DOI: https://doi.org/10.21203/rs.3.rs-1854039/v1
This study was a purpose to investigate the anti-aging activity of Comfrey cell suspension culture (CCSC) extract. The effects of CCSC extract on human normal fibroblast cells (CRL-2076) were examined. Comfrey callus and suspension culture were obtained in Murashige and Skoog (MS) medium including 1 mg/L 2,4-Dichlorophenoxyacetic acid (2.4-D). Total phenolic contents were determined in CCSC lyophilizes, the highest phenolic content was found to be 1181 µM gallic acid equivalent in the extract prepared with 70% ethanol solvent. The half-life concentration (IC50 value) of the extract was determined as 83 µg/ml with 2,2-Diphenyl-1-picrylhydrazyl (DPPH) scavenging activity. It was found that CCSC extract incubated for 48 h did not reduce cell viability on CRL-2076 cells at doses of 100 and 200 µg/mL.
The addition of the CCSC extract at 100 µg/mL concentration to aged CRL-2076 cells increased the collagen type 1 alpha 1 (COL1A1) gene expression level 1.2-fold, elastin (ELN) gene expression level 1.4-fold, and hyaluronan synthase 3 (HAS3) gene expression level 1.4-fold. However, the addition of the CCSC extract at 200 µg/mL concentration to aged CRL-2076 cells increased the COL1A1 gene expression level 1.3-fold, ELN gene expression level 2.7-fold, and HAS3 gene expression level 1.7-fold.
In the study, CCSC extract was shown to have anti-aging properties on CRL-2076 cells, suggesting that CCSC extract can be used as active raw material in natural anti-aging cosmetic products.
Plant cell culture technology has numerous advantages because they address issues such as carbon footprint and water requirements, as well as pesticide and herbicide requirements that may arise as a result of plant use. Plant cell culture technology allows for the preparation of safe and clean components with high consistency levels, independent of seasons or plant reproduction cycles, under controlled conditions, and without the use of agricultural land. Furthermore, when using plant cell culture methods for secondary metabolite production, the concentration of compounds, culturing conditions, and physical parameters can be changed, or the amount of the desired compound can be increased or optimized by adding an inducer compound to the culture medium (Barbulova et al., 2014; Eibl et al., 2018; Krasteva et al., 2021; Trehan et al., 2017). Secondary metabolites have the potential to be used in different industries, pharmaceuticals, agriculture, cosmetics, textiles, and food, making them economically significant (Smetanska, 2008).
Plant cells can also produce higher concentrations of secondary metabolites that are not obtained by methods such as chemical synthesis and extraction, or are obtained at low concentrations. Plant cells have also been used to develop and produce various types of cosmetic actives (Eibl et al., 2018). Several production processes have been established in the cosmetic industry using plant cell culture technology. Examples of commercially produced products are arbutin (a whitening ingredient) from Catharanthus roseus, shikonin (a cosmetic pigment) from Lithospermum erythrorhizon, and carthamin (a cosmetic pigment) from Carthamus tinctorius. (Schürch et al., 2008).
Comfrey (Symphytum officinale L.) is traditionally used in folk medicine to reduce inflammation, promote wound healing, and treat broken bones and skin conditions. The traditional use activities of comfrey preparations have been confirmed by experimental studies.
Comfrey has been used for centuries as a conventional medicinal herb for treatment (Staiger, 2013) and it has a wide range of therapeutic applications. Comfrey has therapeutic applications, including injuries, fractures, swollen bruises, varicose ulcers, burns, tissue repair, arthritis, rheumatic pains, and non-healing wounds (Mulkijanyan et al., 2009; Savic et al., 2015). Comfrey contains a high concentration of rosmarinic acid, which has antioxidant activity. Recent studies have shown that antioxidants help prevent inflammation and promote wound healing (Sowa et al., 2018). Allantoin is the most pharmacologically active component of comfrey root, with a ratio of 0.6–0.8% (Mulkijanyan et al., 2009; Savic et al., 2015). Phenolic acids and allantoin (Rosmarinic, caffeic, p-hydroxybenzoic, p-coumaric acids and chlorogenic, etc.) found in Comfrey root extract have a positive effect on human skin fibroblasts and also provide remarkable wound healing antioxidant effect (Mulkijanyan et al., 2009; Salehi et al., 2019; Savic et al., 2015; Shestopalov et al., 2006).
