Graphene Oxide Induced Oxidative Stress Gene Expression and Gut Microbiome Profiling in in Vivo Drosophila Melanogaster Model

doi:10.21203/rs.3.rs-1855364/v1

PDF

Research Article

Graphene Oxide Induced Oxidative Stress Gene Expression and Gut Microbiome Profiling in in Vivo Drosophila Melanogaster Model

https://doi.org/10.21203/rs.3.rs-1855364/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted 22 Jul, 2022

You are reading this latest preprint version

In the present study we have attempted to reveal the induction of stress, changes in behavioral, molecular, and gut microbiome profile by Graphene oxide (GO) in Drosophila melanogaster. The study revealed that GO does not exert accountable mortality in larvae but had little impact on the formation of pupa from larvae in the treatment group compared to the control group. Similarly, the larval movement exhibited little change in the treatment group (21) compared to the control group (17). The flies that emerged from with and without GO treatment were analyzed for the expression of Glutathione S transferase D 1 (Gstd1) and Acetylcholine Esterase (AchE) gene. In the gut-microbiome study, GO administration had metabolic change and was well measured with increased Acetobacteraceae to survive in the stress-induced conditions. Hence it was concluded that GO was not lethal at 300µg/mL and hence its application in the drug delivery tool or carrier perhaps cause are. Instead, it can able to induce oxidative stress and changes in the regulation of the gene attributed to oxidative stress and locomotor behavior.

Graphene Oxide

Drosophila

Gstd1

AchE

Gut-microbiome

In the recent years, Graphene oxide (GO), the carbon material (Tian et al., 2019; Kusuma et al., 2018; Karim et al., 2019) with multifunctional groups, carboxylic, hydroxyl, epoxy, and carbonyl (Gao et al., 2015; Chiu et al., 2013), is used in automobiles (Yang and Gupta, 2005; Chen et al., 2013), biomedical (Nurunnabi et al., 2015; Zhang et al., 2010), cancer treatment/therapy (Wang et al., 2013; Luo et al., 2017; Qin et al., 2013), biomedical field (Gollavelli and Ling, 2012; Kumar and Chatterjee, 2016; Shen et al., 2012), water purification (Han et al., 2013), and food industry (Alocilja and Radke, 2003). In the biomedical field, GO is a fascinating material for targeted drug or gene delivery (Nurunnabi et al., 2015; Zhang et al., 2010; Wu et al., 2015; Goenka et al., 2014; Feng and Liu, 2011). The key characteristics such as its aromatic domain (π-conjugated) and functional groups facilitate the water dispersal property and the binding of biomolecules respectively (Tian et al., 2019) that make GO befitting in targeted drug delivery. GO’s incorporation in almost all fields bring attention to its eco-friendly or cytotoxic behaviour and Liu et al. (2011), Akhavan and Ghaderi (2010), Zhang et al. (2011), Misra et al. (2012), and Sasidharan et al. (2011) emphasized the need of toxicity data on carbon nanomaterials. Pertaining to it, Montagner et al. (2017) reiterated the GO’s environmental impact upon its anticipated production in the future. In this line, research on the toxicity of GO has been conducted by Wu et al. (2013), Xiaohui et al. (2018), and Qing et al. (2012) in Caenorhabditis elegans, Daphnia magna and Zebra fish respectively. GO-polyvinylpyrrolidone has been proved to be toxic, transferred to neonates from adult invertebrates (Guo et al., 2013), inducing oxidative stress (Pretti et al., 2014; Fernandes et al., 2017; De March et al., 2017) and reorient the behaviour, physiology, and death (Mesaric et al., 2013; 2015; Zhang et al., 2017; X.Zhang et al., 2017). In Danio rerio, GO stymied the growth and imposed delay in the hatching of embryos. Besides, it’s attachment with zebra fish chorion has also been proved by Chen et al. (2015). Similary, GO toxicity has been well demonstrated with C. elegans (Wu et al., 2013; Zhi et al., 2017; Zhao et al., 2016; Diang et al., 2018) and Daphnia magna (Liu et al., 2018; Xiaohui et al., 2018) but only little information was available on GO toxicity against Drosophila melanogaster. D. melanogaster is an excellent model for toxicity assessment since it shows similarity with human disease genes (Rubin, 2000; Bier, 2005), short life cycle, sufficient offspring for research, easily detectable morphological structure (Chakraborty et al., 2011; Botella et al., 2009; Abolaji et al., 2013). Besides, it is endowed with group of Glutathione S-transferase (Gst) genes in which delta (D) has been befitted for xenobiotic compound or chemical induced expression (Ranson et al., 2002; Willoughby et al., 2006; Higgins and Hayes, 2011) and due to oxidative stress (Sun et al., 2011). The Gst Delta gene fluctuated expression has been confirmed in orient fly (Hu et al., 2014) and Anopheles gambiae (Strode et al., 2006; Harker et al., 2012) during their lifespan. Similarly, acetylcholine esterase (AChE) is also served as good marker for neurotoxicity (Siddique et al., 2015). Besides, gut microbiota in D. melanogaster is bestowing the vital information of fly health and changes in the microbial architect also reflect the disease condition or effect of chemical agents such as silver nanoparticles (AgNps) (Han et al., 2014). Han et al. (2014) also noted Lactobacillus brevis and Acetabacter in inversely proportional level due to AgNps. In addition to this, Siddique et al. (2015) recorded the graphene copper nanocomposite induced heat shock protein, which is an important marker of cellular damage, in D.melanogaster. Hence in order to bring essential toxicological information D. melanogaster was used in the present study. The GO driven developmental changes, induction of heat shock protein, expression of antioxidant genes such as glutathione S transferase D1 (GstD1) and AChE and changes in the gut microbiome in D. melanogaster was reported in the present study.

