TTC39C may be a new target for the treatment of lung adenocarcinoma

doi:10.21203/rs.3.rs-1839531/v1

Download PDF

Research Article

TTC39C may be a new target for the treatment of lung adenocarcinoma

https://doi.org/10.21203/rs.3.rs-1839531/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background: The tetratricopeptide repeat domain 39C ( TTC39C ) gene is a novel TTC genes, which mainly mediates the interaction between proteins. It has been shown to be involved in the progression of a variety of tumors. Here we aimed to identify the effect of TTC39C on lung adenocarcinoma, which can be used as potential intervention targets.

Methods: Take samples from TCGA database for difference analysis of TTC39C. Transwell experiment was used to detect the ability of cell metastasis. Celigo and MTT assay detected the effect of TTC39C gene subtraction on cell proliferation. FACS was used to detect the effect of TTC39C gene subtraction on apoptosis. Clonal formation experiment was used to detect the effect of TTC39C gene subtraction on clonal ability. Transcriptomics, proteomics and metabolomics were used to study the possible enrichment pathway of TTC39C gene in the progression of lung adenocarcinoma.

Results: TTC39C expression was significantly increased in lung adenocarcinoma. the proliferation, metastasis and cloning ability of human lung cancer cells were inhibited, while the apoptosis of cells increased significantly after TTC39C depletion. It is concluded that TTC39C may be involved in the progression of LUAD mainly through metabolic pathway and p53 pathway through transcriptomics combined with proteomics and metabolomics.

Conclusion: In summary, TTC39C plays an important role in regulating the proliferation and metastasis of lung adenocarcinoma cells. The main pathways involved in TTC39C in lung adenocarcinoma mainly include energy metabolism and p53 pathway.

TTC39C

Lung adenocarcinoma

Bioinformatics

TPR

Lung cancer is still one of the highest mortality cancers in the world [1]. Even if the cure rate of it is improving. Most patients with lung cancer are treated in the late stage because they are asymptomatic in the early stage [2]. Lung adenocarcinoma (LUAD) is the most common subtype of lung cancer, and its incidence rate is increasing year by year [3, 4]. This may be due to the increase of smokers [5]. Although LUAD occurs in smokers, it is more common in women, especially Asian women, than men [6, 7]. And LUAD is more likely to occur in young people than other types of lung cancer [8]. In addition to smoking, external environmental factors, genomic changes, including abnormal activation of signal pathways caused by gene amplification, mutation, or translocation, are the main reasons for the progression of lung adenocarcinoma [9-11]. At present, the treatment of lung cancer is mainly molecular targeted therapy and immunotherapy. The interaction between PD-L1 and programmed death receptor-1 (PD-1) on lung cancer cells leads to the inhibition of signal transduction [12]. This interaction effectively inhibited the response of T cells to tumor. Now, monoclonal antibodies have been used as immunomodulatory therapy for patients with LUAD [13, 14]. Although they can significantly improve the survival time of patients, the cure of lung cancer patients is still a difficult problem. Therefore, new therapeutic targets will provide a direction for the treatment of lung adenocarcinoma.

TTC proteins are widely involved in the formation of protein complexes and important biological processes such as intracellular transport, vesicle fusion, protein folding, cell cycle and transcriptional regulation. The tetratricopeptide repeat domain 39C gene (TTC39C), a novel TTC genes, is a protein-coding gene located on the long arm of chromosome 18 [16]. Studies have shown that TTC39C gene expression is significantly up-regulated in STK11 mutant lung cancer tissue samples [17]. The protein encoded by TTC39C gene contains several putative tetrapeptide repeat ( TPR ) domains, which is a structural motif that has been shown to contribute to protein-protein interactions [18]. TPR has been found to play a role in cell cycle regulation and signal domain [19, 20]. Lung cancer can trigger host immune response and trigger antibodies against tumor antigens (AAbs). Tetratricopeptide repeat domain 14 (TTC14) , as a messenger RNA that is the target of AABS, is highly expressed in LUAD [21] . In conclusion, we speculate that TTC39C may mediate the interaction between proteins in patients with LUAD through the special protein space structure of TPR.

In this study, we analyzed the significant increase of TTC39C expression in patients with lung adenocarcinoma by TCGA database. Moreover, we found that the survival rate of lung adenocarcinoma patients with high TTC39C expression was significantly reduced. The proliferation rate of A549 and NCI-H1299 cells was significantly inhibited after TTC39C was knockout, and the metastatic ability of the two cells was also significantly inhibited. In addition, A549 and NCI-H1299 cells apoptosis increased and clonogenic ability was inhibited. Further, transcriptomics, proteomics and metabolomics analysis showed that TTC39C gene may be involved in the disease progression of lung adenocarcinoma by mediating cell energy transport and signal pathway transduction.

