Actinomycetes of Howz Soltan Lake and their metabolite diversity in Iran

doi:10.21203/rs.3.rs-1849248/v1

Download PDF

Research Article

Actinomycetes of Howz Soltan Lake and their metabolite diversity in Iran

https://doi.org/10.21203/rs.3.rs-1849248/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Saline environments are largely unexplored sources for actinomycetes with the potential to produce biologically active secondary metabolites. A total of 34 actinomycete strains from water, sediments and mostly rhizosphere (82%) were collected from different sites of Howz Soltan Lake in Iran. Based on phylogenetic analysis, the isolated strains belonged to the genera Streptomyces, Nocardia and Saccharomonospora. Among the isolated actinomycetes, several strains had valuable biotechnological applications such as growth inhibition of human tumor cells. The results of cytotoxic assay revealed strain act9 having the most potent extract (19.716 ± 5.72 µg/ml) against the MDA-MB-231 human breast cancer cell. Also 38% of the strains had an antimicrobial activity against some pathogenic and nonpathogenic microorganisms. The ethyl-acetate extract of act18 showed the most antibacterial effect against Staphylococcus aureus, MRSA, and was further analyzed by GC/MS. Ar-tumerone (26.41%) and Butyl isodecyl phthalate (21.77%) were the main constituents detected in the extract.. This is the first time this compound is being detected in a prokaryote. Act18 showed the most 16s rRNA sequence similarity to Streptomyces youssoufiensis. In addition, a number of the isolates produced different enzymes including lipase, amylase, protease, gelatinase, urease and lecetinase. Also, the plant growth promoting activity of some actinomycete strains were shown. Some of the strains belonging to the genera Streptomyces and Nocardia increased the seed germination, stem length and the number of Echium leaves during the 20 days. Consequently, it was concluded that actinomycetes isolated from these saline lake habitats are potentially valuable for biotechnological applications.

Saline environment

Tumor inhibition

Enzyme production

Plant growth promotion

Hypersaline lakes and soils are extreme environments and widespread in all parts of the world (Oren 2002). The survival of halophilic microorganisms depends on different salts in these extreme ecosystems which often maintain remarkably high microbial cell densities and are significant sources for novel secondary metabolites (Ma et al. 2010). The halophilic microorganisms have the ability to produce extracellular hydrolytic enzymes and novel bioactive molecules with several applications in biomedical technology and chemical industries (Yin et al. 2015), but they are a less explored source of actinomycetes. Most industrial processes are carried out under high temperature, salt and pH values, and halophiles are a suitable source of adapted enzymes to such conditions. Screening of halophilic actinomycetes is fundamental to research on novel enzymes and bioactive metabolites needed for industrial applications.

Various saline environments exist in Iran in which the bacterial diversity has not been described. Howz Soltan Lake is a small (24 km²) seasonal salt lake located in the border of Dasht-e Kavir in North-eastern Qom province, Iran. The lake only reaches a depth between 0.45- 1 m. The depth of salt layer is 20–46 m and the pH of the water and sediments varies between 6.5–8.2. So far some studies have been carried out on the diversity of halophilic bacteria in Howz Soltan Salt Lake (Rohban et al, 2009), however, no research has focused on its actinomycete biodiversity. In this report we describe actinomycetes isolated from the Howz Soltan Lake. As several factors influence the actinomycetes screening, including pretreatments and composition of selective media, a unique pretreatment and isolation media was applied here for a better understanding of the actinomycetes diversity. In addition, features including enzyme production as well as plant growth promoting, anticancer and antimicrobial activities were also investigated.

Sample collection from the Howz Soltan Lake

Howz Soltan Lake is an intact ecosystem located at an elevation of 790 m above sea level on 34° 30′ N wide and 51° 52′ E long (Fig. 1). Twelve different samples were collected from brine, multicolor solar salt, sediments and rhizospheric soils in different locations and preserved at 4°C in the laboratory. The pH range for samples was 6.8-8.1.

