Biological function research of the long non-coding RNA Malnc2310 in bananas induced by Fusarium oxysporum f. sp. cubense

doi:10.21203/rs.3.rs-1834775/v2

Download PDF

Research Article

Biological function research of the long non-coding RNA Malnc2310 in bananas induced by Fusarium oxysporum f. sp. cubense

https://doi.org/10.21203/rs.3.rs-1834775/v2

This work is licensed under a CC BY 4.0 License

Journal Publication

published 28 Jul, 2023

Read the published version in Plant Molecular Biology →

You are reading this latest preprint version

Long non-coding RNAs (lncRNAs) participate in the biological processes of plants under biotic and abiotic stresses. However, little is known about the function and regulation mechanism of the pathogen-related lncRNAs at a molecular level. A banana lncRNA, namely Malnc2310, is greatly induced by Fusarium oxysporum f. sp. cubense TR4 strain (VCG01213/16) in roots. In this study, we indicate the nuclear localization of Malnc2310 by fluorescence in situ hybridization (FISH). We illustrate that Malnc2310 interacts with several proteins that are related to phenylpropanoid pathway, pathogen response and programmed cell death. Overexpression of Malnc2310 confers higher susceptibility to stresses, such as Fusarium crude extracts, salinity and cold in transgenic Arabidopsis. Furthermore, the Malnc2310 transgenic Arabidopsis accumulated more anthocyanin under Fusarium crude extracts and cold treatments. The Malnc2310 overexpression up-regulated the expression of several key genes that are related to the development of lateral roots and those involved in the anthocyanin biosynthesis pathway. Malnc2310 also enhanced the activity of phenylalanine ammonia lyase (PAL) in transgenic Arabidopsis. Based on our findings, we propose that Malnc2310 binds to PAL to participate in the flavonoid metabolism under stresses. This study provides new insights into the role of Malnc2310 in mediating plants to stress adaptation.

Emerging evidence shows that non-coding RNAs, which constitute a significant portion of eukaryotic transcripts, have emerged as key regulators in most biological processes of plant species (Rymarquis et al. 2008; Wang and Chang 2011; Fok et al. 2017). Long non-coding RNAs (lncRNAs), which are greater than 200 nucleotides in length, are vastly heterogeneous groups of RNAs with indiscernible coding potential in plant genomes (Brosnan and Voinnet 2009). Additionally, lncRNAs are increasingly verified to regulate gene expression at the epigenetic, transcriptional and post-transcriptional levels (Ben Amor et al. 2009; Li et al. 2020; Jha et al. 2020). LncRNAs are found to execute a broad range of roles in various biological processes, including development, biotic stresses, and immunity to environmental conditions in plants (Wang et al. 2011; Fan et al. 2015; Wang et al. 2021). For instance, LDMAR regulates the photoperiod-sensitive male sterility, which is required for normal pollen development in rice grown under long-day condition (Ding et al. 2012). COOLAIR physically binds to FLC locus and improves transcriptional shutdown of vernalization-mediated FLC (Csorba et al. 2014), while COLDAIR recruits PRC2 to FLC locus to repress FLC expression, allowing the unimpeded operation of the photoperiod pathway and rapid flowering in Arabidopsis (Kim et al. 2017). LAIR overexpression increases rice grain yield and upregulates the expression of LRK due to its binding to the untranslated regions of LRK1 (Wang et al. 2018). The lncRNA cascade SVALKA-as CBF1 controls CBF1 expression through RNA polymerase and affects freezing tolerance in Arabidopsis (Kindgren et al. 2018). Additionally, At4 and AtIPS1 (induced by phosphate starvation) with sequence complementarity to miR399 can sequester miR399 to improve the accumulation of miR399 target PHO2 (Shi et al. 2006; Franco-Zorrilla et al. 2007). Moreover, OsPI1 acts as a riboregulator and shares the characteristics of the TPS1/Mt4 family (the phosphate starvation inducible novel gene) (Wasaki et al. 2003). The nitrate-induced lncRNA T5120 functions in NLP7-mediated nitrate signaling and directly regulates nitrate nutrition in roots (Liu et al. 2019).

As for the function of lncRNAs in plants to biotic and abiotic stress, 125 lncRNAs from wheat were found to be involved in powdery mildew infection (Bilir et al. 2019), and 931 lncRNAs were identified in response to rape Sclerotinia stem rot in Brassica napus (Joshi et al. 2016). Similar to those findings identified in the interaction between plant and fungi, 2,056 lncRNAs were identified in response to tomato yellow leaf curl virus (TYLCV) (Yang et al. 2019b), and 1,175 lncRNAs in Nicotiana benthamiana infected with Chinese wheat mosaic virus (CWMV) (Zheng et al. 2021). In addition, MSTRG.19915 was shown to have a great ability to defend against downy mildew in Chinese cabbage (Zhang et al. 2021), and XLOC_006393 responded to CWMV by modulating the expression of its target genes in tomato (Zheng et al. 2021). The silencing of long intergenic non-coding RNA XH123 led to increasing sensitivity to cold stress and the decay of chloroplast in cotton (Cao et al. 2021). In consideration of over 400,000 lncRNAs from 78 plant species that have been uploaded in the Green Non-Coding Database (GreeNC, http://greenc.sequentiabiotech.com/wiki2/Main_Page) (Di Marsico et al. 2022), the characterization and functional analysis of most lncRNAs are very limited. Studies on the biological significance of plant lncRNAs are still in their infancy and the systematic identification of lncRNAs remains a major challenge.

The response mechanisms of banana plants to biotic and abiotic stress have been a research focus in recent years. Fusarium wilt and root rot caused by Fusarium oxysporum f. sp. cubense (Foc) has drawn a particular attention as Foc is a devastating soil-borne fungal pathogen that severely limits the yield of banana worldwide in recent decades (Pegg et al. 2019). We have previously shown that more than 5,000 lncRNAs are potentially induced by Foc tropical race 4 (Foc TR4) in banana roots (Li et al. 2017). However, how these lncRNAs participate in the interaction between banana plants and abiotic or biotic stresses are largely unknown.

In the present study, we identified an lncRNA gene, Malnc2310, which is highly related to the response of banana to Foc TR4. The cellular activity of Malnc2310 is mainly in the nucleus of banana roots under Foc TR4 infection. Malnc2310 can bind to phenylalanine ammonia-lyase, polyphenol oxidase and catalase that are widely involved in plant’s response to stresses. The Malnc2310 over-expressed Arabidopsis are more susceptible to Fusarium crude extract, high salinity and cold stresses. Furthermore, the over-expressed Malnc2310 Arabidopsis plants accumulated more anthocyanin and had higher activities of PAL protein after treated by Fusarium crude extract and cold.

Banana plant growth conditions and Foc TR4 inoculation

The susceptible ‘Brizal’ (BX) and the less susceptible ‘Haigong’ (HG) banana cultivars from Cavendish (Musa acuminata) were provided by the Tropical Crop Germplasm Research Institute, Chinese Academy of Tropical Agricultural Sciences (Danzhou city, Hainan, China). The virus-free tissue culture seedlings were grown in pots under 16 h light/8 h dark at 28 ℃ with 100 µmol m^− 2 s^− 1 light intensity for 90 days. The Foc TR4 strain (VCG01213/16) isolated from Hainan, China, by Dr. Jun Peng (Environment and Plant Protection Institute, Chinese Academy of Tropical Agricultural Sciences, Haikou, China) was freshly transferred to the potato dextrose agar (PDA) medium 5 days before plant inoculation.

