhizium species and varieties based on molecular analysis, heat tolerance and cold activity. J Appl Microbiol 108:115–128. https://doi.org/10.1111/j.1365-2672.2009.04422.x
Firake DM, Behere GT (2020) Natural mortality of invasive fall armyworm, Spodoptera frugiperda (J. E. Smith) (Lepidoptera: Noctuidae) in maize agroecosystems of northeast India. BioControl 148:104303. https://doi.org/10.1016/j.biocontrol.2020.104303
Flint ML, Driestadt SH, Clark JK (2002) Natural enemies handbook: the illustrated guide to biological pest control. University of California Press, Berkeley, Calif.; London
Francisco EA, Mochi DA, Correia A do CB, Monteiro AC (2006) Influence of culture media in viability test of conidia of entomopathogenic fungi. Cienc Rural 36:1309–1312. https://doi.org/10.1590/S0103-84782006000400043
Fuxa JR, Richter AR, Acudelo-Silva F (1988) Effect of Host Age and Nematode Strain on Susceptibility of Spodoptera frugiperda to Steinernema feltiae. J Nematol 20:91–95
Ganiger PC, Yeshwanth HM, Muralimohan K, et al (2018) Occurrence of the new invasive pest, fall armyworm, Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae), in the maize fields of Karnataka, India. Curr Sci 115:621–623
Garlet CG, Gubiani P da S, Palharini RB, et al (2021) Field-evolved resistance to chlorpyrifos by Spodoptera frugiperda (Lepidoptera: Noctuidae): Inheritance mode, cross-resistance patterns, and synergism. Pest Manag Sci 77:5367–5374. https://doi.org/10.1002/ps.6576
Geiger F, Bengtsson J, Berendse F, et al (2010) Persistent negative effects of pesticides on biodiversity and biological control potential on European farmland. Basic and Applied Ecology 11:97–105. https://doi.org/10.1016/j.baae.2009.12.001
Giusti A, Ricci E, Gasperetti L, et al (2021) Building of an Internal Transcribed Spacer (ITS) Gene Dataset to Support the Italian Health Service in Mushroom Identification. Foods 10:1193. https://doi.org/10.3390/foods10061193
Goergen G, Kumar PL, Sankung SB, et al (2016) First Report of Outbreaks of the Fall Armyworm Spodoptera frugiperda (J E Smith) (Lepidoptera, Noctuidae), a New Alien Invasive Pest in West and Central Africa. PLOS ONE 11:e0165632. https://doi.org/10.1371/journal.pone.0165632
Government of Western Australi (2021) Fall armyworm in Western Australia. https://www.agric.wa.gov.au/fall-armyworm-western-australia. Accessed 10 Jan 2022
Gutierrez AC, Gołębiowski M, Pennisi M, et al (2015) Cuticle Fatty Acid Composition and Differential Susceptibility of Three Species of Cockroaches to the Entomopathogenic Fungi Metarhizium anisopliae (Ascomycota, Hypocreales). J Econ Entomol 108:752–760. https://doi.org/10.1093/jee/tou096
Hardwick DF (1965) The Corn Earworm Complex. Mem Entomol Soc Can 97:5–247. https://doi.org/10.4039/entm9740fv
Heale JB, Isaac JE, Chandler D (1989) Prospects for strain improvement in entomopathogenic fungi. Pestic Sci 26:79–92. https://doi.org/10.1002/ps.2780260108
Hernández C, Guzman-Franco A (2017) Species Diversity and Population Dynamics of Entomopathogenic Fungal Species in the Genus Metarhizium—a Spatiotemporal Study. Microb Ecol 74:. https://doi.org/10.1007/s00248-017-0942-x
Hernandez-Trejo A, Estrada-Drouaillet B, López-Santillán JA, et al (1970) In vitro evaluation of native entomopathogenic fungi and neem (Azadiractha indica) extracts on Spodoptera frugiperda. phyton 88:47. https://doi.org/10.32604/phyton.2019.04611