Cell transfection

A549 cell lines were purchased in CAS, China and NCI-H1299 cell lines were purchased in ATCC USA.. The A549 cell were cultured with F12K medium (Invitrogen，21127-022) supplemented with 10% fetal bovine serum (Ausbian VS500T). The NCI-H1299 cell were cultured with 1640 medium (Corning, 10-040-CVB), supplemented with 10% fetal bovine serum. A549 and NCI-H1299 cells grown in logarithmic phase were inoculated into six well plates. A549 cells were transfected with 10 μl shTTC39C / shCtrl (Genechem, China) and NCI-H1299 cells were transfected with 5 μl shTTC39C / shCtrl according to the manufacturer’s instructions. The medium was changed to complete medium after 8 h -16 h. The expression of reporter genes (such as GFP) was observed by fluorescence microscope about 72 h after infection and the fluorescence rate was the positive infection rate. All methods were carried out in accordance with relevant guidelines.

Animal model of LUAD

Female BALB/c nude mice (20–22 g, 4 weeks) were purchased from Beijing Wei Tong Li Hua Laboratory Animal Technology Co., Ltd. All animal experiments were approved by Animal Experimental Ethics Committee (Number: GSGC0291706). Animal experiments took place at the Animal Experiment Center in (No.332 Edison Road). Mice were kept in a Controlled temperature (25 ± 1 °C) and humidity (50 ± 5%) environment with a 12 h light/dark cycle with ad lib access to food and water. Mice were divided into NC and KD groups. Two groups of mice were infected with shCtrl / shTTC39C lentivirus respectively. shTTC39C sequence: CCGGCGTCTATTGAAGTGTTGTACTCTCGAGAGTACAACACTTCAATAGACGTTTTT. After the A549 tumor cells were prepared (2e + 7 / ml), they were injected subcutaneously into the animals, and each mouse was injected with 200 μl. The tumor forming condition was observed according to the tumor forming ability of cells. The tumor size and animal weight were measured after 5-20 days. After 28 days of subcutaneous injection, the mice were euthanized by excessive injection of 2% Pentobarbital Sodium. Cervical spondylolisthesis was performed to confirm death. Isolate tumor and lung tissue for experiments. At least six independent experiments were performed in the study. All methods were carried out in accordance with relevant guidelines.

Real-time qPCR

Total cellular RNA was extracted by Trizol kit (Pufei, Shanghai). Nanodrop 2000 / 2000c spectrophotometer was used to analyze and determine the concentration and quality of extracted RNA (Termo Scientifc, USA). CDNA was obtained by reverse transcription using Promega m-mlv kit (Axygen, USA). Then, the reaction system was configured in proportion and Real-time PCR was performed. The sequences of primers used were synthesized by Guangzhou Ruibo Bio technology Co., Ltd (http://www.ribobio.com/), which were list in Table 1. All methods were carried out in accordance with relevant guidelines.

Table 1. Primer sequences used in Real-time PCR

Genes	Forward primer (5′–3′)	Reverse primer (5′–3′)
GAPDH	TGACTTCAACAGCGACACCCA	CACCCTGTTGCTGTAGCCAAA
TTC39C	ATGCCATGATGACATTTGAGGAA	GGGGCGGATTTTCGGACAT

Western blotting

Lung adenocarcinoma tissue were lysed with RIPA lysis bufer (Biyuntian, China), the protein concentration was measured by BCA protein assay kit (Boster, China), the extracted protein samples were separated by 10% or 12% SDS–polyacrylamide gel and then transferred to polyvinyl difuoride membranes (Millipore, USA). After blocking, the membranes were incubated overnight at 4 °C with primary antibody β-actin (1:5000), TTC39C (1:3000) for 24 h and then incubated with secondary antibody (1:10000) for 1 h at room temperature. The membranes were visualized using an ECL-chemiluminescent kit (ECL-plus, CST) and exposed to Medical X-ray machine (Carestream, 038401501). The intensities of bands were quantifed by using the Image J software (NIH, Bethesda, MD, USA). All methods were carried out in accordance with relevant guidelines.

Fluorescence Activating Cell Sorter

The cells were collected, centrifuged and the precipitates washed. Resuspend the cell precipitation with buffer. Then, add 10 μL Annexin V-APC ( Invitrogen, 88-8007-74) staining, keep away from light at room temperature for 10-15 min. According to the amount of cells, add 400-800 μL 1 × Binding buffer, on-line detection. and finally run the machine for detection. All methods were carried out in accordance with relevant guidelines.