The roots were inoculated according to our previous method (Li et al. 2019). Briefly, the artificially wounded by syringe needle root epidermis was covered with freshly prepared Foc TR4 to improve inoculation efficiency. Each treatment sample had six banana plants with three infected roots, and a total of 60 root sections were obtained from three replications.

RNA Fluorescence In Situ Hybridization (FISH)

The full-length cDNA of Malnc2310 was amplified using the BX root cDNA as template by the following primers: Forward: 5’- TTGGTTTGACACTGTTCAC-3’, Reward: 5’-TGGTTTCAAACTCCGATTCG-3’. To detect the activity of Malnc2310, about 46 bp of the sense sequence of Malnc2310 was labeled with 5-carboxyfluorescein (FAM) using oligonucleotide − 5’-end-labeling (CCGTGTGGCGAC ATGGGGACGTAAAAAGGAAAGAGAGGGATGGGTT) synthesized as probe by Sangon Biotech, Shanghai, China. Root tips from one-month old tissue culture seedlings were cut and soaked in the suspension culture of Foc TR4 for 3 h. Root tissue embedding and RNA in situ hybridization were performed by the FISH Tag™ RNA kit (Invitrogen, CA, USA) (Zhang et al. 2017; Golczyk 2019). Briefly, roots were fixed with RNase-free formaldehyde and embedded using a modular automated tissue processor (Leica ASP200S, Weztlar, Germany). Paraffin-embedded samples were sectioned (7–9 µm) with a sliding microtome (Lecia 1200S). After dewaxing, slides were digested with Proteinase K (Roche), dehydrated with gradient ethanol and hybridized with probe. After washing, the slides were incubated with anti-FAM fragments (Roche). The FAM-labeled probes were detected under a confocal microscope (Olympus FV1000, Tokyo, Japan).

RNA Extraction, cDNA Synthesis And Quantitative Real-time RT-PCR (qRT-PCR) Analysis

RNA extraction, cDNA synthesis and quantitative real-time RT-PCR (qRT-PCR) analysis

Collected plant samples were ground in liquid nitrogen. Total RNA was extracted using an RNA kit (Tiangen Biotech, Beijing, China). First-strand cDNAs were synthesized using the FastQuant RT kit (with gDNase) (Tiangen Biotech, China) according to the manufacturer’s instruction and then used as templates for real-time PCR amplification.

The 20 µL PCR mixture contained 1 µL of the cDNA template, 10 µL of 2× SYBR® Premix Ex Taq™ (DRR041A, Takara, Dalian, China), 0.4 µL of 50× ROX reference dye, and 0.2 µM of the forward and reverse primers for each gene. Reactions were performed on an Applied Biosystems StepOne Real-Time PCR system. The PCR program was as follows: 95 ºC for 30 s, followed by 40 cycles of 5 s at 95 ºC, 20 s at 58–62 ºC depending on primer TM. At the end of each experiment, a melt-curve analysis was performed using the default parameters (15 s at 95 ºC; 60 s at 55–95 ºC in 0.3 ºC increments; 15 s at 95 ºC). The relative expression levels of target genes were calculated by the 2^−ΔΔCt method. Banana (Musa acuminata) or Arabidopsis β-actin 2 (Actin) and glyceraldehyde-3-phosphate dehydrogenase 2 (GAPDH2) genes were used as internal references to normalize the transcriptional levels of target genes.

Protein extraction, Western blot, and Biotin- Malnc2310 pull-down assay

Proteins were extracted with the total protein extraction kit (Sigma-Aldrich, MO, USA) and proteins were separated by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) electrophoresis and electro-transferred onto a nitrocellulose membrane (0.2 µm). AtPAL1 was detected using an anti-AtPAL1 affinity-purified antiserum produced by Sangon Biotech corporation (Shanghai, China) for western blot experiment. The immuno-detection was performed with a chemiluminescent detection system kit (Beyotime, Shanghai, China).

Malnc2310 was cloned by PCR and in vitro transcribed into RNA that was labeled with biotin according to the manufacturer’s instructions (Roche) for pull down assay. Biotin-labeled sense MalncRNA2310 and antisense MalncRNA2310 were incubated with the infected ‘BX’ banana root protein extract at 4 ℃ for 12 h. The beads-RNA-proteins were then washed with washing buffer I (10 mM Tris-HCl, 1 mM EDTA and 2 mM NaCl) and II (50 mM Tris-HCl, 1 mM EDTA, 100 mM KCl, 0.1% TritonX-100 and 5% glycerine) three times, respectively. Proteins were precipitated and diluted in 100 µL protein lysis buffer, and then LC-MS/MS mass spectrometry analysis was performed to analyze the purified proteins.

Vector construction and generation of transgenic Arabidopsis

The full-length cDNA of Malnc2310 was cloned into the vector pCAMBIA1300 vector under the control of cauliflower mosaic virus (CaMV) 35S promoter to construct the over-expressed vector pCAMBIA1300::35S::Malnc2310.

Arabidopsis thaliana ecotype Columbia (Col-0) plants were grown in a growth chamber with the following conditions: long-day photoperiod (16 h of light/8 h of dark), light intensity of 170 µmol m^− 2s^− 1, day/night temperatures of 22℃/17℃, and humidity of 65%. The pCAMBIA1300::35S::Malnc2310 plasmids were electroporated into Agrobacterium tumefaciens LBA4404 and then transformed into A. thaliana plants via the floral dip method (Clough and Bent 1998). For identification of 35S::Malnc2310 transgenic homozygous lines, T₀ transgenic Arabidopsis were screened on 1/2 MS media containing 25 µg/mL hygromycin to identify hygromycin-resistant seedlings. To identify T₁ transformants, seeds from each hygromycin-resistant Arabidopsis plant were selected by examining the (3:1) segregation ratio of hygromycin resistance respectively. Totally seven independent T₂ homozygous lines were selected in T₁ progenies and used in the following experiments. The integrity and identity of the transgenes of interest in transgenic lines were assayed by PCR analysis using the Malnc2310 specific primers.

Malnc2310 over-expressed Arabidopsis with Fusarium crude toxin

Fusarium crude toxin (Fu) was extracted according to Xu’s method (Xu et al. 2004). Specifically, 300 mL of freshly prepared Foc TR4 potato dextrose broth was incubated at 28 ºC with shaking at 200 rpm for 3–4 days. Then the broth was centrifuged at 8000 rpm for 10 min at 28 ºC, and the supernatant was collected as the Fusarium crude toxin. To maintain the activity and sterility of the crude extract, the supernatant was filtrated through a 22 µm filter and then condensed to 30 mL through a lyophilizer (EYELA FDU-2110, Tokyo, Japan) before use.

For the effect of Fu on seed germination, all seeds, including the Malnc2310 over-expressed, vector-only transgenic, and WT Arabidopsis, were sterilized and sown on MS with 10% Fu in the growth chamber at the normal temperature with light for 10 days.