Hoang MTV, Irinyi L, Chen SCA, et al (2019) Dual DNA Barcoding for the Molecular Identification of the Agents of Invasive Fungal Infections. Front Microbiol 10:1647. https://doi.org/10.3389/fmicb.2019.01647
Holder DJ, Keyhani NO (2005) Adhesion of the Entomopathogenic Fungus Beauveria (Cordyceps) bassiana to Substrata. Appl Environ Microbiol 71:5260–5266. https://doi.org/10.1128/AEM.71.9.5260-5266.2005
Huang F, Qureshi JA, Jr RLM, et al (2014) Cry1F Resistance in Fall Armyworm Spodoptera frugiperda: Single Gene versus Pyramided Bt Maize. PLOS ONE 9:e112958. https://doi.org/10.1371/journal.pone.0112958
Huson DH, Richter DC, Rausch C, et al (2007) Dendroscope: An interactive viewer for large phylogenetic trees. BMC Bioinform 8:460. https://doi.org/10.1186/1471-2105-8-460
Hussein KA, Abdel-Rahman MAA, Abdel-Mallek AY, et al (2012) Pathogenicity of Beauveria bassiana and Metarhizium anisopliae against Galleria mellonella. Phytoparasitica 40:117–126. https://doi.org/10.1007/s12600-011-0204-2
Ibrahim L, Butt T, Jenkinson P (2002) Effect of artificial culture media on germination, growth, virulence and surface properties of the entomopathogenic hyphomycete Metarhizium anisopliae. Mycol Res 106:705–715. https://doi.org/10.1017/S0953756202006044
Imoulan A, Hussain M, Kirk PM, et al (2017) Entomopathogenic fungus Beauveria: Host specificity, ecology and significance of morpho-molecular characterization in accurate taxonomic classification. J Asia-Pac Entomol 20:1204–1212. https://doi.org/10.1016/j.aspen.2017.08.015
International Plant Protection Convention (2020) Detections of Spodoptera frugiperda (fall armyworm) on mainland Australia. Food and Agriculture Organization of the United Nations, Australia
Izzo A, Agbowo J, Bruns TD (2005) Detection of plot-level changes in ectomycorrhizal communities across years in an old-growth mixed-conifer forest. New Phytol 166:619–629. https://doi.org/10.1111/j.1469-8137.2005.01354.x
Jakka SRK, Knight VR, Jurat-Fuentes JL (2014) Spodoptera frugiperda (J.E. Smith) with field-evolved resistance to Bt maize are susceptible to Bt pesticides. J Invertebr Pathol 122:52–54. https://doi.org/10.1016/j.jip.2014.08.009
Kandel S, Poudel R (2020) Fall Armyworm (Spodoptera Frugiperda) in Maize: An Emerging Threat in Nepal and its Management. Int J Appl Sci Biotechnol 8:305–309. https://doi.org/10.3126/ijasbt.v8i3.31610
Katoh K, Standley DM (2013) MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol Biol Evol 30:772–780. https://doi.org/10.1093/molbev/mst010
Kepler RM, Humber RA, Bischoff JF, Rehner SA (2014) Clarification of generic and species boundaries for Metarhizium and related fungi through multigene phylogenetics. Mycologia 106:811–829. https://doi.org/10.3852/13-319
Kepler RM, Sung G-H, Ban S, et al (2012) New teleomorph combinations in the entomopathogenic genus Metacordyceps. Mycologia 104:182–197. https://doi.org/10.3852/11-070
Kulye M, Mehlhorn S, Boaventura D, et al (2021) Baseline Susceptibility of Spodoptera frugiperda Populations Collected in India towards Different Chemical Classes of Insecticides. Insects 12:758. https://doi.org/10.3390/insects12080758
Kumar S, Singh A (2015) Biopesticides: Present Status and the Future Prospects. J Fertil Pestic 06: https://doi.org/10.4172/2471-2728.1000e129
Lee G-S, Seo BY, Lee J, et al (2020) First Report of the Fall Armyworm, Spodoptera frugiperda (Smith, 1797) (Lepidoptera, Noctuidae), a New Migratory Pest in Korea. Korean J Appl Entomol 59:73–78. https://doi.org/10.5656/KSAE.2020.02.0.006