Cell clone formation assay

The infected cells were inoculated into a six well plate and placed in a incubator for further culture until 14 days or the number of cells in most single clones was greater than 50. The cell clones were photographed under the fluorescence microscope before the end of the experiment. Add 1000 μL clean and impurity free crystal violet ( Shanghai, China ) dye to each well after fixing the cells. Cells were stained for 10-20 min. the cells were washed by ddH₂O several times, dried , took photos with a digital camera, and counted. All methods were carried out in accordance with relevant guidelines.

Transwell

Take out the transfer kit ( Corning, USA ), place the required number of chambers in a new 24 well plate, add 100 µL serum-free medium to the upper chamber, and place it in incubator for 1 h. Carefully remove the medium in the upper chamber and add 100 µL cell suspension, and add 600 µL 30% FBS medium in the lower chamber. The cell plates were incubated in a 37 ℃ incubator for a period of time. Take out the chamber and fix it. Drop 1-2 drops of staining solution to the lower surface of the membrane, stain and transfer the cells for 1-3 minutes. Then, soak and rinse the chamber for several times, and air dry. Finally, take microscope photos. All methods were carried out in accordance with relevant guidelines.

Celigo scratch test

Inoculate the cells on the 96 well plate, align the scratch instrument with the central part of the upper end of the 96 well plate, and gently push upward to form a scratch. Rinse gently with PBS for 2-3 times, add the medium containing 1% FBS serum, and sweep the plate for 0 h. Choose the appropriate time to sweep the plate with celigo according to the degree of healing, and collect three time points in total. Finally, the migration area was analyzed by celigo. All methods were carried out in accordance with relevant guidelines.

Transcriptome analysis

We selected 6 NC animal samples and 6 KD animal samples for transcriptome analysis. The integrity of RNA was detected by Agilent 2100 Bioanalyzer after RNA extraction. A total amount of 1 μg RNA per sample was used as input material for the RNA sample preparations. Briefly, mRNA was purified from total RNA using poly-T oligo-attached magnetic beads. Fragmentation was carried out using divalent cations under elevated temperature in First Strand Synthesis Reaction Buffer (5 X). Firststrand cDNA wassynthesized using random hexamer primer and M-MuLV Reverse Transcriptase (RNase H). Second strand cDNA synthesis was subsequently performed using DNA Polymerase I and RNase H. Remaining overhangs were converted into blunt ends via exonuclease/polymerase activities. After adenylation of 3’ ends of DNA fragments, Adaptor with hairpin loop structure were ligated to prepare for hybridization. In order to select cDNA fragments of preferentially 370~420 bp in length, the library fragments were purified with AMPure XP system (Beckman Coulter, Beverly, USA). Then PCR was performed with Phusion High-Fidelity DNA polymerase, Universal PCR primers and Index (X) Primer. At last, PCR products were purified (AMPure XP system) and library quality was assessed on the Agilent Bioanalyzer 2100 system. The clustering of the index-coded samples was performed on a cBot Cluster Generation System using TruSeq PE Cluster Kit v3-cBot-HS (Illumia) according to the manufacturer’s instructions. After cluster generation, the library preparations were sequenced on an Illumina Novaseq platform and 150 bp paired-end reads were generated. All methods were carried out in accordance with relevant guidelines.

Metabonomic analysis

Take an appropriate amount of sample and add precooled methanol / acetonitrile / aqueous solution (2:2:1, V / V) after the sample is slowly thawed at 4 ℃. The samples were subjected to low-temperature ultrasound for 30min after vortex mixing. Then, the samples were allowed to stand at - 20 ℃ for 10 min, centrifuged (14000 g) at 4 ℃ for 20 min. The supernatant was taken and dried in vacuum, 100 μL acetonitrile aqueous solution (acetonitrile: water = 1:1, V / V) was added during mass spectrometry analysis. Centrifuge for 15 min after sample was vortex. Finally, the supernatant was analyzed by chromatography-mass spectrometry. The samples were separated by 1290 infinity LC ultra high performance liquid chromatography system (UHPLC) (Agilent, USA.) HILIC column. AB triple TOF 6600 mass spectrometer (AB SCIEX, USA.) was used to collect the primary and secondary spectra of samples. Finally, data analysis and quality evaluation were carried out. All methods were carried out in accordance with relevant guidelines.