The 2 two-week-old Arabidopsis seedlings on MS media were added with Fu extraction for 2 weeks to investigate the effect of Fu extraction on the development of seedlings. They were grown in the chamber with normal temperature and light.

Malnc2310 over-expressed Arabidopsis treated with salt and cold

For salinity treatment on Arabidopsis germination, all seeds, including the Malnc2310 over-expressed, vector-only transgenic, and WT Arabidopsis, were sterilized and sown on MS media with 50, 80 and 100 mM NaCl for 2 weeks in the growth chamber with normal temperature and light. The germination ratio was calculated by the number of plats with roots versus the total seed number.

The two-week old seedlings on MS media in the growth chamber with the normal temperature and light were transferred to a cold chamber at 4 ºC with normal light for 48 h as cold treatment. Then, they were transferred into the chamber with normal temperature and light to grow for 14 days.

Anthocyanin Extraction And Evaluation By HPLC

One-gram fresh leaf sample was ground in liquid nitrogen to extract anthocyanin using 5:1 (v/w) ethanol/H₂O/acetic acid (80:20:1 v/v/v) in an Ultra-Turrax homogenizer for 30 min and extracted overnight at 4 ℃. Anthocyanin was extracted and detected by HPLC as previously described (Li et al. 2015). Anthocyanin concentration was calculated from the peak area at 530 nm as cyanidin 3-O-glucoside (WAKO, Jap, CAS No. 7084-24-4).

Induction of Malnc2310 by Foc TR4 in banana roots

The 450 bp sequence of Malnc2310 was cloned from the ‘BX’ banana root and was shown to contain no potential open reading frame (Fig. 1a). Malnc2310 locates near the 5’ UTR domain of Ma09_g21160, a hypothetical protein through the published banana genome (Musa acuminata ‘DH-Pahang’) (https://banana-genome-hub.southgreen.fr/). Malnc2310 is an intronic lncRNA and share little consensus sequence with the other uploaded banana lncRNAs (http://greenc.sequentiabiotech.com/wiki2/Main_Page). Potential protein coded by Ma09_g21060 containing 59 amino acids does no match to any homologous proteins through BLASTp on NCBI (https://www.ncbi.nlm.nih.gov/). The structure of Malnc2310 was analyzed through the online RNAfold Web server (http://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi). There are a stem and many other small circles in the overall secondary centroid structure of Malnc2310, suggesting that it might have more flexible fold structures. Moreover, the high base-pair probabilities mainly consist of two circles (red) (Fig. 1b).

Understanding the spatiotemporal gene expression dynamics is of particular importance in plant developmental biology. To determine the localization of Malnc2310 at the cellular level, FISH analysis was carried out for the roots of ‘BX’ (purple arrows) 27 hours after inoculation with Foc TR4. Strong green fluorescence signals were detected in the nuclei of vascular cells. In contrast, strong green fluorescence signals were hardly detected in roots without Foc infection (CK), implying that Malnc2310 was mainly induced in the nuclei of phloem cells in roots (Fig. 1c). Furthermore, the expression level of Malnc2310 was investigated in roots and leaves of both banana cultivars. The result indicated that the levels of Malnc2310 were significantly higher in roots than in leaves in both cultivars during the whole treatment time (Fig. 1d). Moreover, the expression levels of Malnc2310 were 3 folds higher in ‘BX’ than in ‘HG’, indicating that it was more closely related to the susceptibility of ‘BX’.

Protein interaction with Malnc2310

To identify the potential target regulated by Malnc2310, we performed a pull-down experiment with the protein extract using the biotin-labeled Malnc2310. Then, LC-MS/MS mass spectrometry analysis was performed on purified proteins. As shown in Fig. 2, eight proteins, i.e. phenylalanine ammonia-lyase (PAL), polyphenol oxidase (PPO), catalase (CAT), RNA small subunit methyltransferase (NOL1/NOP2), fructose-bisphosphate aldolase (FbA), cytochrome f (CYTf), actin-2 (Actin-2) and histone H2A variant 3 (His H2A), were specifically identified in the infected ‘BX’ banana root, and PAL was the only protein bound by the sense of Malnc2310. It is well known that PAL is the key enzyme of the phenylpropanoid pathway and catalyzes phenylalanine into cinnamic acid, and is involved in the biosynthesis of flavonoid, lignin and phytoalexin. This data show that Malnc2310 binds to PAL and regulates the flavonoid metabolism by modulating anthocyanin biosynthesis in banana roots under stresses.

In addition, PPO and CAT have higher activities compared to other five proteins from the Fig. 2. Both PPO (Zhang and Sun 2021) and CAT (Gayatridevi et al. 2012) have been confirmed to be response factors to pathogen infection. Research has shown that PPO and CAT are greatly induced in plants under stress. The binding of Malnc2310 with PPO and CAT proteins also might be due to their highly induced expression. CYTf was intimately related to the programmed cell death (Van Aken and Van Breusegem 2015), and NOL1/NOP2/sun family was mainly involved in the methylation of 5-methylcytosine (Cui et al. 2017). As one of the key enzymes, fructose-bisphosphate aldolase (FBA) participated in many metabolisms, including glycolytic, pentose phosphate pathways and the Calvin cycle. Histone H2A (His H2A) and Actin-2 were extensively involved in gene expression and plant development.

Response of Malnc2310 over-expressed Arabidopsis plants to Fusarium crude extract

Fusaric acid has been verified as the major ingredient of the Fusarium toxin and plays the most important role in pathogenesis (Xu et al. 2004). Fusarium crude extract is mainly composed of fusaric acid (73.34%) and can mimic the main toxin from Foc TR4 (Li et al. 2010). To elucidate the role of Malnc2310 in response to Fusarium, the effect of Fusarium crude extract (Fu) on seed germination and plant development of the Malnc2310 over-expressed (OE) transgenic Arabidopsis lines were investigated in this study. All seeds germinated on MS media containing 10% Fu, with no difference in the germination ratio among Malnc2310 OE, vector-only (VE) transgenic and wild-type (WT) seeds. All seeds hardly germinate on MS media with 50% Fu (Online Resource 1).

When the two-week old Arabidopsis seedlings grown on MS media were added with 3 mL of concentrated Fu for two weeks, obvious chlorosis was noted on the old leaves of OE plants 3 days after application but was not found on the WT plants (Fig. 3a). The leaf width of OE plants treated by Fu (OE-Fu) became smaller on day 6 compared to that of WT treated by Fu (WT-Fu). After 10 days of Fu treatment, the growth from some OE homozygous plants were inhibited, the leaves stayed smaller in compared to the WT plants. Most of the OE plants treated with Fu were induced to produce more lateral roots than the control plants (OE-CK and WT-CK) (Fig. 3a enlarged image). On day 15, the development of all OE-Fu plants was greatly inhibited compared to that of WT-Fu, showing obvious wilt and dwarfing phenotype. The fresh weight of roots was greatly higher in OE-Fu than in other treated plants, while the rosette diameter of the treated OE plants was significantly smaller than that in other treated plants (Fig. 3b).