Leite NA, Mendes SM, Santos-Amaya OF, et al (2016) Rapid selection and characterization of Cry1F resistance in a Brazilian strain of fall armyworm. Entomologia Experimentalis et Applicata 158:236–247. https://doi.org/10.1111/eea.12399
León-García I, Rodríguez-Leyva E, Ortega-Arenas LD, Solís-Aguilar JF (2012) Insecticide susceptibility of Spodoptera frugiperda (J. E. Smith) (Lepidoptera: Noctuidae) associated with turfgrass at Quintana Roo, México. Agrociencia 46:279–287
Liang J, Zhang D, Li D, et al (2021) Expression profiles of Cry1Ab protein and its insecticidal efficacy against the invasive fall armyworm for Chinese domestic GM maize DBN9936. J Integr Agric
Liu S-S, Rao A, Bradleigh Vinson S (2014) Biological Control in China: Past, present and future – An introduction to this special issue. BioControl 68:1–5. https://doi.org/10.1016/j.biocontrol.2013.05.005
Lovett B, St. Leger RJ (2018) Genetically engineering better fungal biopesticides. Pest Manag Sci 74:781–789. https://doi.org/10.1002/ps.4734
Lv S-L, Shi Y, Zhang J-C, et al (2021) Detection of ryanodine receptor target-site mutations in diamide insecticide-resistant Spodoptera frugiperda in China. Insect Sci 28:639–648. https://doi.org/10.1111/1744-7917.12896
Madden T (2003) The BLAST sequence analysis tool. The NCBI handbook 9:
Mills NJ, Beers EH, Shearer PW, et al (2016) Comparative analysis of pesticide effects on natural enemies in western orchards: A synthesis of laboratory bioassay data. BioControl 102:17–25. https://doi.org/10.1016/j.biocontrol.2015.05.006
Minh BQ, Nguyen MAT, von Haeseler A (2013) Ultrafast Approximation for Phylogenetic Bootstrap. Mol Biol Evol 30:1188–1195. https://doi.org/10.1093/molbev/mst024
Mondal S, Baksi S, Koris A, Vatai G (2016) Journey of enzymes in entomopathogenic fungi. Pacific Science Review A: Natural Science and Engineering 18:85–99. https://doi.org/10.1016/j.psra.2016.10.001
Monnerat R, Martins E, Macedo C, et al (2015) Evidence of Field-Evolved Resistance of Spodoptera frugiperda to Bt Corn Expressing Cry1F in Brazil That Is Still Sensitive to Modified Bt Toxins. PLOS ONE 10:e0119544. https://doi.org/10.1371/journal.pone.0119544
Montezano DG, Sosa -Gómez D. R., Specht A, et al (2018) Host plants of Spodoptera frugiperda (Lepidoptera : Noctuidae) in the Americas. Afr Entomol 26:286–300. https://doi.org/10.4001/003.026.0286
Muthukumar M, Sharma R, Sinha SR (2007) Field efficacy of biopesticides and new insecticides against major insect pests and their effect on natural enemies in cauliflower. Pesticide Research Journal 19:190–196
Nappi AJ, Vass E, Frey F, Carton Y (1995) Superoxide anion generation in Drosophila during melanotic encapsulation of parasites. Eur J Cell Biol 68:450–456
Nawaz M, McCulloch GA, Brookes DR, et al (2021) Native range surveys for host-specific Acacia auriculiformis biocontrol agents – A role for DNA barcoding. BioControl 158:104594. https://doi.org/10.1016/j.biocontrol.2021.104594
Nilsson RH, Kristiansson E, Ryberg M, et al (2008) Intraspecific ITS Variability in the Kingdom Fungi as Expressed in the International Sequence Databases and Its Implications for Molecular Species Identification. Evol Bioinform Online 4:193–201
Niu Y, Qureshi JA, Ni X, et al (2016) F2 screen for resistance to Bacillus thuringiensis Cry2Ab2-maize in field populations of Spodoptera frugiperda (Lepidoptera: Noctuidae) from the southern United States. J Invertebr Pathol 138:66–72. https://doi.org/10.1016/j.jip.2016.06.005