Statistical analysis

All experimental data are presented as the means±standard deviation of at least 3 repeat independent experiments. Statistical analysis was performed using SPSS version 22.0. One-way analysis of variance (ANOVA) was used to evaluate diferences between each groups. The diferences between two groups were determined by unpaired two-tailed t-test. Significant enrichment analysis was statistically analyzed by Fisher's Exact Test. Fuzzy c-means(FCM) algorithm was used to analyze metabolites. OPLS-DA model is used to screen differential metabolites. P < 0.05 was considered to indicate a statistically significant difference.

TTC39C was increased in lung adenocarcinoma

59 normal tissues, 277 stage 1 LUAD, 125 stage 2 LUAD, 85 stage 3 LUAD and 28 stage 4 LUAD were downloaded from TCGA database. As shown in Fig. 1A, The expression of TTC39C in LUAD tissues was significantly higher than that in normal tissues. As shown in Fig. 1B, The expression of TTC39C in LUAD sample types was significantly higher than that in normal samples. Further, we compared the survival rates of luad patients with higher TTC39C expression to those with low or moderate TTC39C expression. 125 patients with low or moderate TTC39C expression and 377 high expression of LUAD were analyzed from TCGA database. The results show that LUAD patients with high expression of TTC39C had lower survival rate and the 10-year survival probability of patients with high expression of luad is almost zero ( Fig. 1C ). These results suggest that TTC39C may play an important role in the development or treatment of LUAD disease.

Down regulation of TTC39C inhibits the proliferation and metastasis in A549 and NCI-H1299 cells.

To study the effect of TTC39C on the proliferation and migration of lung cancer cells, We selected human lung cancer cell line A549 and NCI-H1299 cells for experiment. ShRNA lentivirus infection was used to to knock down TTC39C gene. After 3 days of shRNA lentivirus infection, the mRNA level of TTC39C gene was reduced in A549 and NCI-H1299 cells in the experimental group ( Fig. 1D ). Then, The effect of TTC39C gene subtraction on cell metastasis was detected by Transwell method without ECM. As shown in Fig. 2A and Fig. 2B, the metastatic ability of A549 and NCI-H1299 cells in the experimental group was significantly inhibited compared with the control group. In addition, MTT was used to detect the proliferation of the two cells for 5 days. The results showed that the proliferation of A549 and NCI-H1299 cells was significantly inhibited after TTC39C knockdown ( Fig. 2C), the test results of celigo imaging technology are consistent with this ( Fig. 2D and Fig. 2E ). It suggested that TTC39C gene is significantly related to the proliferation and metastasis of A549 and NCI-H1299 cells.

Effects of TTC39C knockdown on cell clonogenic ability and apoptosis in A549 and NCI-H1299 cells.

The apoptosis and cloning ability of cancer cells are closely related to the prognosis and prognosis of cancer. Therefore, we explored the relationship between TTC39C and cell apoptosis and cloning ability. Apoptosis was detected by annexin v-apc single staining. The results showed that the number of apoptotic A549 and NCI-H1299 cells in the experimental group increased significantly after 5 days of shRNA lentivirus infection ( Fig. 3A and Fig. 3B ). Clone formation experiment showed that the number of A549 and NCI-H1299 cell colonies decreased after TTC39C knockdown ( Fig. 3C and Fig. 3D ). It presentational that TTC39C gene is significantly related to the apoptosis and cell clonogenic ability of A549 and NCI-H1299 cells.

Transcriptome and proteomic analysis of lung adenoma samples from TTC39C knockout and normal nude mice

To sum up, TTC39C has an important effect on the proliferation and migration of LUAD. Then we continue to study how TTC is involved in the progression of luad disease at the gene and protein levels. Ten female BALB / c nude mice and ten TTC39C knock down transgenic BALB / c nude were selected. And A549 human lung cancer cell line was injected into two group mice via the right skin axillary. The tumor formation in mice was observed after 39 days. As shown in Fig. 4A and Fig. 4B, the tumor of NC group was significantly larger than that of KD group, and the tumor body increased with the increase of test cycle. The average weight of tumor in NC group was significantly higher than that in KD group (Fig. 4C ). RNA-seq technology was used for database construction, sequencing and biological information analysis. The heatmap analysis of gene expression profile revealed that gene expression profile presented with relatively good consistency and tendency in both NC group and KD group, respectively (Fig. 5A). PCA plots disclosed a clear segregation between NC group and KD group, indicating that gene expression profile could differNC group from KD group (Fig. 5B). Consistent with this, the protein samples between two group also have good repeatability (Fig. 5C and Fig. 5D).