Sample pretreatments and the bacterial growth conditions

In order to isolate as many cultivable actinomycetes from the soil and sediment, samples collected from the ecosystem were subjected to different selective pre-treatments and media cultures. The pre-treatments included: T1. dry heat (120 °C, 60 min), T2. phenol (1.5 %, 30 min at 30 °C), T3. 0.05 % SDS and 6 % yeast extract for 30 min and T4. wet heat(50°C, 15 min) (Jayashree et al. 1991). The pretreated samples were diluted (1:10 v/v) with a 5% saline solution and mixed for one hour. Serial dilutions were prepared down to 10^-4. Water samples and the dilutions of the soils were plated out onto different selective isolation media. The media and ingredients were as below (g/L): IM1 (oatmeal agar, ISP meduim3): oatmeal, 60; agar, 15; IM2 (Gause modified medium 1): soluble starch, 20; K₂HPO₄, 0.5; KNO₃, 1; MgSO₄·7H₂O, 0.5; agar, 15; IM3 (Yeast extract-malt extract agar; ISP medium 2): yeast extract, 4; malt extract, 10; glucose, 4; agar, 15; IM4 (Starch casein agar); starch, 10; casein, 3; agar, 15; IM5 (ZSSE agar): soluble starch, 5; KNO₃, 1; agar 10. IM6 (soil extracts agar): Twice sterilized precipitated soli suspension 400, yeast extract 10, agar 15; IM7 (Glycerol casein agar); Glycerol, 10; casein, 3; KNO₃2; CaCO₃ 0.02; MgSO₄.7H₂O, 0.05; K₂HPO₄, 1; agar, 15 g (Hong et al. 2009). The pH of the culture media was adjusted to 8.0. Each medium was supplemented with 100 mg/L K₂Cr₂O₇, 30 mg/L nystatin and 10 mg/L nalidixic acid. The media contained different concentrations of sodium chloride (0, 5 and 10% w/v). Cultures were incubated at 28 °C for a period of 1-8 weeks. Actinomycete-like colonies growing on the isolation plates were inoculated onto IM3 and IM7 plates and incubated for 7 d at 28 °C. Purified cultures were stored in 30% glycerol at -20 °C (Hong et al. 2009).

In order to distinguish halophiles from halotolerant strains, a modified Sea Water (SW) agar medium containing 0.5 % yeast extract and 15 g/L agar was prepared. Growth at different NaCl concentrations (0, 2.5, 5 %, w/v) was monitored on SW agar at pH 8.0 for a period of 72 hours. Isolates growing optimally at 3.5-15 % NaCl concentrations are considered as moderate halophiles, while halotolerant strains are capable of growing in both high and zero salinity (Kushner and Kamekura 1988).

Screening for antimicrobial activity by modified spektra-plak method

Since microbial communities have antagonistic relationships with each other, the production of antimicrobial agents by isolated actinomycetes was examined against several different tested microorganisms. Seven indicator microorganisms were used to test their susceptibility: Methicillin resistant Staphylococcus aureus (MRSA)ATCC 33591, Klebsiella pneumoniae ATCC 10031, Escherichia coli ATCC 29998, Micrococcus loteus ATCC 9341, Bacillus subtilis ATCC 6633, Aspergillus niger ATCC 16404 and Candida albicans ATCC 10231. They were obtained from the Persian Type Culture Collection (PTCC). Cultures of the indicator bacteria were grown in Nutreint Broth (N.B.) for 24 h at 37°C. Aspergillus niger was grown on Sabouraud Dextrose Agar (SDA) slants at 28°C for 10 days and the spores were collected. Yeast was grown on Sabouraud Dextrose Broth (SDB) at 28°C for 48 h (Duraipandiyan et al, 2010). For Antibacterial and anti-candidal assay, Mueller Hinton Agar (MHA) plates were inoculated with actinomycete cultures as a small circle at the center of the plate and incubated at 28 °Cfor 4 d. The media were inoculated with one ml of N. B. containing bacterial or yeast test strains and 0.3 % (w/v) agar. The inoculation size for the bacterial strains and yeast were 10⁴ and 10⁶ CFU/ml, respectively. For antifungal assay, Starch-casein agar plates were inoculated by actinomycete isolates around the plate and A. niger at the center at the same time. Antagonism was detected by formation of inhibition zone and measured by determining the size of the inhibition zone (Salehghamari and Najafi 2016). All experiments were performed in triplicate.

Secondary Screening of Antibacterial Activity

Among the isolated streptomyces, some isolates with the largest inhibition zone against MRSA were incubated in ISP-2 at 28°C, 220 rpm for 5 d. The filtrate-fermented broth was extracted with ethyl acetate (1:2 v/v) for two hours. The ethyl acetate layer was evaporated and concentrated with an evaporator. The crude extract was tested for antimicrobial activity using the agar-well diffusion method against MRSA, M. loteus as gram positive bacteria, K. pneumoniae and E. coli as gram negative bacteria and C. albicans as a yeast on Muller-Hinton agar and incubated overnight at 37°C. The inhibition zone of the test microorganisms around the wells was then measured (Augustine et al., 2005, Khan and Patel, 2011).

Identification of antibacterial compounds using Gas Chromatography-Mass Spectrometry

The ethyl acetate extract of the selected strains was subjected to gas chromatograph (Agilent 7890A) equipped with a HP-5MS column (diameter 0.25 mm, length 30.0 m, film thickness 0.25μm) mass spectrometer (Agilent 5975, EI 70 eV). The initial temperature was set at 50°C and increased to 230°C at a rate of 10°C/min then to 270 °C at a rate of 30 °C/min and kept for 10.667 min. The total run time was 30 min. The injector temperature was set at 250°C and a flow rate of 1 ml/min.