All layers of the dermis and epidermis are involved in the complex biological process of skin aging (Papakonstantinou et al., 2012; Weihermann et al., 2017). Aging of human skin occurs as a result of two independent processes, age-related aging, and photoaging. The aging process is characterized by the reduction of collagen, elastin, and hyaluronic acid synthesis in the skin and the deterioration of dermal collagen and elastin structure. Age-dependent aging is an unavoidable process in which genetic and metabolic factors that occur with age are effective. Photoaging is a process in which external factors such as ultraviolet (UV) light and air pollution are effective (Kang et al., 2016; Weihermann et al., 2017). In both age-dependent and premature aging aged skin, degraded collagen levels increase while collagen synthesis declines (Papakonstantinou et al., 2012). Skin aging is characterized by processes such as decreased fibroblast count, skin thinning, decreased collagen synthesis, deterioration of dermal elastin structure, decreased elastin synthesis, and loss of elasticity. All of these processes are effective at causing skin sagging and wrinkle formation (Duque et al., 2017; Weihermann et al., 2017).
The most abundant extracellular matrix (ECM) protein made by dermal fibroblasts is collagen. About 80% of the dry weight of the dermis is produced by type I collagen (Mei Xiong et al., 2017). Exposure to UV light can reason photoaging of the skin by downregulating collagen synthesis (Jung et al., 2014). Skin elasticity depends on elastin, one of the richest ECM proteins in the skin dermis. Elastin is synthesized by dermal fibroblasts and forms into higher-order structures with other ECM proteins. Elastin production remains relatively constant during physiological aging until the age of 30 to 40, after which it drops significantly (Mei Xiong et al., 2017). Hyaluronan, also known as hyaluronic acid (HA), is an ECM component that is used to fill areas where cells can migrate. Hyaluronic acid is responsible for moisture retention in the skin, and it forms a base for fibroblasts during wound healing and tissue repair (Lee et al., 2016).
Collagen type 1 is a heterotrimer, triple helix protein encoded by the COL1A1 and COL1A2 genes and occurs of two α1 chains and one α2 chain (Bornstein & Sage, 1989). Elastin is encoded by the single-copy ELN gene and it occurs as a soluble tropoelastin precursor that can be found as globules or expanded polypeptides (Kielty, 2006). Hyaluronic acid is an unbranched glycosaminoglycan and is synthesized by HA synthases (HAS1-3). Hyaluronan synthase 3, encoded by the HAS3 gene, is related to the synthesis of hyaluronic acid. When the HAS3 gene is compared with the proteins encoded by other members of the HA synthase family (HAS1 and HAS2), it was concluded that this protein is more a regulator of hyaluronan synthesis (Ota et al., 2022).
Plant cells have totipotent properties, they can produce specific secondary metabolites found in parent plants and comply with good manufacturing practices and procedures. Plant cells can be easily produced using high-volume bioreactors regardless of climate. This method provides a reliable contamination-free production for the continuous supply of medicinal, rare, and endangered plant species (Georgiev et al., 2018). In many studies to date, methods to slow down skin aging, and strengthen and protect skin cells have been investigated. Plant stem cells can induce fibroblasts to synthesize collagen, which stimulates skin regeneration, and may exhibit anti-aging properties (Miastkowska & Sikora, 2018). Although the metabolites of Comfrey are supported by different studies with medicinal effects on the skin, the anti-aging activity of comfrey cell suspension culture extract on aged CRL20-76 cells has yet to be determined. For this reason, it would be an appropriate approach to obtain cell cultures of the comfrey plant, which has the potential to be a cosmetic active ingredient, using plant cell culture technology and to investigate the efficiency of the obtained cells in human normal fibroblast cells. For this reason, the effect of comfrey cell suspension extract on the expression of the COL1A1, ELN, and HAS3 genes were analyzed to determine the anti-aging activity in aged CRL-2076 cells.