Analysis of biological information related to proteome and transcriptome

The results of GO enrichment analysis showed that the two groups of differential genes and proteins were mainly enriched in cellular compenent, molecular function and biological process. Fig. 6 A and Fig. 6 B show the top 10 different genes and proteins between the two groups. Similarly, KEGG enrichment analysis were carried out for the top 10 differentially pathway with the most significant enrichment degree among genes and proteins participate in LUAD (Fig. 6 C and Fig. 6 D). Then, the differentially expressed genes and proteins were integrated and analyzed. There were 206 overlapping distributions between 2814 differential genes and 470 differentially expressed proteins (Fig. 6 E). Fig. 7A and Fig. 7B showed the significance level of the top 10 biological process entries in the four types of association analysis results of proteome and transcriptome by GO and KEGG enrichment, respectively. The results showed that the gene enrichment pathways with the same expression trend of proteome and transcriptome were mainly enriched in neutral amino acid transport, response to virus, integrin-mediated signaling pathway, amino acid transport, p53 signaling pathway and so on. It indicated that TTC39C may be involved in the progression of lung adenocarcinoma through these pathways.

High resolution non target metabonomics analysis of TTC39C and its metabolites in LUAD

The metabolomics method based on UHPLC-Q-TOF MS technology was used to analyze the changes of metabolic profile. The positive and negative Hotelling's T2 test results of the overall samples show that the QC samples are within the 99% confidence interval. It indicating that the repeatability of the experiment is good (Fig. 8 A and Fig. 8 B). All metabolites identified (metabolites identified by combining positive and negative ions) were classified and counted according to their chemical taxonomy. And the proportion of various metabolites is shown in Fig.9 A. The results showed that metabolites mainly accumulated in organic acids and derivatives, lipids and lipid-like molecules and so on. The significant difference metabolites between the two groups were analyzed by multidimensional statistics. Positive and negative volcanic map showed the up-regulated top 10 and down-regulated top 10 were selected for labeling ( Fig. 9 B and Fig. 9 C ). Variable Importance for the Projection (VIP) obtained by OPLS-DA model can be used to measure the influence intensity and interpretation ability of the expression mode of each metabolite on the classification and discrimination of each group of samples to mining biologically significant differential lipid molecules. The histogram visually shows the identified significant difference and the change of metabolic difference multiple ( Fig. 10 A and Fig. 10 B ). among them, PG 44; 12. The difference between Glu Gln and 2,2-bis (hydroxymethyl) - 2,2,2-nitrotriethanol was the most significant. Further enrichment analysis of top 20 differential metabolic pathways was carried out through KEGG pathway mapper function ( Fig. 11 A). The metabolic changes of significantly enriched metabolic pathways were analyzed by differential abundance score ( Fig. 11 B). It is obvious that the differential metabolites are mainly concentrated in carbohydrate metabolism, energy metabolism,central carbon metabolism in cancer and so on.

At present, the discovery of oncogenic driver gene mutation and its application in predicting the response to targeted therapy have become the main way for clinicians to diagnose and treat lung adenocarcinoma [22]. The main targets of the targeted therapeutic drugs that have been listed are EGF, ALK, ROS1, BRAF, RAS and etc., which have achieved great benefits for the individualized treatment of patients, but the drug resistance rate is also gradually increasing [23, 24]. In addition, immunotherapy has become a new hot spot in cancer treatment in recent years, including LUAD [25-27]. The most studied checkpoint receptors in tumor immunotherapy targets are cytotoxic T lymphocyte antigen-4 (CTLA-4) and programmed death-1 (PD-1) receptor down regulates the activation, proliferation and function of T cells through different mechanisms [28, 29]. But, the effective rate of single drug immunotherapy is low, and combined immunotherapy is generally used. Therefore, it is urgent to find a new target to reduce the drug resistance rate of lung adenocarcinoma and improve the therapeutic effect.

The protein encoded by TTC39C gene contains several putative tetrapeptide repeat (TPR) domains, which is a structural motif that has been shown to contribute to protein interactions [18]. TTC39C plays an important role in muscle cell signal transduction and differentiation. It participates in skeletal muscle atrophy by regulating ERK1 / 2 MAP kinase and hedgehog signal transduction [30]. Furthermore, zebrafish embryos with TTC39C knocked down showed a variety of fiber disease phenotypes, including abnormal body bending and abnormal organogenesis [31]. These studies suggest that TTC39C may be closely related to cell heterogeneity. To explore the potential role of TTC39C in LUAD progression, we analyzed the RNA-seq data (FPKM values) from The Cancer Genome Atlas (TCGA) database. The results showed that TTC39C expression was significantly increased in LUAD tissues compared with normal tissues. And it showed that patients with high expression had a worse overall survival (OS) than those with low TTC39C expression. In addition, we studied the function of TTC39C in lung cancer cells A549 and NCI-H1299. It was found that the proliferation, metastasis and cell cloning ability of A549 and NCI-H1299 cells decreased after TTC39C gene deletion, but the apoptosis of cells increased. These results suggest that TTC39C may play an important role in the pathological progression of LUAD.