Binary actinomycete interaction assays

To test the effect of actinomycete strains dual culture on each other’s antibiotic synthesis, glycerol casein agar plates were used. One μl of spore stock of a strain was cultured 0.5 cm away from other strains and so as each of the strains alone as a control (Seyedsayamdost et al, 2012; Salehghamari et al 2017). This experiment was performed in triplicates. Plates were incubated at 28 °C for 5 d until the developmental progress was visible in the control colonies. The effects of dual culture of isolated actinomycetes on antibacterial metabolite production were tested against K. pneumoniae. An overnight culture of test strain was added to LB containing 0.3% (w/v) agar (~45 °C) to prepare 10⁶ CFU/ml, which were poured over the interaction assay and control plates. The plates were incubated overnight at 37 °C and checked for altered zones of inhibition.

Screening of the isolates for extracellular hydrolytic activities

In order to show the diverse enzyme profile of the actinomycete population, the ability of the actinomycete isolates to produce extracellular hydrolases, including amylase, protease, lipase, lecithinase, gelatinase and urease was investigated. The pH of all media was adjusted to 8.0 and NaCl was added to a final concentration of 0-5%. Hydrolytic activity of the strains is described below.

Amylolytic activity of the cultures was screened using starch agar medium and 0.3% I2–0.6% KI solution; Clear zones around the growth were taken as evidence of starch hydrolysis. The presence of proteolytic activity on plate was determined using skim milk agar containing 10% w/v skim milk and 2% w/v agar. A clear zone around the growth indicated proteolytic activity. The presence of lipase production on plates was determined using nutrient agar containing 1% v/v tween 20 and appropriate salt concentration. The zone of precipitation around the growth showed lipase activity. To determine the ability of microorganisms to produce lecithinase, Egg Yolk Agar was used and a white opaque zone of precipitation surrounding the colony indicates positive lecithinase activity. The presence of gelatinases was detected using a nutrient gelatin medium. When a gelatinase is produced, the enzyme liquefies gelatin (Tille and Forbes 2014). To determine urease activity, urea broth containing yeast extract, urea and phenol red as a pH indicator was used. When urease is produced, the phenol red changes from a yellow color to a red or cerise color (alkalin pH) (Benson 2002).

Plant growth promoting metabolites of actinomycete strains

Another aspect of the relationship in an ecosystem is between plants and microorganisms. In this view, we examined the presence of plant growth-promoting actinomycetes on Echium growth. Seeds of Echiumsp. were washed with 2.5% NaClO + Tween 80 for 10 min and rinsed in sterile distilled water for 10 min continuously. Seeds were inoculated with actinomycete strains by dipping them in bacterial spore suspensions at a concentration of 1 x 10⁶CFU ml^-1. The pots were filled with 300 g perlite and cocopeat 1:3 and six inoculated Echium sp.. Seeds were placed in each pot at a 1 cm depth. The pots were incubated in a greenhouse for 8 weeks. Uninoculated plants served as controls (Balseiro-Romero et al. 2016).

Cytotoxicity screening and secondary metabolite extraction

The cytotoxic activity of the actinomycetes and cell line MDA-MB-231 as an invasive cell for eukaryotic organisms was investigated.The isolated strains were inoculated in ISP-2 at 28°C, 220 rpm for 5 d. The filtrate-fermented broth was extracted with ethyl acetate as mentioned above. Cell viability was assessed with MTT reduction assay. MDA-MB-231 cells were seeded in 96-well culture plates at 0.1 × 10⁵ cells/well in RPMI-1640 medium and allowed to attach for 24 h followed by treatment with various concentrations of ethyl acetate extracts of strains supernatant (10-100 μg/ml) for 24 and 48 h. Then the medium was removed and the cells were incubated with 0.5 mg/ml of 3-[4, 5-dimethylthiazol-2-yl]-2, 5-diphenyltetra-zolium bromide (MTT) (Sigma, USA). After incubation for 3-4 h at 37 °C and 5% CO2, the amount of formazan deposits after dissolving in DMSO was quantified at 570 nm (Lossdrecht et al. 1994).Normal MCF10 cells of breast were used as control. All of the experiments were conducted in triplicates. The statistical significance of the data was analyzed with one-way ANOVA (P < 0.05). The cytotoxic activity was expressed as mean IC50 ± standard error (SE). The IC50 values of the samples were calculated using the software GraphPad PRISM version 6 (GraphPad Software, San Diago, CA).