MS media with vitamins (MSP20), 6-Benzylaminopurine (BAP, B001), and 2,4-D (D001) were supplied from Caisson Lab (USA). Culture gel (Gellan gum, G434) was purchased from PhytoTech Labs (KS, USA). Tween-20 (P1379), gallic acid (G7384), Folin & Ciocalteu′s phenol reagent (F9252), sodium bicarbonate (Na2CO3, 1.06392), (±)-6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid (Trolox, 238813), and DPPH (D9132) were supplied from Sigma-Aldrich (St Louis, MO, USA). 1-(4,5-Dimethylthiazol-2-yl)-3,5-diphenylformazan (MTT Formazan, A2231) and dimethyl sulfoxide (DMSO, A3672) were purchased from Applichem (Darmstadt, Germany). Iscove's Modified Dulbecco's Medium with L-Glutamine (IMDM, 21980-032), and Fetal Bovine Serum (FBS, 10270-106) were purchased from Gibco Life Technologies (Carlsbad, CA, USA). RNA isolation kit (E.Z.N.A Total RNA kit I) was purchased from Omega Bio-tek (Norcross, GA, USA). cDNA synthesis kit (High Capacity cDNA Reverse Transcription Kit) and SYBR Green master mix kit (Power Up, SYBR Green master mix kit) were supplied from Applied Biosystems (Forster City, CA, USA).
Comfrey (Symphytum officinale L.) seeds supplied from Zeytinburnu Medicinal Plants Botanical Garden, Zeytinburnu, İstanbul.
Comfrey leaves were surface-sterilized in one or two drops of Tween-20 containing 10% bleach for 10 min, then washed three times (five min each) with sterile distilled water. Surface-sterilized leaves were placed in an semi-solid MS media with vitamins included with 1 mg/L BAP. The explants were incubated at 25 ± 2°C under a 16-h photoperiod. New shoots formed by organogenesis were transferred to semi-solid MS medium with vitamins for four weeks. In vitro seedlings grown in semi-solid MS media with vitamins were regularly subcultured every month. In the third subculture of in vitro grown comfrey leaves were cut into small pieces and placed on a solid semi-solid MS media with vitamins included with 1 mg/L 2,4-D in dark. Friable calluses incubated for 30 days in the dark were used to obtain suspension culture. 5 g of friable callus from the third subculture was transferred to 50 mL of liquid MS media with vitamins included with 1 mg/L 2,4-D to create the cell suspension. Then 250 mL erlenmeyer flask was placed on a shaker (in dark, 110 rpm, 25 ± 2°C). Every 14 days, cells were moved to a fresh liquid media to be cultivated.
Cell suspension cultures in flasks were harvested through Miracloth after 14 days of incubation. The harvested cells were washed with distilled water. Cell harvests were frozen and then dried in a lyophilizer (Teknosem, TRS 4/2V). 400 mL of 70% ethanol solvent was added to 10 grams of cell lyophilisate and homogenized with a homogenizer (Wisetis, HG-150). The prepared mixture was incubated with shaking at 110 rpm for 24 h at room temperature (Infost HT, Multitron Set). After 24 h of incubation the samples were filtered via filter paper to remove the residue. Using a rotary evaporator (Heidolph, Hei-VAP) under atmospheric pressure, the filtrate was evaporated at 40°C. The solvent was removed and the extract was freeze-dried.