Oliveira I, Pereira JA, Lino-Neto T, et al (2012) Fungal diversity associated to the olive moth, Prays Oleae bernard: a survey for potential entomopathogenic fungi. Microb Ecol 63:964–974. https://doi.org/10.1007/s00248-011-9955-z
Otim MH, Adumo Aropet S, Opio M, et al (2021) Parasitoid Distribution and Parasitism of the Fall Armyworm Spodoptera frugiperda (Lepidoptera: Noctuidae) in Different Maize Producing Regions of Uganda. Insects 12:121. https://doi.org/10.3390/insects12020121
Pearce SL, Clarke DF, East PD, et al (2017) Genomic innovations, transcriptional plasticity and gene loss underlying the evolution and divergence of two highly polyphagous and invasive Helicoverpa pest species. BMC Biol 15:63. https://doi.org/10.1186/s12915-017-0402-6
Petrisor C, Stoian G (2017) The role of hydrolytic enzymes produced by entomopathogenic fungi in pathogenesis of insects mini review. Romanian J Plant Prot 10:66–72
Piggott MP, Tadle FPJ, Patel S, et al (2021) Corn-strain or rice-strain? Detection of fall armyworm, Spodoptera frugiperda (JE Smith) (Lepidoptera: Noctuidae), in northern Australia. Int J Trop Insect Sci 41:2607–2615. https://doi.org/10.1007/s42690-021-00441-7
Quesada-Moraga E, Vey A (2004) Bassiacridin, a protein toxic for locusts secreted by the entomopathogenic fungus Beauveria bassiana. Mycol Res 108:441–452. https://doi.org/10.1017/s0953756204009724
Raja HA, Miller AN, Pearce CJ, Oberlies NH (2017) Fungal Identification Using Molecular Tools: A Primer for the Natural Products Research Community. J Nat Prod 80:756–770. https://doi.org/10.1021/acs.jnatprod.6b01085
Rajula J, Pittarate S, Suwannarach N, et al (2021) Evaluation of Native Entomopathogenic Fungi for the Control of Fall Armyworm (Spodoptera frugiperda) in Thailand: A Sustainable Way for Eco-Friendly Agriculture. J Fungi 7:1073. https://doi.org/10.3390/jof7121073
Ramanujam B, Poornesha B, Kandan A, et al (2021) Natural occurrence of entomopathogenic fungus Beauveria felina (DC.) J.W. Carmich on fall armyworm, Spodoptera frugiperda (J. E. Smith). J Entomol Zool Stud 9:140–143. https://doi.org/10.22271/j.ento.2021.v9.i3b.8738
Ramanujam B, Poornesha B, Shylesha AN (2020) Effect of entomopathogenic fungi against invasive pest Spodoptera frugiperda (J. E. Smith) (Lepidoptera: Noctuidae) in maize. Egypt J Biol Pest Control 30:100. https://doi.org/10.1186/s41938-020-00291-4
Rangel DEN, Alston DG, Roberts DW (2008) Effects of physical and nutritional stress conditions during mycelial growth on conidial germination speed, adhesion to host cuticle, and virulence of Metarhizium anisopliae, an entomopathogenic fungus. Mycol Res 112:1355–1361. https://doi.org/10.1016/j.mycres.2008.04.011
Reeson AF, Wilson K, Gunn A, et al (1998) Baculovirus resistance in the noctuid Spodoptera exempta is phenotypically plastic and responds to population density. Proc R Soc Lond B 265:1787–1791. https://doi.org/10.1098/rspb.1998.0503
Roberts DW, Hajek AE (1992) Entomopathogenic Fungi as Bioinsecticides. In: Leatham GF (ed) Frontiers in Industrial Mycology. Springer US, Boston, MA, pp 144–159
Rohrlich C, Merle I, Mze Hassani I, et al (2018) Variation in physiological host range in three strains of two species of the entomopathogenic fungus Beauveria. PLoS ONE 13:e0199199. https://doi.org/10.1371/journal.pone.0199199
Ryberg M, Nilsson RH, Kristiansson E, et al (2008) Mining metadata from unidentified ITS sequences in GenBank: A case study in Inocybe (Basidiomycota). BMC Evol Biol 8:50. https://doi.org/10.1186/1471-2148-8-50