Moreover, OE-Fu plants appeared to accumulate anthocyanin in leaves on day 11 but other treated plants did not. On day 15, only the leaves of OE-Fu were shown to have significantly accumulated a high concentration of anthocyanin that reached to 3.45 mg g fwt^− 1, while anthocyanin was hardly detected in other plants, indicating that Malnc2310 is involved in anthocyanin biosynthesis in plants (Fig. 3c).

Relationship Of Gene Expression Levels With Root Development And Anthocyanin Accumulation

The expression levels of key genes related to lateral roots development and anthocyanin biosynthesis in Malnc2310 OE Arabidopsis plants under Fu treatment were further investigated.

The expression levels of CYP79B2, AUX1, TIR1 and ARF7 related to auxin biosynthesis and lateral root development (Julkowska et al. 2017; Swarup and Bhosale 2019) in OE-Fu plants were up-regulated by 4- to 5-fold in roots compared to OE plants not treated with Fu (Fig. 4). The expression levels of CYP79B2, AUX1, TIR1 and ARF7 were up-regulated by 2.7- to 3-fold in WT-Fu plants compared to WT plants compared to WT plants not treated with Fu. It speculated that Malnc2310 can participate in the lateral roots development through regulating the expression of genes involved in auxin biosynthesis and transduction under Fu influence.

Phenylalanine ammonia lyase (PAL), chalcones synthesis (CHS), flavanone-3’-hydrooxylase/monooxygenase (F3’H), dihydroflavonol reductase (DFR), and leucoanthocyanidin dioxygenase (LDOX) are involved in the anthocyanin biosynthesis pathway (Winkel-Shirley 2001). Among them, the expression levels of four potential PALs that Malnc2310 binds to were induced in OE-Fu plants, by 1- to 5-fold, compared to other samples (OE-CK, WT-CK and WT-Fu) (Fig. 5a). Especially, AtPAL1 and AtPAL2 were significantly stimulated compared to those in OE plants, by 3- to 5-fold compared OE plants not treated with Fu (Fig. 5a). The early anthocyanin biosynthesis genes, mainly AtCHS and AtF3’H, were also expressed at higher levels (5-fold) in OE-Fu than in other samples (OE-CK, WT-CK and WT-Fu). The later key anthocyanin biosynthesis genes, including AtDFR, AtLDOX1 and AtLDOX2, were also greatly induced in OE-Fu plants through the qRT-PCR result. In brief, the average expression levels of all genes were more than 3 folds in the leaves of OE-Fu than in other samples (OE-CK, WT-CK and WT-Fu). Western blotting analysis confirmed that the PAL1 accumulation was higher in the leaves of OE-Fu than other plants (OE-CK, WT-CK and WT-Fu), suggesting that Malnc2310 might promote the activities of PALs by binding to it when plants are under stresses (Fig. 5b).

Response of the Malnc2310 OE Arabidopsis plants to salinity

Soil salinity can seriously affect crops at any stage of plant growth and ultimately reduce yield. High salinity induces the formation of reactive oxygen species (ROS), which led to oxidative damage in plants under salinity stress (Flowers and Colmer 2015).

The seed germination and seedling growth of OE, WT and VE plants on MS with 80 and 100 mmol/L NaCl were studied. The germination of OE plants was significantly lower on MS media supplemented with 80 mM NaCl on day 7 compared to WT and VE plants. Specifically, the average germination rate of seven OE lines was 60% on MS media supplemented with 80 mM NaCl and the lowest rate was 15%, while WT and VE seeds germinated 100% on day 7 (Fig. 6a). Moreover, all WT and VE seeds were germinated at day 4, while the germination of OE lines were delayed and some did not germinate until 7 days later. The spread between two cotyledons is an indicator for the length and development phenotype of leaves. Statistical analysis showed that the spread of leaves and the root length of OE lines were significantly smaller and shorter than WT and VE plants under high salinity, respectively (Fig. 6b). Moreover, on MS with 100 mM NaCl, 85% of WT and VE seeds germinated on day 4, while only two OE lines (T-2 and T-6) germinated on day 4 and most OE lines did not germinate until day 10 (Online Resource 2). These results indicate that Malnc2310 renders the OE transgenic Arabidopsis plants more susceptible to high salinity.

Response of the Malnc2310 OE Arabidopsis plants to cold

Coldness as one of the harsh climatic stresses is being extensively studied. As reported, cold stress can enhance ROS production to disrupt electron transport chains and cellular processes, resulting in reduced crop growth and yield (Gill and Tuteja 2010). The Malnc2310 OE Arabidopsis plants were investigated in their response to cold stress in this study.

For cold stress, all two-week old plants were put to a chamber at 4 ℃ for 48 h and then transferred to the normal growth chamber with 22 ℃ and 16 h of light/8 h of dark for two weeks. Most old leaves of OE lines were found to turn yellow and wilt, while all leaves of WT and VE plants remained green on day 14 after cold treatment (Fig. 7a). Overall, leaves of all plants under cold treatment became thinner than those under 22 ℃. More than 50% of OE plants accumulated anthocyanin in petioles and leaves under cold treatment. Additionally, the average concentration of anthocyanin in OE plants was more than 1.4 folds compared to WT and VE plants (Fig. 7b). The gene expression levels involved in anthocyanin biosynthesis including PAL1, CHS, F3’H, DFR, and LDOX1 in OE-cold plants were more than 3-fold higher the WT-cold plants. Particularly AtPAL1 was upregulated to more than 5-fold in OE-cold plants compared to WT-cold plants (Fig. 7c). Moreover, we found that about 50% cold treated OE lines bloomed one month earlier than WT- and VE-cold plants. There was no difference in the average weight and length of the roots among all Arabidopsis plants. The yellow old leaves, anthocyanin accumulation and the early blossoming of OE Arabidopsis plants under cold stress indicate that Malnc2310 overexpression results in susceptibility to cold stress in transgenic plants.

Banana (Musa spp.) is one of the world’s most important fruits and is consumed as staple food in many tropical and subtropical countries. However, most of the leading banana cultivars are susceptibility to Fusarium wilt caused by Foc TR4 (Wang et al. 2012). Therefore, better understand to the response of banana to this disease is needed.

In the past decades, efforts on the genetic improvement to disclose the interaction mechanism between banana and Foc TR4 has been focused on effector genes or proteins. The technical innovations of genome sequencing, RNA-sequencing and advanced bioinformatics tool have greatly improved the functional elucidation of metabolism pathways, various coding genes and proteins related to the response of banana to Foc. For instance, phenylpropanoid biosynthesis, phenylalanine metabolism, and phytohormone biosynthesis and metabolism, and key genes encoding peroxidase, polyphenol oxidase and chitinase have been found to play important roles in banana response to stresses (Li et al. 2012; Bai et al. 2013; Li et al. 2019; Swarupa et al. 2013; Candra et al. 2022). The novel and feasible approaches have also played important roles to uncover the complicated regulation of lncRNAs in plant development, and significant progresses have been achieved in plant lncRNA functional prediction and characterization (Waseem et al. 2020). For instance, various stress-responsive mRNAs, regulatory transcription factors, or microRNAs are proved to be the potential targets of lncRNAs (Chekanova 2015), as well as the responses of plants to stress are closely related to lncRNAs (Chen and Carmichael 2010; Fok et al. 2017). In the present study, we show that biotic stress (Foc TR4) can induce the high expression of the long non-coding RNA Malnc2310 in susceptible banana roots and the Malnc2310 OE Arabidopsis plants are more sensitive to Fu, cold and salinity stresses. In addition, we have indicated that the promoter of Malnc2310 can greatly induce the activities of GUS in Arabidopsis plants treated with NaCl and Fu (Li et al. 2022). So Malnc2310 is a novel gene involved in the response of banana to stress.