Transcriptome sequencing is to study all mRNA transcribed by specific tissues or cells at a certain period based on Illumina sequencing platform. It is the basis of gene function and structure research and plays an important role in understanding the development of organisms and the occurrence of diseases [32]. In the joint analysis of proteome and transcriptome, correlation analysis and go / KEGG enrichment analysis are used to assist in the research of molecular mechanisms such as tumor occurrence, development and metastasis, target screening and drug design [33]. Metabolome technology is used to analyze the difference of metabolic level between the experimental group and the control group, and find out the different metabolites, which is helpful to screen biomarkers or study the biological processes involved in different metabolites [34, 35]. In order to study the possible mechanism of TTC39C in LUAD, transcriptomics, proteomics and metabolomics multidimensional analysis are applied. The mRNA and protein expression levels and metabolites in tumor samples of TTC39C knockout mice were measured in an all-round way to obtain a panoramic view of the expression profile, which can be used to analyze the genes, proteins and pathways regulated by TTC39C. The gene enrichment pathways with the same expression trend of proteome and transcriptome were were mainly enriched in neutral amino acid transport, response to virus, integrin-mediated signaling pathway, amino acid transport, p53 signaling pathway and etc. Studies have shown that the increase of integrin is involved in the progression of LUAD [36, 37]. Due to the increased energy demand of cancer cells, the transport of amino acids in tumor cells is very active. Studies have shown that amino acid transporters can be used as therapeutic targets for breast cancer [38, 39]. The involvement of p53 cell pathway in tumor progression has been widely studied [40, 41]. These results suggest that TTC39C may be involved in the progression of lung adenocarcinoma through these pathways. It is concluded that the metabolic pathways most likely to be involved by TTC39C included carbohydrate metabolism, energy metabolism, central carbon metabolism in cancer and so on through KEGG enrichment and the differential abundance of all different metabolic pathways, this has a common set with the enrichment of transcriptome and proteomic pathways. This experiment mainly studied the effects of TTC39C on the proliferation, apoptosis, cloning and metastasis of LUAD. Combined with bioinformatics analysis, the possible pathways involved in TTC39C were studied. There is a certain defect in this experiment is that it is no accurate research on the pathways involved. Next, we will study the specific mechanism according to the results of bioinformatics.

In conclusion, our findings provide experimental evidence that TTC39C plays an important role in proliferation and migration of lung cancer cells. The main pathways involved in TTC39C in lung adenocarcinoma mainly include energy metabolism and p53 pathway.

TTC39C: The tetratricopeptide repeat domain 39C; LUAD: Lung adenocarcinoma; PD-1: programmed death receptor-1; TPR: tetrapeptide repeat; AAbs: antibodies against tumor antigens; TTC14: Tetratricopeptide repeat domain 14; VIP: Variable Importance for the Projection; CTLA-4: cytotoxic T lymphocyte antigen-4; TCGA: The Cancer Genome Atlas; OS: overall survival.

Ethics approval and consent to participate

All procedures involving animals included studies have been approved by ethics committees of Sichuan Cancer Hospital & Institute (approval number: 2015011306) and complied with applied principles of experimental animals.

Consent for publication

Not applicable.

Availability of data and materials

The data used to support the findings are included in the main article. And the data are available from the corresponding author upon request.

Competing interests

All authors of the manuscript have read and agreed to its content and are accountable for all aspects of the accuracy and integrity of the manuscript. The article is original, has not already been published in a journal, and is not currently under consideration by another.

Funding

Not applicable.

Authors' contributions

Hao Rong was responsible for the experimental design and writing of the manuscript, Jun Peng, Ke Ma and Jiang Zhu participated in the experimental process. Jin-Tao He was responsible for the conception and revision of manuscript framework. All authors have read and approved the final manuscript.

Acknowledgements

Thanks to the scientific research environment provided by Sichuan Experimental Center and the solidarity and cooperation of the members of the thoracic surgery research group.