The Folin Ciocalteu reagent method was used to determined the amount of total phenolic content in the CCSC extract (Ainsworth & Gillespie, 2007). CCSC lyophilisate was prepared in triplicate with different solvents (100% water, 10% ethanol, 50% ethanol, 70% ethanol, 96% ethanol) at a concentration of 1 mg/mL. Using a homogenizer, the mixtures were homogenized for 45 sec at 4000 rpm (Roche, MagNA Lyser). After 24 h of incubation, the prepared extracts were centrifuged at 13000 rpm for 5 min and the supernatant was filtered through a PTFE syringe filter (Sartorious, 0.45 µM). 100 µL of CCSC extracts and 200 µL of 10% Folin & Ciocalteu′s phenol reagent were mixed. Then, 800 µL of 700 mM Na2CO3 was added to the mixture and the reaction was incubated for 2 h at room temperature in the dark. For each analysis, triplicates of the standard gallic acid and samples were made and the average absorbance value was obtained. A spectrophotometer was used to measured absorbance at 765 nm. Gallic acid standard absorbance (100–600 µM) was used to calculate the total phenol concentration, which was calculated as gallic acid equivalents (µM of GAEs/g of extract)
The antioxidant activity of CCSC extract was measured with the most commonly used DPPH free radical method (Adedapo et al., 2009). Briefly, CCSC extract was processed in 1 mL of 0.135 mM DPPH at concentrations of 31.25, 62.5, 125, 250, and 500 µg/mL. Trolox was used as a positive control. Samples were thoroughly blending the samples for 10 sec and than incubated for 30 min at room temperature in the dark. A spectrophotometer was used to measured absorbance at 517 nm. The % DPPH activity of CCSC extract was calculated with the formula (%) inhibition= ((A of control-A of the sample) /A of control) X 100. IC50 value was calculated using the concentration plot and % inhibition values.
Human normal fibroblast cells (CRL-2076) were maintained in an IMDM medium including 10% FBS. Cells were incubated at 37°C in a humid atmosphere with 5% CO2 (Heal Force, HF90).
CRL-2076 cells (passages 17) were cultured in IMDM including 10% FBS and grown at 37°C in a humidified atmosphere with 5% CO2. The MTT assay was used to measure cell viability (Mosmann, 1983). In 24-well plates, CRL-2076 cells were seeded at a density of 0.1 x105 cells/well to allow for 24 h complete attachment. The cells were treated with 100 and 200 µg/mL concentrations of CCSC extracts for 48 h. After removing the culture media, MTT solutions (5 mg/mL) were incubated for three hours at 37°C, and the formazan that had precipitated was subsequently dissolved in DMSO. A microplate spectrophotometer was used to measured absorbance at 570 nm. The viability of cells treated with CCSC extract concentrations was expressed as relative cell viability versus those of controls.
CRL-2076 cells (passages 17) were seeded at a density of 0.1x105 cells/flask in 25 cm2 flasks for complete attachment at 37°C with 5% CO2. After 24 h of incubation the cells were then treated with 100 and 200 µg/mL concentrations of CCSC extract for 48 h with the exception of the control group. RNA isolation kit was used to isolate total RNA. The purity of the isolated RNA was determined using a spectrophotometer (Thermo Scientific, NanoDrop 2000c).
cDNAs were synthesized using a cDNA synthesis kit and 100 ng/µL of total RNA. The purity of the synthesized cDNA was determined using a spectrophotometer (Thermo Scientific, NanoDrop 2000c). RT-qPCR (Roche, LightCycler 480) was used to determine the effect of CCSC extract on anti-aging genes on CRL-2076 cells. The SYBR Green master mix kit was used to identify the change in gene expression. Changes in expression of genes (COL1A1, ELN, HAS3, Thermo Fisher Custom Primers) were determined using the reference ACTB gene and an RT-qPCR system. Reading results were evaluated using the 2[−△△ct] method (Schmittgen & Livak, 2008).
|
Gene Name |
PRIMER SEQUENCES |
|
|---|---|---|
|
COL1A1 |
Upstream: 5′-CTGGAAGAGTGGAGAGTACTG − 3′ Downstream: 5′-GTCTCCATGTTGCAGAAGAC − 3′ |
|
|
ELN |
Upstream: 5′-ATAAAGCTGCTAAGGCTGG − 3′ Downstream: 5′-AAAGCTCCACCTACACCTG − 3′ |
|
|
HAS3 |
Upstream: 5′- TGGACTACATCCAGGTGTG − 3′ Downstream: 5′- TGAGTCGTACTTGTTGAGGA − 3′ |
|
|
ACTB |
House-keeping gene |
Upstream: 5′- GGCTCTATTCCAACCATCCA − 3′ Downstream: 5′- TAGAAGCAGTGCCACCACAC − 3 |
Graphpad Prism version 9.4 was used to conduct a statistical analysis of the value differences between the groups using ANOVA and Tukey's test. For p < 0.05, differences were considered statistically significant.