LncRNA are involved in a wide range of biological functions through diverse molecular mechanisms, including the interaction with one or more proteins to regulate the expression of genes (Zhu et al. 2013; Wang et al. 2008). Most of lncRNAs have been verified to require the interaction with one or more RNA-binding proteins (RBPs) and the deregulation of RBPs is frequently associated to pathologies in plants (Ferrè et al. 2016). LncRNAs interact with proteins and modulate proteins in various ways, one of which is mediation of protein localization. For instance, the first plant lncRNA ENOD40 guides the re-localization of MtRBP1 into cytoplasmic granules in Medicago truncatula at the stage of nodule formation (Campalans et al. 2004). Post-translational modification of proteins is an important part of proteomics and lncRNAs also participate in post-translational modification of proteins. LncRNA OLA1P2 markedly affects STAT3 signaling activity by inhibiting the nuclear import of phosphorylated STAT3 in human, because OLA1P2 has the same conserved STAT3 transcriptional response element as the STAT3 target gene, and it directly interacts with STAT3 and inhibits its phosphorylation (Guo et al. 2016). Moreover, some lncRNA directly bind to proteins to change phosphorylation or catalytic activity of protein. A lnc-DC binds directly to STAT3 protein in the cytoplasm, which promotes STAT3 phosphorylation on tyrosine-705 by preventing STAT3 binding to SHP1 and prevents SHP1 dephosphorylation (Wang et al. 2014). LncRNA-ACOD1 directly binds the metabolic enzyme glutamic-oxaloacetic transaminase (GOT2), enhancing its catalytic activity, so the recombinant GOT2 protein and its metabolites could rescue viral replication and increase viral lethality in cell (Wang et al. 2017). We have obtained a zinc finger protein that can bind to the promote sequence of Malnc2310 (Li et al. 2022). In this study, we have verified that Malnc2310 can bind to PAL in banana roots and the Fu treatment led to higher activity of PAL in Malnc2310 OE Arabidopsis. Phenylalanine ammonia-lyase (PAL) is more relevant than other enzymes to the biosynthesis of plant flavonoids (Reyes Jara et al. 2022; Phimchan et al. 2014) and PAL knocked-down plants are susceptible to fungal pathogen (Cass et al. 2015; Wang et al. 2020). Since PAL is involved in the response network of plants to stresses, our study illustrated that Malnc2310 alone or with the binding protein changes the expression or the activity of PAL to participate in the response process of plants to stress.

In addition, lncRNAs has been broadly defined as potential regulators in pigment formation in plants (Chialva et al. 2021; Zhang et al. 2018; Yang et al. 2019a). For instance, MdLNC610, an ethylene-related gene, was shown to be induced by high-light to regulate anthocyanin accumulation by mediating the positive regulation of MdACO1 expression in apple (Yu et al. 2022). In the MdWRKY1-MdLNC499-MdERF109 transcriptional cascade, MdWRKY1 is activated by light to increase the transcription of MdLNC499, which in turn induces MdERF109. The MdERF109 protein induces the expression of anthocyanin-related genes and the accumulation of anthocyanins in apple (Ma et al. 2021). Anthocyanins biosynthesis in plants is a part of the phenylpropanoid pathway and PAL belongs to the early biosynthesis genes for anthocyanin biosynthesis (Zhang et al. 2014). Many later anthocyanin biosynthesis genes including CHS, CHI, F3H, F3’H, F3’5’H, DFR and LDOX and some important transcription factors MYB, bHLH and WD (Liu et al. 2021), also become to the potential binding targets of lncRNAs. Since anthocyanin biosynthesis and its regulation have been shown as an elucidated network, so our study demonstrate that Malnc2310 might play a potentially important role in anthocyanin biosynthesis or flavonoid pathway through regulating these genes or proteins in plants.

As a noncoding RNAs with many sub-circles in its structure, Malnc2310 may have the potential ability to fold into complex 3D-conformations that enables it to form specific interactions with proteins. It also demonstrated that Malnc2310 can bind to eight identified proteins in banana roots under Foc stress. For instance, PPO usually oxidizes polyphenols to quinones in plants and improves plant resistance to pathogen infection (Li and Steffens 2002; Wang and Constabel 2004). CAT catalyzes the decomposition of hydrogen peroxide in cells to prevent membrane lipid peroxidation and oxidative damage caused by various biotic and abiotic stresses (Mhamdi et al. 2010). Likewise, the ELF18-related ELENA1 induced by infection of Pseudomonas syringae had been found to interact with FIB2, which in turn directly interacts with MED19a, and enhances the expression of pathogenesis-related gene 1 (PR1) by blocking the binding of FIB2 to MED19a and releasing FIB2 from PR1 promoter (Seo et al. 2017; Seo et al. 2019). The other binding proteins, programmed cell death related CYTf protein family (Van Aken and Van Breusegem 2015) and gene methylation related NOL1/NOP2/sun family (Cui et al. 2017), also indicated that Malnc2310 might be widely involved in plant growth and development. The binding protein FBA, His H2A, and Actin-2 may indicate that Malnc2310 widely participated in the various foundational or housekeeping physiological processes during plant development. Current knowledge illustrates an intricate interaction network between lncRNAs and proteins, more research is needed to fully understand how Malnc2310 binds to its target proteins and modulate their activities.

Our results have demonstrated that Malnc2310 is an important negative regulator of plant stress tolerance by mediating the activities of PAL or other proteins. These findings will be helpful in targeted manipulation of plant stress tolerance improvement.

Funding:

This study was supported by High-Level Talents Project of Hainan Provincial Natural Science Foundation (2019RC292) and the National Key Research and Development Program (2019YFD1000204).

Competing interests:

All authors declare they have no financial interests.

Author contributions:

All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Wenbin Li, Pingjuan Zhao, Jianbo Sun, Xiaoling Yu, Liangping Zou, and Shuxia Li. The first draft of the manuscript was written by Wenbin Li. The manuscript was revised by Rong Di, Mengbin Ruan and Ming Peng. All authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

Data availability:

All original datasets had been included in the text.