Safavi SA, Shah FA, Pakdel AK, et al (2007) Effect of nutrition on growth and virulence of the entomopathogenic fungus Beauveria bassiana. FEMS Microbiol Lett 270:116–123. https://doi.org/10.1111/j.1574-6968.2007.00666.x
Sasaki F, Miyamoto T, Tamai Y, Yajima T (2007) Note on Cordyceps brongniartii Shimazu collected from the wild in Japan. Mycoscience 48:312–315. https://doi.org/10.1007/s10267-007-0366-4
Schlum KA, Lamour K, de Bortoli CP, et al (2021) Whole genome comparisons reveal panmixia among fall armyworm (Spodoptera frugiperda) from diverse locations. BMC Genomics 22:179. https://doi.org/10.1186/s12864-021-07492-7
Schoch CL, Seifert KA, Huhndorf S, et al (2012) Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proc Natl Acad Sci USA 109:6241–6246. https://doi.org/10.1073/pnas.1117018109
Sepúlveda M, Vargas M, Gerding M, et al (2016) Molecular, morphological and pathogenic characterization of six strains of Metarhizium (Deuteromycotina: Hyphomycetes) for the control of Aegorhinus superciliosus (Coleoptera: Curculionidae). Chilean J Agric Res 76:77–83. https://doi.org/10.4067/S0718-58392016000100011
Shah PA, Pell JK (2003) Entomopathogenic fungi as biological control agents. Appl Microbiol Biotechnol 61:413–423. https://doi.org/10.1007/s00253-003-1240-8
Shapiro-Ilan DI, Mizell RF (2015) An insect pupal cell with antimicrobial properties that suppress an entomopathogenic fungus. J Invertebr Pathol 124:114–116. https://doi.org/10.1016/j.jip.2014.12.003
Shimazu M, Mitsuhashi W, Hashimoto H (1998) Cordyceps brongniartii nov., the telomorph of Beauveria brongniartii. Trans mycol Soc Japan 29:323–330
Smith ME, Douhan GW, Rizzo DM (2007) Ectomycorrhizal community structure in a xeric Quercus woodland based on rDNA sequence analysis of sporocarps and pooled roots. New Phytol 174:847–863. https://doi.org/10.1111/j.1469-8137.2007.02040.x
St Leger RJ, Wang C (2010) Genetic engineering of fungal biocontrol agents to achieve greater efficacy against insect pests. Appl Microbiol Biotechnol 85:901–907. https://doi.org/10.1007/s00253-009-2306-z
Staden R, Beal KF, Bonfield JK (1999) The Staden Package, 1998. In: Misener S, Krawetz SA (eds) Bioinformatics Methods and Protocols. Humana Press, Totowa, NJ, pp 115–130
Storer NP, Babcock JM, Schlenz M, et al (2010) Discovery and characterization of field resistance to Bt maize: Spodoptera frugiperda (Lepidoptera: Noctuidae) in Puerto Rico. J Econ Entomol 103:1031–1038. https://doi.org/10.1603/ec10040
Sugumaran M, Barek H (2016) Critical Analysis of the Melanogenic Pathway in Insects and Higher Animals. Int J Mol Sci 17:E1753. https://doi.org/10.3390/ijms17101753
Sung J-M, Lee J-O, Humber RA, et al (2006) Cordyceps bassiana and Production of Stromata in vitro Showing Beauveria Anamorph in Korea. Mycobiology 34:1–6. https://doi.org/10.4489/MYCO.2006.34.1.001
Tay WT, Rane RV, James W, et al (2022a) Resistance bioassays and allele characterisation inform Spodoptera frugiperda (Lepidoptera: Noctuidae) management and introduction pathways in Asia and Australia. 2022.02.08.479273
Tay WT, Rane RV, Padovan A, et al (2022b) Global population genomic signature of Spodoptera frugiperda (fall armyworm) supports complex introduction events across the Old World. Commun Biol 5:1–15. https://doi.org/10.1038/s42003-022-03230-1