Molecular identification of selected strains

For molecular identification of the Actinomycete strains, they were grown in ISP-2 medium at 28°C and 200 rpm for 4 d. Biomass was harvested and used for DNA extraction as described by Kieser et al. (2000). The 16S rDNA was amplified using PCR with pfu DNA polymerase and primers 9F (5´ AAGAGTTTGATCATGGCTCAG 3´) and 1542R (5´ AGGAGGTGATCCAACCGCA 3´). The reaction solution (100 μl) contained 1 μl of genomic DNA, 0.5 μl of pfu DNA polymerase, 0.2 mM of dNTP, 5% DMSO and 0.5 mM of each primer in a final volume of 25 μl. The reaction was started with an initial denaturation at 96 ºC for 300 seconds followed by 30 cycles of denaturation at 98 ºC for 10 seconds, annealing at 54.5 ºC for 60 seconds and extension at 72 ⁰C for 90 seconds, with a final extension at 72 ⁰C for 300 seconds. After analyzing the PCR products by agarose gel electrophoresis, they were submitted for purification and sequencing to Macrogen Inc. (Seoul, Korea). The identification of phylogenetic relationship of the isolates and the calculation of pairwise 16S rDNA sequence similarities were determined using the Eztaxon server (http://www.ezbiocloud.net/eztaxon). Sequences were aligned using CLUSTAL X software (version 2.0, Conway Institute, USA), and a phylogenetic analysis was performed by the neighbor-joining method using MEGA software (version 6.0, Biodesign Institute, USA). Mycobacterium avium MG13Twas used as the out group. The bootstrap analysis was used to evaluate the tree topology by performing 1,000 replicates (Salehghamari et al. 2017).

Isolation of actinomycetesand their taxonomic diversity

The samples collected from Howz Soltan Lake were affected by several different treatments and cultured on various media. A total of 34 actinomycetes were purified from the collected environmental samples.

82% of the strains were isolated from rhizosphere, 15% from the lake sediments and the rest from the water. Most of them had low growth rate, aerobic respiration, gypsum or leather like colonies. All isolates were able to produce aerial mycelium with white, yellow, orange colors and a few strains were red, brown, gray, blue and green.

Four treatments and seven different culture media were used to isolate the most diverse population of the actinomycetes from the samples. Of the four treatments performed on the samples to isolate actinomycetes, most isolates were obtained from the wet heat treatment, while thedry heat and chemical treatments led to the isolation of unique strains in terms of colony morphology and pigment. Among the different media used for actinomycete isolation, the highest number of actinomycete strains were isolated from IM4 medium (28%) followed by IM1 and IM7 media (18% each) (Fig 2). Among all the isolated strains, 6 species grew optimally on the unsalted culture medium, 27 species grew on a culture medium with 5% (w/v) NaCl, and one species grew on a culture medium including 10% (w/v) NaCl.

Based on characteristics such as aerial mycelial color and spore morphology, it was found that most isolates (30 strains, 64%) belonged to the genus Streptomyces and the rest were non-Streptomyces. Among them, 11 strains were selected for 16S rRNA gene sequencing (Fig 3). The 16S rRNA gene sequences (>1000 nt) of the strains act1, act3, act4, act5, act16, act18, act 23, act26, act 30, act 33 and act34 were deposited in the Genebank database under the accession numbers OM491223, OM491327, OM491212, OM491328, OM491227, OM491329, OM540365, OM540366, OM491245, OM540368 and OM540367, respectively. Analysis of 16S rRNA gene sequence similarity among these strains showed that they shared 98–100% similarities to their nearest matching type strains. As a result of phylogenetic analysis, the isolated strains belonged to the genera Streptomyces, Nocardia and Saccharomonospora.

Antagonistic activity of the isolated actinomycetes

The antagonistic effects of the isolated actinomycetes against 7 tested microorganisms, including pathogenic and non-pathogenic bacteria and fungi, were investigated (Fig 4). In this study, it was shown that 38% of the strains had an antimicrobial activity against at least one of the tested microorganisms. According to the antagonistic chart, it was revealed that the highest percentage of antimicrobial activity among the isolates was against B. subtilis (23%). Production of antimicrobial metabolites against K. pneumoniae had the lowest frequency (5%).

In this regard, it was found that 35% of the isolates produced antimicrobial metabolites against four tested non-pathogenic microorganisms. Also, 21% of them showed antimicrobial activity against three tested pathogenic microorganisms. Twenty-four percent of actinomycetes also produced antifungal compounds against C. albicans and A. niger.

The antimicrobial test against the pathogenic strains also showed that the strain act18 had the largest growth inhibition zone against MRSA. In addition, this strain showed the highest antimicrobial effect against M. loteus. Thus, the bioactivity of its ethyl acetate extract was studied and clearly showed an antimicrobial effect against the two tested strains. GC-MS analysis revealed ar-tumerone (26.41 %) with an RT of 14.098 and a significance of 98.1%, and Butyl isodecyl phthalate (21.77 %) with an RT of 17.168 and a significance of 50.6%, respectively (Supplementary Figure1). The effect of actinomycete dual cultures on antibiotic biosynthesis

Interspecies interaction of actinomycetes will express new gene clusters and may therefore affect the pigmentation, sporulation and production of secondary metabolites (Salehghamari et al. 2017). In the present report, binary actinomycete interaction assay was conducted to evaluate its effect on antibiotic production against K. pneumonia, a multidrug resistant pathogen. Only 5% of the isolated actinomycete strains produced antimicrobial metabolites against it. A total of 35% of the strains induced the production of antimicrobials against k. pneumonia in four non-producing strains while 78% inhibited that of two productive strains, act 21 and act 32 (Fig 5). Interestingly, one strain belonging to the genus Nocardia, act 26, inhibited the production of antibiotics in one strain belonging to the genus Streptomyces, act 32.