Friable callus formation was observed after three weeks in callus induction induced using leaf explants of Comfrey in vitro grown comfrey plants (Fig. 1a). Selected friable calluses were transferred to a fresh medium and subcultured every 30 days. Friable calluses in the third subculture were (Fig. 1b) used for cell suspension culture. Cell aggregates that were not suspended at the two-week suspension were removed from the suspension by filtration through sterile sieves. Comfrey cell suspension cultures were subcultured every two weeks (Fig. 1c). Comfrey cell suspension cultures Packed Cell Volume (PCV) was obtained as 65%.
Total phenolic content was determined in Comfrey cell suspension culture in different solvents using the gallic acid (100–600 µM) standard. Total phenolic content is calculated as µM gallic acid equivalents per gram CCSC extract weight using a formula derived from a standard curve (µM of GAEs/g of extract) (Fig. 2). Total phenolic content in the study extracts was determined as 694 µM in 100% aqueous extract, 744 µM in 10% ethanol extract, 989 µM in 50% ethanol extract, 1181 µM in 70% ethanol extract, and 179 µM in 96% ethanol extract, respectively. (Fig. 2). From this point of view, it was concluded that the extract prepared using 70% ethanol solvent had a higher phenolic content.
The antioxidant activity of CCSC extract and standard compound (Trolox) were evaluated spectrophotometrically with the most commonly used DPPH free radical method. In the graph of the drawn Trolox standard, % activity increase was observed depending on the dose (Fig. 3a). The IC50 value of the CCSC extract was determined as 83 µg/ml corresponding to 50% in the graph drawn with the % activity corresponding to the doses. The results showed that CCSC extracts inhibited significantly (p < 0.05) depending on the concentrations used. (Fig. 3b).
The effect of CCSC extract on cell viability was evaluated before investigating the effect of CCSC extract on CRL-2076 cells. The MTT assay was used to the effect of CCSC extract on cell viability. CRL-2076 cells were treated with CCSC extract concentrations of 100 and 200 µg/mL for 48 hours. As shown in Fig. 4, CCSC extract did not reduce cell viability when cells treated with the extract were compared with the control group. CCSC extract concentrations determined not to reduce cell viability were used for further studies.
To determine whether CCSC extract has anti-aging activity, anti-aging-arelated expression gene levels were analyzed by RT-qPCR. CCSC extracts were treated to CRL-2076 cells for 48 h at concentration of 100 and 200 µg/mL. The COL1A1, ELN, and HAS3 genes were found to be significantly and dose-dependently up-regulated by CCSC extract at doses of concentrations of 100 and 200 µg/mL
Expression of the COL1A1 gene increased 1.2-fold at the 100 µg/mL concentration and 1.3-fold at the 200 µg/mL concentration compared to the control group (Fig. 5a). Expression of the ELN gene increased 1.4-fold at the 100 µg/mL concentration and 2.7-fold at the 200 µg/mL concentration compared to the control group (Fig. 5b). Expression of the HAS3 gene increased 1.4-fold at the 100 µg/mL concentration and 1.7-fold at the 200 µg/mL concentration compared to the control group (Fig. 5c).
Valuable medicinal plants have been used in different health fields from past to present. While some of these plants are used as active pharmaceutical ingredients, some of them are used in the cosmetics industry. Many plants contain small amounts of valuable metabolites and require large amounts of plants to obtain these metabolites. For this reason, the use of biotechnological methods is an appropriate approach to obtaining valuable metabolites in plants. Plant cell suspension culture is a sustainable source for obtaining valuable metabolites. In many studies, it is possible to produce cell suspension cultures and methods for the cosmetics and pharmaceutical industries on an industrial scale.
It has been demonstrated in studies that the wound healing activity of the Comfrey plant. However, no study has been conducted to investigate the anti-aging activity of Comfrey cell suspension culture extract by determining gene expression in fibroblast cells. Therefore, in this study, the effect of Comfrey cell suspension culture extract was evaluated.