Bai TT, Xie WB, Zhou PP, Wu ZL, Xiao WC, Zhou L, Sun J, Ruan XL, Li HP (2013) Transcriptome and expression profile analysis of highly resistant and susceptible banana roots challenged with Fusarium oxysporum f. sp. cubense tropical race 4. PLoS ONE 8:e73945. https://doi:10.1371/journal.pone.0073945
Ben Amor B, Wirth S, Merchan F, Laporte P, d'Aubenton-Carafa Y, Hirsch J, Maizel A, Mallory A, Lucas A, Deragon JM, Vaucheret H, Thermes C, Crespi M (2009) Novel long non-protein coding RNAs involved in Arabidopsis differentiation and stress responses. Genome Res 19:57–69. https://doi:10.1101/gr.080275.108
Bilir O, Telli O, Norman C, Budak H, Hong Y, Tor M (2019) Small RNA inhibits infection by downy mildew pathogen Hyaloperonospora arabidopsidis. Mol Plant Pathol 20:1523–1534. https://doi:10.1111/mpp.12863
Brosnan CA, Voinnet O (2009) The long and the short of noncoding RNAs. Curr Opin Cell Biol 21:416–425. https://doi:10.1016/j.ceb.2009.04.001
Campalans A, Kondorosi A, Crespi M (2004) Enod40, a short open reading frame-containing mRNA, induced cytoplasmic localization of a nuclear RNA binding protein in Medicago truncatula. Plant Cell 16:1047–1059. https://doi:10.1105/tpc.019406
Candra RT, Prasasty VD, Karmawan LU (2022) Biochemical analysis of banana plants in interaction between endophytic bacteria Kocuria rhizophila and the fungal pathogen Fusarium oxysporum f. sp. cubense Tropical Race (Foc TR4). Biology and Life Sciences Forum 11:1–8. https://doi:10.3390/xxxxx
Cao ZY, Zhao T, Wang LY, Han J, Chen JW, Hao YP, Guan XY (2021) The lincRNA XH123 is involved in cotton cold-stress regulation. Plant Mol Biol 106:521–531. https://doi:10.1007/s11103-021-01169-1
Cass CL, Peraldi A, Dowd PF, Mottiar Y, Santoro N, Karlen SD, Bukhman YV, Foster CE, Thrower N, Bruno LC, Moskvin OV, Johnson ET, Willhoit ME, Phutane M, Ralph J, Mansfield SD, Nicholson P, Sedbrook JC (2015) Effects of PHENYLALANINE AMMONIA LYASE (PAL) knockdown on cell wall composition, biomass digestibility, and biotic and abiotic stress responses in Brachypodium. J Exp Bot 66:4317–4335. https://doi:10.1093/jxb/erv269
Chekanova JA (2015) Long non-coding RNAs and their functions in plants. Curr Opin Plant Biol 27:207–216. https://doi:10.1016/j.pbi.2015.08.003
Chen LL, Carmichael GG (2010) Decoding the function of nuclear long non-coding RNAs. Curr Opin Cell Biol 22:357–364. https://doi:10.1016/j.ceb.2010.03.003
Chialva C, Blein T, Crespi M, Lijavetzky D (2021) Insights into long non-coding RNA regulation of anthocyanin carrot root pigmentation. Sci Rep 11:4093. https://doi:10.1038/s41598-021-83514-4
Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16:735–743. https://doi:10.1046/j.1365-313x.1998.00343.x
Csorba T, Sun IQJ, Dean QW C (2014) Antisense COOLAIR mediates the coordinated switching of chromatin states at FLC during vernalization. Proc Natl Acad Sci USA 111:16160–16165. https://doi:10.1073/pnas.1419030111
Cui X, Liang Z, Shen L, Zhang Q, Bao S, Geng Y, Zhang B, Leo V, Vardy LA, Lu T, Gu X, Yu H (2017) 5-Methylcytosine RNA Methylation in Arabidopsis Thaliana. Mol Plant 10:1387–1399. https://doi:10.1016/j.molp.2017.09.013
Di Marsico M, Paytuvi Gallart A, Sanseverino W, Aiese Cigliano R (2022) GreeNC 2.0: a comprehensive database of plant long non-coding RNAs. Nucleic Acids Res 50:D1442–D1447. https://doi:10.1093/nar/gkab1014
Ding J, Lu Q, Ouyang Y, Mao H, Zhang P, Yao J, Xu C, Li X, Xiao J, Zhang Q (2012) A long noncoding RNA regulates photoperiod-sensitive male sterility, an essential component of hybrid rice. Proc Natl Acad Sci USA 109:2654–2659. https://doi:10.1073/pnas.1121374109
Fan CY, Hao ZQ, Yan JH, Li GL (2015) Genome-wide identification and functional analysis of lincRNAs acting as miRNA targets or decoys in maize. BMC Genomics 16:793. https://doi:10.1186/s12864-015-2024-0
Ferrè F, Colantoni A, Helmer-Citterich M (2016) Revealing protein-lncRNA interaction. Brief Bioinform 17:106–116. https://doi:10.1093/bib/bbv031
Flowers TJ, Colmer TD (2015) Plant salt tolerance: adaptations in halophytes. Ann Bot 115:327–331. https://doi:10.1093/aob/mcu267
Fok ET, Scholefield J, Fanucchi S, Mhlanga MM (2017) The emerging molecular biology toolbox for the study of long noncoding RNA biology. Epigenomics 9:1317–1327. https://doi:10.2217/epi-2017-0062
Franco-Zorrilla JM, Valli A, Todesco M, Mateos I, Puga MI, Rubio-Somoza I, Leyva A, Weigel D, Garcia JA, Paz-Ares J (2007) Target mimicry provides a new mechanism for regulation of microRNA activity. Nat Genet 39:1033–1037. https://doi:10.1038/ng2079
Gayatridevi S, Jayalakshmi SK, Screeramulu K (2012) Salicylic acid is a modulator of catalase isozymes in chickpea plants infected with Fusarium oxysporum f. sp. ciceri. Plant physiol biochem 52:154–161. https://doi:10.1016/j.plaphy.2011.12.005
Gill SS, Tuteja N (2010) Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol Biochem 48:909–930. https://doi:10.1016/j.plaphy.2010.08.016
Golczyk H (2019) A simple non-toxic ethylene carbonate fluorescence in situ hybridization (EC-FISH) for simultaneous detection of repetitive DNA sequences and fluorescent bands in plants. Protoplasma 256:873–880. https://doi:10.1007/s00709-019-01345-7
Guo H, Liu J, Ben Q, Qu Y, Li M, Wang Y, Chen W, Zhang J (2016) The aspirin-induced long non-coding RNA OLA1P2 blocks phosphorylated STAT3 homodimer formation. Genome Biol 17:24. https://doi:10.1186/s13059-016-0892-5
Jha UC, Nayyar H, Jha R, Khurshid M, Zhou M, Mantri N, Siddique KHM (2020) Long non-coding RNAs: emerging players regulating plant abiotic stress response and adaptation. BMC Plant Biol 20:466. https://doi:10.1186/s12870-020-02595-x
Joshi RK, Megha S, Basu U, Rahman MH, Kav NN (2016) Genome wide identification and functional prediction of long non-coding RNAs responsive to sclerotinia sclerotiorum infection in Brassica napus. PLoS ONE 11:e0158784. https://doi:10.1371/journal.pone.0158784