Hirsch FR, Scagliotti GV, Mulshine JL, et al. Lung cancer: current therapies and new targeted treatments. Lancet. 2017, 389 (10066):299-311.
Siegel RL, Miller KD, Jemal A. Cancer statistics. CA Cancer J Clin. 2016, 66 (1):7-30.
Noguchi M, Morikawa A, Kawasaki M, et al. Small adenocarcinoma of the lung. Histologic characteristics and prognosis. Cancer. 1995, 75 (12):2844-2852.
Zappa C, Mousa SA. Non-small cell lung cancer: current treatment and future advances. Transl Lung Cancer Res. 2016, 5 (3):288-300.
Okudela K, Matsumura M, Arai H, Woo T. The nonsmokers' and smokers' pathways in lung adenocarcinoma: Histological progression and molecular bases. Cancer Sci. 2021, 112 (9):3411-3418.
Chen J, Yang H, Teo ASM, et al. Genomic landscape of lung adenocarcinoma in East Asians. Nat Genet. 2020, 52 (2):177-186.
Chen YJ, Roumeliotis TI, Chang YH, et al. Proteogenomics of Non-smoking Lung Cancer in East Asia Delineates Molecular Signatures of Pathogenesis and Progression. Cell. 2020, 182 (1):226-244.e17.
SUN S, SCHILLER JH, GAZDAR AF. Lung cancer in never smokers-different disease. Nat Rev Cancer. 2007, 7: 778-790.
Zhang S, Xu Y, Zhao P, et al. Integrated Analysis of Genomic and Immunological Features in Lung Adenocarcinoma With Micropapillary Component. Front Oncol. 2021, 11:652193.
Chen Z, Zhao M, Li M, et al. Identification of differentially expressed genes in lung adenocarcinoma cells using single-cell RNA sequencing not detected using traditional RNA sequencing and microarray. Lab Invest. 2020, 100 (10):1318-1329.
Feng W, Guo X, Huang H, et al. Polymorphism rs3819102 in thymidylate synthase and environmental factors: effects on lung cancer in Chinese population. Curr Probl Cancer. 2019, 43 (1):66-74.
Hellmann, M.D., Rizvi,, et al.. Novolumab plus ipilimumab as first-line treatment for advanced nonsmall-cell lung cancer (CheckMate 012): results of an open-label, phase 1, multicohort study. Lancet Oncol. 2017, 18, 31–41.
Silva AP, Coelho PV, Anazetti M, Simioni PU. Targeted therapies for the treatment of non-small-cell lung cancer: Monoclonal antibodies and biological inhibitors. Hum Vaccin Immunother. 2017, 13 (4):843-853.
Kitagawa S, Hakozaki T, Kitadai R, Hosomi Y. Switching administration of anti-PD-1 and anti-PD-L1 antibodies as immune checkpoint inhibitor rechallenge in individuals with advanced non-small cell lung cancer: Case series and literature review. Thorac Cancer. 2020, 11 (7):1927-1933.
D'Andrea, L. D., & Regan, L. . TPR proteins: The versatile helix. Trends in Biochemical Sciences, 2003, 28 (12), 655–662.
Zeytuni, N., & Zarivach, R.. Structural and functional discussion of the tetra‐trico‐peptide repeat, a protein interaction module. Structure. 2012, 20 (3), 397–405.
Park C, Lee Y, Je S, et al. Overexpression and Selective Anticancer Efficacy of ENO3 in STK11 Mutant Lung Cancers. Mol Cells. 2019, 42 (11):804-809.
Meng W, Chan BW, Ezeonwumelu C, et al. A genome-wide association study implicates that the TTC39C gene is associated with diabetic maculopathy with decreased visual acuity. Ophthalmic Genet. 2019, 40 (3):252-258.
Cao S, Ho GH, Lin VC. Tetratricopeptide repeat domain 9A is an interacting protein for tropomyosin Tm5NM-1. BMC Cancer. 2008, 8:231.
Choi YL, Lira ME, Hong M, et al. A novel fusion of TPR and ALK in lung adenocarcinoma. J Thorac Oncol. 2014, 9 (4):563-566.
Wang J, Shivakumar S, Barker K, et al. Comparative Study of Autoantibody Responses between Lung Adenocarcinoma and Benign Pulmonary Nodules. J Thorac Oncol. 2016, 11 (3):334-345.
Mazieres J, Drilon A, Lusque A, et al. Immune checkpoint inhibitors for patients with advanced lung cancer and oncogenic driver alterations: results from the IMMUNOTARGET registry. Ann Oncol. 2019, 30 (8):1321-1328.