In this study, the most efficient solvent in CCSC extracts of different solvents prepared with lyophilisates was investigated. The highest total phenolic content determined in 5 different solvents (100% water, 10% ethanol, 50% ethanol, 70% ethanol, and 96% ethanol,) was found to be 1181 µM in the extract prepared with 70% ethanol solvent. The 3T3 Swiss albino mouse fibroblast cell line was used in a study to examine the antioxidant and proliferative effects of Comfrey aqueous and ethanolic extracts. According to the study, the ethanolic and aqueous extracts of comfrey root contained total phenolic contents of 116.93 and 99.49 mg GAE/g, respectively (Ustun Alkan et al., 2014).
In this study, the antioxidant activity of CCSC extract was evaluated with the DPPH assay and its IC50 value was determined as 83 µg/mL. In a study, Fulya et al. the IC50 value of the Comfrey ethanolic extract was reported as 39.97 µg/mL, and the IC50 value of the aqueous extract was reported as 96.21 µg/mL (Ustun Alkan et al., 2014).
The cytotoxicity of the CCSC extract was determined in aged CRL-2076 cells before assessing the anti-aging activity. It was determined that CCSC extract did not show reduce cell viability on CRL-2076 cells after 48 h of incubation at 100 and 200 µg/mL concentrations. In a studt Fulya et al., it was shown that Comfrey aqueous and ethanolic extracts were not reduced cell viability on 3T3 cells and had proliferative activity on them (Ustun Alkan et al., 2014). In a similar study, Ireneusz et al. investigated the antioxidant and proliferative activity of comfrey root extract. In the study, it was concluded that Comfrey root extracts (50–200 µg/mL) did not reduce cell viability on HSF cells after 24 and 48 h of incubation (Sowa et al., 2018).
In this study, CCSC extract was examined to determine whether it has transcriptional anti-aging activity in aged CRL-2076 cells. Incubation of CCSC extract at 100 µg/mL concentration in CRL20-76 cells for 48 hours increased the expression level of COL1A1, ELN, and HAS3 genes 1.2-fold, 1.4-fold, and 1.4-fold, respectively. However, CCSC extract at a concentration of 200 µg/mL in CRL20-76 cells increased the expression level of the COL1A1, ELN, and HAS3 genes by 1.3-fold, 2.7-fold, and 1.7-fold, respectively. In the evaluation, it was concluded that CCSC extract up-regulated the expression levels of the anti-aging-related genes COL1A1, ELN, and HAS3 genes in aged CRL-2076 cells in a dose-dependent manner. When the studies in the literature are examined, there is no gene study with which we can compare the results we obtained at the gene level.
This study showed that CCSC extract did not reduce cell viability in CRL-2076 cells in aged CRL-2076 cells and significantly increased the expression of COL1A1, ELN, and HAS3 genes. Comfrey plant is characterized by high antioxidant properties, stimulating wound healing and skin regeneration (increase in fibroblast proliferation). The results obtained in this study show that CCSC extract obtained by in vitro cell culture technology from the Comfrey plant can also be used as an anti-aging natural active ingredient in cosmetics. Obtaining CCSC extract by cell culture techniques allows this extract to be grown in large volumes in a bioreactor for industrial-scale production.
Acknowledgments
Authors would like to thank sponsor Company ACTV Biotechnology. Aysenur Calli. has received research support from ACTV Biotechnology through her thesis project.
Authors Contribution
All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Aysenur Calli, Senay Vural Korkut and Yıldız Bodurlar. While Aysenur Calli wrote the first draft of the article, Yıldız Bodurlar and Senay Vural Korkut provided feedback on previous drafts and revised them. The final manuscript has been read and approved by all authors.
Complaince with ethical standards
This article does not contain any studies involving animals or human participants performed by any of the authors.
Conflict of interest
The authors declare that they have no conflict of interest.
Competing Interest
Authors declare financial interests/personal relationships that could be considered potential competing interests. All authors stated that financial support, equipment and materials were provided by ACTV Biotechnology.