Togola A, Meseka S, Menkir A, et al (2018) Measurement of Pesticide Residues from Chemical Control of the Invasive Spodoptera frugiperda (Lepidoptera: Noctuidae) in a Maize Experimental Field in Mokwa, Nigeria. Int J Environ Res Public Health 15:849. https://doi.org/10.3390/ijerph15050849
Toledo AV, Lenicov AMM de R, Lastra CCL (2010) Histopathology caused by the entomopathogenic fungi, Beauveria bassianaand Metarhizium anisopliae, in the adult planthopper, Peregrinus maidis, a maize virus vector. J Insect Sci 10:35. https://doi.org/10.1673/031.010.3501
Trakimas G, Krams R, Krama T, et al (2019) Ecological Stoichiometry: A Link Between Developmental Speed and Physiological Stress in an Omnivorous Insect. Behav Neurosci 13:
Trifinopoulos J, Nguyen L-T, von Haeseler A, Minh BQ (2016) W-IQ-TREE: a fast online phylogenetic tool for maximum likelihood analysis. Nucleic Acids Res 44:W232-235. https://doi.org/10.1093/nar/gkw256
Trisyono YA, Suputa S, Aryuwandari VEF, et al (2019) Occurrence of Heavy Infestation by the Fall Armyworm Spodoptera frugiperda, a New Alien Invasive Pest, in Corn Lampung Indonesia. Jurnal Perlindungan Tanaman Indonesia 23:156–160. https://doi.org/10.22146/jpti.46455
Tseng M-N, Chung C-L, Tzean S-S (2014) Mechanisms Relevant to the Enhanced Virulence of a Dihydroxynaphthalene-Melanin Metabolically Engineered Entomopathogen. PLOS ONE 9:e90473. https://doi.org/10.1371/journal.pone.0090473
van Lenteren JC, Bolckmans K, Köhl J, et al (2018) Biological control using invertebrates and microorganisms: plenty of new opportunities. BioControl 63:39–59. https://doi.org/10.1007/s10526-017-9801-4
VanderMolen KM, Raja HA, El-Elimat T, Oberlies NH (2013) Evaluation of culture media for the production of secondary metabolites in a natural products screening program. AMB Expr 3:71. https://doi.org/10.1186/2191-0855-3-71
Vestergaard S, Cherry A, Keller S, Goettel M (2003) Safety of Hyphomycete Fungi as Microbial Control Agents. In: Hokkanen HMT, Hajek AE (eds) Environmental Impacts of Microbial Insecticides: Need and Methods for Risk Assessment. Springer Netherlands, Dordrecht, pp 35–62
Victoria State Government (2020) Fall armyworm | Priority pest insects and mites | Pest insects and mites | Biosecurity | Agriculture Victoria. https://agriculture.vic.gov.au/biosecurity/pest-insects-and-mites/priority-pest-insects-and-mites/fall-armyworm. Accessed 10 Jan 2022
Visalakshi M, Varma PK, Sekhar VC, et al (2020) Studies on mycosis of Metarhizium (Nomuraea) rileyi on Spodoptera frugiperda infesting maize in Andhra Pradesh, India. Egypt J Biol Pest Control 30:135. https://doi.org/10.1186/s41938-020-00335-9
Wang C, St Leger RJ (2007) The MAD1 adhesin of Metarhizium anisopliae links adhesion with blastospore production and virulence to insects, and the MAD2 adhesin enables attachment to plants. Eukaryot Cell 6:808–816. https://doi.org/10.1128/EC.00409-06
Wang Z-Y, He K-L, Zhang F, et al (2014) Mass rearing and release of Trichogramma for biological control of insect pests of corn in China. BioControl 68:136–144. https://doi.org/10.1016/j.biocontrol.2013.06.015
Westbrook J, Fleischer S, Jairam S, et al (2019) Multigenerational migration of fall armyworm, a pest insect. Ecosphere 10:e02919. https://doi.org/10.1002/ecs2.2919
Westbrook JK, Nagoshi RN, Meagher RL, et al (2016) Modeling seasonal migration of fall armyworm moths. Int J Biometeorol 60:255–267. https://doi.org/10.1007/s00484-015-1022-x
Wickham H (2011) ggplot2. WIREs Computational Statistics 3:180–185. https://doi.org/10.1002/wics.147