Vaishnavi A, Schubert L, Rix U, et al. EGFR Mediates Responses to Small-Molecule Drugs Targeting Oncogenic Fusion Kinases. Cancer Res. 2017, 77 (13):3551-3563.
Stutvoet TS, Kol A, de Vries EG, et al. MAPK pathway activity plays a key role in PD-L1 expression of lung adenocarcinoma cells. J Pathol. 2019, 249 (1):52-64.
Zhang C, Zhang G, Sun N, et al. Comprehensive molecular analyses of a TNF family-based signature with regard to prognosis, immune features, and biomarkers for immunotherapy in lung adenocarcinoma. EBioMedicine. 2020, 59:102959.
Zhang C, Zhang Z, Sun N, et al. Identification of a costimulatory molecule-based signature for predicting prognosis risk and immunotherapy response in patients with lung adenocarcinoma. Oncoimmunology. 2020, 9 (1):1824641.
Song Y, Yan S, Fan W, et al. Identification and Validation of the Immune Subtypes of Lung Adenocarcinoma: Implications for Immunotherapy. Front Cell Dev Biol. 2020, 8:550.
Lv Y, Huang Z, Lin Y, et al. MiRNA expression patterns are associated with tumor mutational burden in lung adenocarcinoma. Oncoimmunology. 2019, 8 (10):e1629260.
Zhang X, Wang Y, A G, Qu C, Chen J. Pan-Cancer Analysis of PARP1 Alterations as Biomarkers in the Prediction of Immunotherapeutic Effects and the Association of Its Expression Levels and Immunotherapy Signatures. Front Immunol. 2021, 12:721030.
Hayes CS, Labuzan SA, Menke JA, Haddock AN, Waddell DS. Ttc39c is upregulated during skeletal muscle atrophy and modulates ERK1/2 MAP kinase and hedgehog signaling. J Cell Physiol. 2019, 234 (12):23807-23824.
Xu Y, Cao J, Huang S, et al. Characterization of tetratricopeptide repeat-containing proteins critical for cilia formation and function. PLoS One. 2015, 10 (4):e0124378.
Zhang H, He L, Cai L. Transcriptome Sequencing: RNA-Seq. Methods Mol Biol. 2018, 1754:15-27.
Yin Y, Yu G, Chen Y, et al. Genome-wide transcriptome and proteome analysis on different developmental stages of Cordyceps militaris. PLoS One. 2012, 7 (12):e51853.
Johnson CH, Ivanisevic J, Siuzdak G. Metabolomics: beyond biomarkers and towards mechanisms. Nat Rev Mol Cell Biol. 2016, 17 (7):451-459.
Contrepois, K., Wu, S., Moneghetti, K.J., Hornburg, D., Ahadi, S., Tsai, M.S., et al.. Molecular Choreography of Acute Exercise. Cell. 2020, 1112-1130 e1116.
Wang M, Zhang G, Zhang Y, et al. Fibrinogen Alpha Chain Knockout Promotes Tumor Growth and Metastasis through Integrin-AKT Signaling Pathway in Lung Cancer. Mol Cancer Res. 2020, 18 (7):943-954.
Liu W, Luo W, Zhou P, Cheng Y, Qian L. Bioinformatics Analysis and Functional Verification of ADAMTS9-AS1/AS2 in Lung Adenocarcinoma. Front Oncol. 2021, 11:681777.
Cha YJ, Kim ES, Koo JS. Amino Acid Transporters and Glutamine Metabolism in Breast Cancer. Int J Mol Sci. 2018, 19 (3):907.
Saito Y, Soga T. Amino acid transporters as emerging therapeutic targets in cancer. Cancer Sci. 2021, 112 (8):2958-2965.
Cortez MA, Ivan C, Valdecanas D, et al. PDL1 Regulation by p53 via miR-34. J Natl Cancer Inst. 2015, 108 (1):djv303.
Gu MM, Gao D, Yao PA, et al. p53-inducible gene 3 promotes cell migration and invasion by activating the FAK/Src pathway in lung adenocarcinoma. Cancer Sci. 2018, 109 (12):3783-3793.

No competing interests reported.

Download PDF

Editorial decision: Major revision
02 Aug, 2022
Reviews received at journal
31 Jul, 2022
Reviewers agreed at journal
18 Jul, 2022
Reviewers invited by journal
16 Jul, 2022
Editor assigned by journal
16 Jul, 2022
Editor invited by journal
13 Jul, 2022
Submission checks completed at journal
13 Jul, 2022
First submitted to journal
08 Jul, 2022

You are reading this latest preprint version

TTC39C may be a new target for the treatment of lung adenocarcinoma

Status:

Version 1

Abstract

Figures

Introduction

Methods

Results

Discussion

Conclusion

Abbreviations

Declarations

References

Additional Declarations

Status:

Version 1