Screening of the isolated actinomycete strains for extracellular enzyme production

All the isolated marine actinomycetes were screened qualitatively for the production of six important enzymes incluinglipase, protease, gelatinase, lecithinase, urease and amylase. In this study, among the 34 isolates, 53, 50, 44, 31, 9 and 6 % of the isolates produced amylase, lipase, protease, gelatinase, lecithinase and urease, respectively. Therefore, the most common secretory enzymes among the isolated actinomycetes were amylase, lipase and protease, respectively. It is interesting to note that the combined hydrolytic activity was also detected in many isolated actinomycete strains. About 28% of the strains were able to produce three enzymes while 9% produced four enzymes (Fig 6). The strains belonging to the genus Nokardia produced three of the tested enzymes. That is, strain act23 produced the enzymes lipase, amylase and gelatinase, and the strain act26 produced the enzymes lipase, amylase and protease.

Plant growth promoting metabolites of the isolated actinomycetes

Among the isolated strains evaluated for growth enhancement of Echium in pot experiments, seeds of Echium sp. germinated faster in the presence of three strains including act2, act5 and act13. Also Echium sp. had its best growth with the highest number of leaves and longer stems in the presence of the strain act26 during the 20 days.

Cytotoxic activity of the secondary metabolites extracted from the actinomycetes

The results of cytotoxic assay revealed strain act9 having the most potent antimicrobial extract (19.716±5.72 µg/ml) against the human tumor cell line MDA-MB-231 (Fig 7). As seen in Table 1, the secondary metabolites extracted from act1, ac9 and act25 isolates exhibited the highest IC50 values of 50.467±2.65, 19.716±5.72, and 43.598±9.71 μg/ml against human breast tumor cell line (MDA-MB-231), respectively, during 48 h and did not show a significant toxicity towards normal MCF10 cells.

Actinomycetes are widely distributed in natural ecosystem habitats such as rhizosphere soil, hypersaline soils and aquatic environments. Actinomycetes play a key role in ecosystems and are even found to be the most important members of their microbial community. This is because of their ability to produce a variety of secondary metabolites that are likely to coordinate the function of different microbial populations in ecosystems. These active compounds have special chemical structures which make them suitable for biotechnological applications including their use as antibiotics, biopesticide agents, plant growth hormones, antitumor compounds, pharmacological compounds, enzymes, and biosurfactants (Selim et al. 2021; Singh et al. 2020).

Several studies have been done to isolate actinomycetes from different environments (Parera-Valadez et al. 2019; Ramesh and Mathivanan 2009), however few studies have been performed on the separation of actinomycetes from saline lakes. Especially in Iran, no direct research has been done on the isolation and biodiversity of haloactinomycetes of saline environment. In this study, using different culture media and treatments, the biodiversity of actinomycetes in Howz Soltan Lake was investigated and valuable strains with high biotechnological applications were isolated.

Based on morphological and chemical criteria, actinomycetes have been grouped into different genera and Streptomyces is the most commonly isolated genera of the order Actinomycetales. Other actinomycetes genera isolated from hypersaline environments include Nocardia sp. and Micromonospora sp. (Selim et al. 2021; Singh et al. 2020). In the present study, the greatest number of strains isolated belonged to the genus Streptomyces with only 12% belonging to the two genera Nocardia and Micromonospora .

Secondary metabolites produced by actinomycetes display diverse biological effects. The order actinomycetales are responsible for the production of bioactive compounds with growth inhibitory or lethal effects on microorganisms. About 75% of antibiotics, mainly antibacterials are produced by actinomycetes. Among them about 34% are produced by Streptomyces and 11% from other actinomycetes (Selim et al. 2021). In this study, it was shown that the production of antimicrobial agents against gram-positive bacteria was higher than gram-negative bacteria. Thus, 25, 20 and 12% of the strains had antimicrobial activity against B. subtilis, M. Loteus and S.aureus, respectively, while only 16% and 6% of the strains showed antimicrobial effect against E. coli and K. pneumonia, respectively. Similar results have been shown in other studies (Chanthasena and Nantapong 2016). Therefore, it may be concluded that gram-positive bacteria are more sensitive to antibiotic compounds than are gram-negative bacteria, and this is probably due to the presence of an outer membrane in latter’s cell wall. Also in this study, in addition to showing interspecific relationships in antibiotic production, the relationship between the two genera Streptomyces and Nocardia in the inhibition of antimicrobial compound production was also evident.