Worku Bogale M, Andargie Y (2019) Evaluation of efficacy of insecticides against the fall army worm Spodoptera frugiperda. Indian J Entomol 81:13. https://doi.org/10.5958/0974-8172.2019.00076.2
Wrońska AK, Boguś MI, Włóka E, et al (2018) Cuticular fatty acids of Galleria mellonella (Lepidoptera) inhibit fungal enzymatic activities of pathogenic Conidiobolus coronatus. PLOS ONE 13:e0192715. https://doi.org/10.1371/journal.pone.0192715
Wu J, Yu X, Wang X, et al (2019) Matrine Enhances the Pathogenicity of Beauveria brongniartii Against Spodoptera litura (Lepidoptera: Noctuidae). Front Microbiol 10:
Wu M-F, Qi G-J, Chen H, et al (2022) Overseas immigration of fall armyworm, Spodoptera frugiperda (Lepidoptera: Noctuidae), invading Korea and Japan in 2019. Insect Sci 29:505–520. https://doi.org/10.1111/1744-7917.12940
Yang F, Morsello S, Head GP, et al (2018) F2 screen, inheritance and cross-resistance of field-derived Vip3A resistance in Spodoptera frugiperda (Lepidoptera: Noctuidae) collected from Louisiana, USA. Pest Manag Sci 74:1769–1778. https://doi.org/10.1002/ps.4805
Yeo H, Pell JK, Alderson PG, et al (2003) Laboratory evaluation of temperature effects on the germination and growth of entomopathogenic fungi and on their pathogenicity to two aphid species. Pest Manag Sci 59:156–165. https://doi.org/10.1002/ps.622
Yu SJ, Nguyen SN, Abou-Elghar G (2003) Biochemical characteristics of insecticide resistance in the fall armyworm, Spodoptera frugiperda (J.E. Smith). Pestic Biochem Phys 77:1–11. https://doi.org/10.1016/S0048-3575(03)00079-8
Zaimi S, Saranum M, Hudin L, Ali W (2021) First incidence of the invasive fall armyworm, Spodoptera frugiperda (J.E. Smith, 1797) attacking maize in Malaysia. Bioinvasions Rec 10:81–90. https://doi.org/10.3391/bir.2021.10.1.10
Zhang D, Xiao Y, Xu P, et al (2021) Insecticide resistance monitoring for the invasive populations of fall armyworm, Spodoptera frugiperda in China. J Integr Agric 20:783–791. https://doi.org/10.1016/S2095-3119(20)63392-5
Zhang J, Zhang F, Tay WT, et al (2022) Population genomics provides insights into lineage divergence and local adaptation within the cotton bollworm. Mol Ecol Resour 22:1875–1891. https://doi.org/10.1111/1755-0998.13581
Zhang L, Liu B, Zheng W, et al (2020) Genetic structure and insecticide resistance characteristics of fall armyworm populations invading China. Mol Ecol Resour 20:1682–1696. https://doi.org/10.1111/1755-0998.13219
Zhao Y-X, Huang J-M, Ni H, et al (2020) Susceptibility of fall armyworm, Spodoptera frugiperda (J.E.Smmith), to eight insecticides in China, with special reference to lambda-cyhalothrin. Pestic Biochem Physiol 168:104623. https://doi.org/10.1016/j.pestbp.2020.104623
Zhou Y, Wu Q, Zhang H, Wu K (2021) Spread of invasive migratory pest Spodoptera frugiperda and management practices throughout China. J Integr Agric 20:637–645. https://doi.org/10.1016/S2095-3119(21)63621-3
Zimmermann G (2007) Review on safety of the entomopathogenic fungi Beauveria bassiana and Beauveria brongniartii. Biocontrol Sci Technol 17:553–596. https://doi.org/10.1080/09583150701309006

No competing interests reported.

Download PDF

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Virulence of Beauveria sp. and Metarhizium sp. fungi towards Fall armyworm (Spodoptera frugiperda)

Status:

Version 1

Abstract

Figures

Key Message

1. Introduction

2. Materials And Methods

3. Results

4. Discussion

5. Conclusion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1