Julkowska MM, Koevoets IT, Mol S, Hoefsloot H, Feron R, Tester MA, Keurentjes JJB, Korte A, Haring MA, de Boer GJ, Testerink C (2017) Genetic components of root architecture remodeling in response to salt stress. Plant Cell 29:3198–3213. https://doi:10.1105/tpc.16.00680
Kim DH, Xi Y, Sung S (2017) Modular function of long noncoding RNA, COLDAIR, in the vernalization response. PLoS Genet 13:e1006939. https://doi:10.1371/journal.pgen.1006939
Kindgren P, Ard R, Ivanov M, Marquardt S (2018) Transcriptional read-through of the long non-coding RNA SVALKA governs plant cold acclimation. Nat Commun 9:4561. https://doi:10.1038/s41467-019-13269-0
Li C, Li YJ, Yu L, Huang BZ (2010) Ingredient analysis and bioassay of the toxin of Fusarium oxysporum f. sp. cubense. J Fruit Sci 27:969–974 (In Chinese with English abstract). https://doi:10.13925/j.cnki.gsxb.2010.06.043
Li CY, Deng GM, Yang J, Viljoen A, Jin Y, Kuang RB, Zuo CW, Lv ZC, Yang QS, Sheng O, Wei YR, Hu CH, Dong T, Yi GJ (2012) Transcriptome profiling of resistant and susceptible Cavendish banana roots following inoculation with Fusarium oxysporum f. sp. cubense tropical race 4. BMC Genomics 13:374. https://doi:10.1186/1471-2164-13-374
Li F, Shi T, He A, Huang X, Gong J, Yi Y, Zhang J (2020) Bacillus amyloliquefaciens LZ04 improves the resistance of Arabidopsis thaliana to high calcium stress and the potential role of lncRNA-miRNA-mRNA regulatory network in the resistance. Plant Physiol Biochem 151:166–180. https://doi:10.1016/j.plaphy.2020.03.022
Li L, Steffens JC (2002) Overexpression of polyphenol oxidase in transgenic tomato plants results in enhanced bacterial disease resistance. Planta 215:239–247. https://doi:10.1007/s00425-002-0750-4
Li WB, Wang XL, Li CQ, Sun JB, Li SX, Peng M (2019) Dual species transcript profiling during the interaction between banana (Musa acuminata) and the fungal pathogen Fusarium oxysporum f. sp. cubense. BMC Genomics 20:519. https://doi:10.1186/s12864-019-5902-z
Li WB, Li CQ, Li SX, Peng M (2017) Long noncoding RNAs that respond to Fusarium oxysporum infection in 'Cavendish' banana (Musa acuminata). Sci Rep 7:16939. https://doi:10.1038/s41598-017-17179-3
Li WB, Liu YF, Zeng SH, Xiao G, Wang G, Wang Y, Peng M, Huang HW (2015) Gene expression profiling of development and anthocyanin accumulation in kiwifruit (Actinidia chinensis) based on transcriptome sequencing. PLoS ONE 10:e0136439. https://doi:10.1371/journal.pone. 0136439
Li WB, Yu XL, Yan YC, Sun JB (2022) Analysis of long noncoding RNA gene Malnc2310 promoter from banana (Musa Spp.) and identification of its regulators. Journal of Nanjing Agricultural University, Accepted
Liu F, Xu Y, Chang K, Li S, Liu Z, Qi S, Jia J, Zhang M, Crawford NM, Wang Y (2019) The long noncoding RNA T5120 regulates nitrate response and assimilation in Arabidopsis. New Phytol 224:117–131. https://doi:10.1111/nph.16038
Liu W, Feng Y, Yu S, Fan Z, Li X, Li J, Yin H (2021) The flavonoid biosynthesis network in plants. Int J Mol Sci 22:12824. https://doi:10.3390/ijms222312824
Ma H, Yang T, Li Y, Zhang J, Wu T, Song T, Yao Y, Tian J (2021) The long noncoding RNA MdLNC499 bridges MdWRKY1 and MdERF109 function to regulate early-stage light-induced anthocyanin accumulation in apple fruit. Plant Cell 33:3309–3330. https://doi:10.1093/plcell/koab188
Mhamdi A, Queval G, Chaouch S, Vanderauwera S, Van Breusegem F, Noctor G (2010) Catalase function in plants: a focus on Arabidopsis mutants as stress-mimic models. J Exp Bot 61:4197–4220. https://doi:10.1093/jxb/erq282
Pegg KG, Coates LM, O'Neill WT, Turner DW (2019) The epidemiology of Fusarium wilt of banana. Front Plant Sci 10:1395. https://doi:10.3389/fpls.2019.01395
Phimchan P, Chanthai S, Bosland PW, Techawongstien S (2014) Enzymatic changes in phenylalanine ammonia-lyase, cinnamic-4-hydroxylase, capsaicin synthase, and peroxidase activities in capsicum under drought stress. J Agric Food Chem 62:7057–7062. https://doi:10.1021/jf4051717
Reyes Jara AM, Gomez Lobato ME, Civello PM, Martinez GA (2022) Phenylalanine ammonia lyase is more relevant than chalcone synthase and chalcone isomerase in the biosynthesis of flavonoids during postharvest senescence of broccoli. J Food Biochem 46:e14054. https://doi:10.1111/jfbc.14054
Rymarquis LA, Kastenmayer JP, Huttenhofer AG, Green PJ (2008) Diamonds in the rough: mRNA-like non-coding RNAs. Trends Plant Sci 13:329–334. https://doi:10.1016/j.tplants.2008.02.009
Seo JS, Diloknawarit P, Park BS, Chua NH (2019) ELF18-INDUCED LONG NONCODING RNA 1 evicts fibrillarin from mediator subunit to enhance PATHOGENESIS-RELATED GENE 1 (PR1) expression. New Phytol 221:2067–2079. https://doi:10.1111/nph.15530
Seo JS, Sun HX, Park BS, Huang CH, Yeh SD, Jung C, Chua NH (2017) ELF18-INDUCED LONG-NONCODING RNA associates with mediator to enhance expression of innate immune response genes in Arabidopsis. Plant Cell 29:1024–1038. https://doi:10.1105/tpc.16.00886
Shi H, Shi HS, Chen R, Harrison MJ (2006) Loss of At4 function impacts phosphate distribution between the roots and the shoots during phosphate starvation. Plant J 45:712–726. https://doi:10.1111/j.1365-313X.2005.02629.x
Swarup R, Bhosale R (2019) Developmental roles of AUX1/LAX auxin influx carriers in plants. Front Plant Sci 10:1306. https://doi:10.3389/fpls.2019.01306
Swarupa V, Ravishankar KV, Rekha A (2013) Characterization of tolerance to Fusarium oxysporum f.sp. cubense infection in banana using suppression subtractive hybridization and gene expression analysis. Physiol Mol Plant P 83:1–7. https://doi:10.1016/j.plantsci.2006.06.013
Van Aken O, Van Breusegem F (2015) Licensed to kill: mitochondria, chloroplasts, and cell Death. Trends Plant Sci 20:754–766. https://doi:10.1016/j.tplants.2015.08.002
Wang J, Chen Q, Wu W, Chen Y, Zhou Y, Guo G, Chen M (2021) Genome-wide analysis of long non-coding RNAs responsive to multiple nutrient stresses in Arabidopsis thaliana. Funct Integr Genomics 21:17–30. https://doi:10.1007/s10142-020-00758-5
Wang J, Constabel CP (2004) Polyphenol oxidase overexpression in transgenic Populus enhances resistance to herbivory by forest tent caterpillar (Malacosoma disstria). Planta 220:87–96. https://doi:10.1007/s00425-004-1327-1