GC-MS analysis of the strain act18 medium extract with the antimicrobial activity against MRSA revealed ar-tumerone and Butyl isodecyl phthalate as the main metabolites extracted. Based on our knowledge, this is the first report on the production of ar-turmeron in the prokaryotic kingdom. Ar-tumerone is a yellowish oil with toxic effect on aquatic life. It has a chemical formula of C5H20O and a molecular weight of 216. It has been found in Curcuma Longa (Turmeric) as a flowering plant with its rhizome used as spice. Ar-tumerone has anti venom activity against both Bothrops jararaca and Crotalus durissus terrificus venom (Pal et al. 2020 and Ferreira et al. 1992). This compound has also been found in Aglaia odorata Lour (Joycharat et al. 2014). The growth inhibition test performed by others has revealed that ar-tumerone has no or low inhibitory effect on E. coli growth (Lee 2006 and Marliyana et al, 2019), which may be due to its relatively lower concentration in their extract. Still other have determined that the essential oil of C. Longa and the extract of Jathyadi Thailam, both containing ar-tumerone and other compounds, possess antibacterial effect on MRSA (Mandrika et al, 2021 and Srisayam et al, 2018). Although there is no antibacterial test of the pure ar-tumeron on MRSA, still their results might be in accordance with ours.

The second compound included butyl isodecyl phthalate, a heterocyclic compound, with a linear formula of C22H34O4 and a molecular weight of 362.5 g/mol. Despite a lack of sufficient research on this compound, however, phthalate derivative compounds are categorized as toxic. Butyl isodecyl phthalate, as a plasticizer, has also been extracted from herbal tissues by some research groups (He et al, 2017; You et al, 2021) with one mentioning it as a contamination. In our work, however, the compound was detected in only one of the bacterial extracts (unpublished data), dismissing the possibility of it being a contamination. Based on our knowledge, this is the first report on butyl isodecyl phthalate production in bacteria. There is no specific data on the antibacterial effect of pure Butyl isodecyl phthalate, but some crude extract containing this compound has shown antibacterial activity in accordance with our results (You et al, 2021).

Actinomycetes have different active enzymes which are able to catalyze lots of biochemical reactions. Streptomyces species produced important enzymes such as amylase, protease, and lipase with commercial applications in different industries. In this study, the production of enzymes by isolated strains were examined and it was concluded that a large number of strains produced several enzymes. Among these, lipase and amylase followed by proteases were the three main enzymes produced in the collected strains. In a study conducted by Rohban et al. (2009) on non-actinomycotic halophilic strains of Howz Soltan lake, lipase and amylase were the first two enzymes produced in the greatest amounts followed by proteases. Interestingly, the first three enzymes produced in the greatest amounts in the strains collected from the lake were the same in both actinomycetes and non-actinomycetes, which is probably due to the available carbon and nitrogen sources for microorganisms. In a study by Sanchez Pro on the halophilic bacteria of a saline lake in Spain, the enzymes produced in the greatest amounts by the isolated strains was amylase followed by proteases and lipases (Sanchez pro et al. 2003).

Actinomycetes are important for plants, where rhizospheric streptomycetes can protect plant roots by producing antifungal compounds. They also produce plant growth promoting hormones such as gibberellin and auxin-like compounds which are responsible for cell division, elongation, and differentiation (Bloemberg and Lugtenberg 2001). In this study, the effect of isolated actinomycetes on the growth and germination of Echium sp. was investigated. It was revealed that the three strains belonging to the genus Streptomyces cause the seeds of this plant to germinate faster. Also, one of the strains of the genus Nocardia increased the stem length and the number of Echium leaves in 20 days. Other studies have shown that the genus Streptomyces has the greatest effect on plant growth compared to other bacteria due to the production of siderophore and Indole-3-Acetic Acid (IAA), phosphate solubilization and production of 1-aminocyclopropane-1carboxylate (ACC) deaminase (Kruasuwan and Thamchaipenet 2016).

Streptomycetes are differentiated groups that can produce distinctive cytotoxic compounds withanticancer activity (Selim et al. 2021). They have significant activity against different malignant cell lines (Selim et al. 2021). In the present study, the most potent strain, act9, showed high cytotoxicity toward the tested human tumor cell line. Interestingly, the act9 extract exhibited a selective cytotoxic activity toward MDA-MB-231while it was significantly (P < 0.05) non- toxic toward the normal cell line (Table 1). This selectivity is a prerequisite that could improve therapeutic properties of a cytotoxic agent. Other studies have also shown antitumor activity of Streptomyces strains of saline environments (Gozari et al. 2019).

As actinomycetes are a suitable source of new bioactive metabolites, introduction of the strains identified in the present study would be of great value in industrial applications due to their capability in producing compounds such as, enzymes, antitumor agents and antibiotics. However, the ecological habitats have an underexplored rare actinomycetes diversity and yet to be investigated for unknown metabolites.

Acknowledgment

We thank Dr. Hamidreza Jafari for his help in collecting samples. Also, the authors gratefully acknowledge university of Kharazmi for supporting this study.

Statements & Declarations

The authors declare that no funds, grants, or other support were received during the preparation of this manuscript.

Competing Interests

The authors have no relevant financial or non-financial interests to disclose.

Data availability

The datasets generated during the current study are available from the corresponding author on reasonable request.

Balseiro-Romero M, Gkorezis P, Kidd PS, Van Hamme J, Weyens N, Monterroso C, Vangronsveld J. (2017) Use of plant growth promoting bacterial strains to improve Cytisus striatus and Lupinus luteus development for potential application in phytoremediation. Sci Total Environ 581:676–88. https://doi.org/10.1016/j.scitotenv.2016.12.180
Benson JH (2002). Microbiological Applications. Laboratory manual in general Microbiololy. 8th edition.
Bloemberg GV, Lugtenberg BJ (2001) Molecular basis of plant growth promotion and biocontrol by rhizobacteria. Curr Opin Plant Biol 4(4) 343–350. https://doi.org/10.1016/S1369-5266(00)00183-7
Chanthasena P, Nantapong N (2016) Biodiversity of antimicrobial-producing actinomycetes strains isolated from dry dipterocarp forest soil in northeast Thailand. Braz Arch Biol Techn 59. https://doi.org/10.1590/1678-4324-2016150674
Duraipandiyan VAH, Sasi VIH, Islam M, Valanarasu S, Ignacimuthu S (2010) Antimicrobial properties of actinomycetes from the soil of Himalaya. J Mycol Med 20: 15–20. https://doi.org/10.1016/j.mycmed.2009.11.002
Ferreira LA, Henriques O, Andreoni AA, Vital GR, Campos MM, Habermehl GG and de Moraes VL (1992) Antivenom and biological effects of ar-turmerone isolated from Curcuma longa (Zingiberaceae). Toxicon 30(10): 1211–1218
Gozari M, Zaheri A, Jahromi ST, Gozari M. and Karimzadeh R (2019) Screening and characterization of marine actinomycetes from the northern Oman Sea sediments for cytotoxic and antimicrobial activity. Int Microbio 22(4) 521–530. https://doi.org/10.1007/s10123-019-00083-3
He D, Li X, Sai X, Wang L, Li S, Xu Y, (2018) Camellia nitidissima CW Chi: a review of botany, chemistry, and pharmacology. Phytochem Rev 17(2), 327–349.
Hong K, Gao AH, Xie QY, Gao HG, Zhuang L, Lin HP, Yu HP, Li J, Yao XS, Goodfellow M, Ruan JS, (2009) Actinomycetes for marine drug discovery isolated from mangrove soils and plants in China. Mar drug 7(1) 24–44. https://doi.org/10.3390/md7010024
Joycharat N, Thammavong S, Voravuthikunchai SP, Plodpai P, Mitsuwan W, Limsuwan S, Subhadhirasakul S (2014) Chemical constituents and antimicrobial properties of the essential oil and ethanol extract from the stem of Aglaia odorata Lour., Natural Product Research, 28:23, 2169–2172.
Jayashree S, Vyas V, Bhatnagar GP, Syed S (1991) On selection of methods and media for isolation of freshwater actinomycetes. Env techn 12(12) 1183–1186. https://doi.org/10.1080/09593339109385119
Keiser T, Bibb MJ, Buttner MJ Charter KF, Hopwood DA (2000) Practical streptomyces genetics. The John Innes Foundation. Norwich
Kruasuwan W, Thamchaipenet A, (2016) Diversity of culturable plant growth-promoting bacterial endophytes associated with sugarcane roots and their effect of growth by co-inoculation of diazotrophs and actinomycetes. J Plant Growth Regul 35(4) 1074–1087. https://doi.org/10.1007/s00344-016-9604-3
Kumar RR, Jadeja VJ (2016) Isolation of actinomycetes: A complete approach. Int J Curr Microbiol App Sci 5(5): 606–618. http://dx.doi.org/10.20546/ijcmas.2016.505.062
Kushner H, Kamekura M (1988). Physiology of halophilic eubacteria in Rodriguez-Valera F, editor. Halophilic bacteria. I. Boca Raton, Fla: CRC Press, Inc.109–140
Lee HS (2006) Antimicrobial properties of turmeric (Curcuma longa L.) rhizome-derived ar-turmerone and curcumin. Food Sci Biotechnol15(4), pp.559–563.
Ma Y, Galinski EA, Grant WD, Oren A, Ventosa A. (2010) Halophiles 2010: life in saline environments. App. Env. microb. 76(21):6971–81. https://doi.org/10.1128/AEM.01868-10
Mandrika I, Kumar S, Zandersone B, Eranezhath SS, Petrovska R, Liduma I, Jezupovs A, Pirags V, Tracevska T (2021) Antibacterial and Anti-Inflammatory Potential of Polyherbal Formulation Used in Chronic Wound Healing. Evidence-Based Complementary and Alternative Medicine.
Marliyana SD, Wibowo FR, Wartono MW, Munasah G (2019) Evaluation of antibacterial activity of sesquiterpene Ar-Turmerone from Curcuma soloensis Val. rhizomes. In IOP Conference Series: Materials Science and Engineering (Vol. 578, No. 1, p. 012060). IOP Publishing.
Oren A, (2006) Halophilic microorganisms and their environments (Vol. 5). Springer Science & Business Media.