Wang KC, Chang HY (2011) Molecular mechanisms of long noncoding RNAs. Mol Cell 43:904–914. https://doi:10.1016/j.molcel.2011.08.018
Wang KC, Yang YW, Liu B, Sanyal A, Corces-Zimmerman R, Chen Y, Lajoie BR, Protacio A, Flynn RA, Gupta RA, Wysocka J, Lei M, Dekker J, Helms JA, Chang HY (2011) A long noncoding RNA maintains active chromatin to coordinate homeotic gene expression. Nature 472:120–124. https://doi:10.1038/nature09819
Wang P, Xu J, Wang Y, Cao X (2017) An interferon-independent lncRNA promotes viral replication by modulating cellular metabolism. Science 358:1051–1055. https://doi:10.1126/science.aao0409
Wang P, Xue Y, Han Y, Lin L, Wu C, Xu S, Jiang Z, Xu J, Liu Q, Cao X (2014) The STAT3-binding long noncoding RNA lnc-DC controls human dendritic cell differentiation. Science 344:310–313. https://doi:10.1126/science.1251456
Wang S, Liu S, Liu L, Li R, Guo R, Xia X, Wei C (2020a) miR477 targets the phenylalanine ammonia-lyase gene and enhances the susceptibility of the tea plant (Camellia sinensis) to disease during Pseudopestalotiopsis species infection. Planta 251:59. https://doi:10.1007/s00425-020-03353-x
Wang W, Hu Y, Sun D, Staehelin C, Xin D, Xie J (2012) Identification and evaluation of two diagnostic markers linked to Fusarium wilt resistance (race 4) in banana (Musa spp.). Mol Biol Rep 39:451–459. https://doi:10.1007/s11033-011-0758-6
Wang X, Arai S, Song X, Reichart D, Du K, Pascual G, Tempst P, Rosenfeld MG, Glass CK, Kurokawa R (2008) Induced ncRNAs allosterically modify RNA-binding proteins in cis to inhibit transcription. Nature 454(7200):126–130. https://doi:10.1038/nature06992
Wang Y, Luo X, Sun F, Hu J, Zha X, Su W, Yang J (2018b) Overexpressing lncRNA LAIR increases grain yield and regulates neighbouring gene cluster expression in rice. Nat Commun 9:3516. https://doi:10.1038/s41467-018-05829-7
Wasaki J, Yonetani R, Shinano T, Kai M, Osaki M (2003) Expression of the OsPI1 gene, cloned from rice roots using cDNA microarray, rapidly responds to phophorus status. New Phytol 158:239–248. https://doi:10.1046/j.1469-8137.2003.00748.x
Waseem M, Liu Y, Xia R (2020) Long non-coding RNAs, the dark matter: an emerging regulatory component in plants. Int J Mol Sci 22. https://doi:10.3390/ijms22010086
Winkel-Shirley B (2001) Flavonoid biosynthesis. a colorful model for genetics, biochemistry, cell biology, and biotechnology. Plant Physiol 126:485–493. https://doi:10.1104/pp.126.2.485
Xu W, Wu X, Yang J, Yang K (2004) The pathogenic reaction of banana pesudostem cells to different races of vascular wilt fungus and their crude toxins. Acta phytopathologica sinica 34:425–430 (in Chinese with English abstract). https://doi:10.13926/j.cnki.apps.2004.05.007
Yang T, Ma H, Zhang J, Wu T, Song T, Tian J, Yao Y (2019a) Systematic identification of long noncoding RNAs expressed during light-induced anthocyanin accumulation in apple fruit. Plant J 100:572–590. https://doi:10.1111/tpj.14470
Yang Y, Liu T, Shen D, Wang J, Ling X, Hu Z, Chen T, Hu J, Huang J, Yu W, Dou D, Wang MB, Zhang B (2019) Tomato yellow leaf curl virus intergenic siRNAs target a host long noncoding RNA to modulate disease symptoms. PLoS Pathog 15:e1007534. https://doi:10.1371/journal.ppat.1007534
Yu J, Qiu K, Sun W, Yang T, Wu T, Song T, Zhang J, Yao Y, Tian J (2022) A long noncoding RNA functions in high-light-induced anthocyanin accumulation in apple by activating ethylene synthesis. Plant Physiol 189:66–83. https://doi:10.1093/plphys/kiac049
Zhang B, Su T, Li P, Xin X, Cao Y, Wang W, Zhao X, Zhang D, Yu Y, Li D, Yu S, Zhang F (2021) Identification of long noncoding RNAs involved in resistance to downy mildew in Chinese cabbage. Hortic Res 8:44. https://doi:10.1038/s41438-021-00479-1
Zhang G, Chen D, Zhang T, Duan A, Zhang J, He C (2018) Transcriptomic and functional analyses unveil the role of long non-coding RNAs in anthocyanin biosynthesis during sea buckthorn fruit ripening. DNA Res 25:465–476. https://doi:10.1093/dnares/dsy017
Zhang J, Sun X (2021) Recent advances in polyphenol oxidase-mediated plant stress responses. Phytochemistry 181:112588. https://doi:10.1016/j.phytochem.2020.112588
Zhang TQ, Lian H, Zhou CM, Xu L, Jiao Y, Wang JW (2017) A two-step model for de novo activation of WUSCHEL during plant shoot regeneration. Plant Cell 29:1073–1087. https://doi:10.1105/tpc.16.00863
Zhang Y, Butelli E, Martin C (2014) Engineering anthocyanin biosynthesis in plants. Curr Opin Plant Biol 19:81–90. https://doi:10.1016/j.pbi.2014.05.011
Zheng WR, Hu HC, Lu QS, Jin P, Cai LN, Hu CL, Yang J, Dai LY, Chen JP (2021) Genome-Wide identification and characterization of long noncoding RNAs involved in Chinese Wheat Mosaic Virus infection of Nicotiana benthamiana. Biology 10:232. https://doi:10.3390/biology10030232
Zhu JJ, Fu HJ, Wu YG, Zheng XF (2013) Function of lncRNAs and approaches to lncRNA-protein interactions. Sci China Life Sci 56(10):876–885. https://doi:10.1007/s11427-013-4553-6
Statements & Declarations

Download PDF

Journal Publication

published 28 Jul, 2023

Read the published version in Plant Molecular Biology →

Editorial decision: Major revisions
29 Dec, 2022
Reviewers agreed at journal
23 Nov, 2022
Reviewers invited by journal
14 Nov, 2022
Editor invited by journal
14 Nov, 2022
Editor assigned by journal
14 Nov, 2022
First submitted to journal
09 Nov, 2022

You are reading this latest preprint version

Biological function research of the long non-coding RNA Malnc2310 in bananas induced by Fusarium oxysporum f. sp. cubense

Status:

Journal Publication

Version 2

Abstract

Figures

Introduction

Material And Methods

RNA Fluorescence In Situ Hybridization (FISH)

RNA Extraction, cDNA Synthesis And Quantitative Real-time RT-PCR (qRT-PCR) Analysis

Anthocyanin Extraction And Evaluation By HPLC

Results

Relationship Of Gene Expression Levels With Root Development And Anthocyanin Accumulation

Discussion

Declarations

References

Status:

Journal Publication

Version 2