Parera-Valadez Y, Yam-Puc A, López-Aguiar LK, Borges-Argáez R, Figueroa-Saldivar MA, Cáceres-Farfán M, Márquez-Velázquez NA, Prieto-Davó A (2019) Ecological strategies behind the selection of cultivable actinomycete strains from the yucatan peninsula for the discovery of secondary metabolites with antibiotic activity. Microb ecol 77(4) 839–851. https://doi.org/10.1007/s00248-019-01329-3
Ramesh S, Mathivanan N (2009) Screening of marine actinomycetes isolated from the Bay of Bengal, India for antimicrobial activity and industrial enzymes. World J Microb Biot 25(12) 2103–2111. https://doi.org/10.1007/s11274-009-0113-4
Rohban R, Amoozegar MA, Ventosa (2009) Screening and isolation of halophilic bacteria producing extracellular hydrolyses from Howz Soltan Lake, Iran. J Ind Microbiol Biot 36(3) 333–340. https://doi.org/10.1007/s10295-008-0500-0
Salehghamari E, Soleimani M, Tafacori V (2015) Antibacterial activity of some actinomycetes isolated from soils of Alborz province, Iran. Prog Biol Sci 5: 159–167. https://doi.org/10.22059/PBS.2015.55526
Salehghamari E, Taheri F, Hosseini M, Sardabi M, Etesami A, Hasani G (2017) Interspecies interactions of halophilic and halotolerant actinomycetes: An example from a salt. Prog Biol Sci 7(2) 183–189. https://doi.org/10.22059/PBS.2020.258364.1303
Sánchez-Porro C, Martin S, Mellado E, Ventosa A (2003) Diversity of moderately halophilic bacteria producing extracellular hydrolytic enzymes. J Appl Microbiol 94(2) 295–300. https://doi.org/10.1046/j.1365-2672.2003.01834.x
Selim MSM Abdelhamid SA, Mohamed SS (2021) Secondary metabolites and biodiversity of actinomycetes. J Genet Eng Biotechno 19(1) 1–13. https://doi.org/10.1186/s43141-021-00156-9
Seyedsayamdost MR Traxler MF Clardy J Kolter R (2012) Old meets new: using interspecies interactions to detect secondary metabolite production in actinomycetes. Method Enzymol 517: 89–109. https://doi.org/10.1016/B978-0-12-404634-4.00005-X
Singh P, Saini KC, Ali V, Gupta SK, Verma M (2020) Small in Size, Big in Impact: Marine Microbes, a Boon for Biotherapeutics. In Marine Niche: Applications in Pharmaceutical Sciences (73–88). Springer, Singapore.
Srisayam M, Jooduang J, Srisopa A, Keerin P, Sangthong S (2018) Chemical composition and antibacterial activity of essential oils from three Curcuma species in Thailand. Rajabhat J Sci Humanities Social Sci 19(2), pp.222–233.
Tille PM, Forbes BA (2014). Bailey & Scott’s diagnostic microbiology (Thirteenth edition.). St. Louis, Missouri: Elsevier.
Van de Loosdrecht AA, Beelen RH, Ossenkoppele G, Broekhoven MG, Langenhuijsen MM (1994) A tetrazolium-based colorimetric MTT assay to quantitate human monocyte mediated cytotoxicity against leukemic cells from cell lines and patients with acute myeloid leukemia. J Immunol Methods 174(1–2): 311–320. https://doi.org/10.1016/0022-1759(94)90034-5
Yin J, Chen JC, Wu Q, Chen GQ (2015) Halophiles, coming stars for industrial biotechnology. Biotechnol Adv 33(7): 1433–1442. https://doi.org/10.1016/j.biotechadv.2014.10.008
You J, He SC, Chen L, Guo ZH, Gao F, Li RK, Qu WL, Chen W (2021) A Network Pharmacology-Based Study on Pharmacological Activities and Mechanisms of Essential Oil in Leaves of C. Grandis ‘Tomentosa’.

Table 1. Cytotoxic activity of secondary metabolites extracted from the potent Streptomyces isolates against human tumor cell line MDA-MB-231 (IC50 µg/ml).

Isolates	Act1	Act9	Act25
24h	82.876±8.45	66.423±1.76	113.452±2.98
48h	50.467±2.65	19.716±5.72	43.598±9.71

No competing interests reported.

Supp.docx

Download PDF

Editorial decision: Major revision
08 Aug, 2022
Reviews received at journal
27 Jul, 2022
Reviewers agreed at journal
14 Jul, 2022
Reviewers invited by journal
14 Jul, 2022
Editor assigned by journal
14 Jul, 2022
Submission checks completed at journal
13 Jul, 2022
First submitted to journal
12 Jul, 2022

You are reading this latest preprint version

Actinomycetes of Howz Soltan Lake and their metabolite diversity in Iran

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Declarations

References

Tables

Additional Declarations

Supplementary Files

Status:

Version 1