Chemicals and Reagents

All the chemicals used for the various methods mentioned below were purchased from Himedia Scientific Chemicals and Laboratories – Mumbai, India. All the Molecular biology related reagents mentioned below including primer sets were bought from the Biokart India Pvt. Ltd. Company, Bangalore, India.

Synthesis of Graphene Oxide (GO) and Characterization

In the present study we have used the modified Hummers et al. (1958) method for the synthesis of the GO sheet. The sheet was characterized by using FTIR.

In Vivo Drosophila melanogaster

Collection of Drosophila Melanogaster and Bioassay

D. melanogaster culture was collected from the Osmania University, Hyderabad, India. The major stocks retrieved from the above mentioned Laboratory include mutant flies of w¹¹¹⁸ strain (white eye, tubby). Collection of larvae was done by setting up 8 ounce bottle of D. melanogaster flies and let flies lay eggs for 24hours, then clear bottle of flies by transferring the adults into a new bottle and this can be repeated as many a times as necessary. The bottles were incubated for 3-4 days, are until third instar larvae visible. The bottle with larvae was added with 50-100ml of 20% sucrose and was let sit for 20 minutes; this will make the larvae float to the top. The collected larvae were grouped into 50, 150 and 300 µg/mL of GO and a control (without GO) was maintained. Four replications were maintained and each vial was released with 5 larvae. They were maintained in constant temperature of 25^oC and humidity in the BOD incubator for 24 and 48 hours. During the test, the media was replaced every 3 days with fresh vials and life span data were recorded until all the flies were dead. The mean pupa and adult developments from control and treated larval groups were recorded.

Behavioral Assay: Crawling and Climbing Assay

The larval crawling and climbing assay for the current study was carried out following by Manjila (2018).

RNA Isolation and cDNA synthesis

RNA was isolated from the tissue sample using TRI Soln method. After RNA isolation, the samples were used for cDNA synthesis 2µl of Random Hexamer was added to 8µl of sample and incubated at 70°C for 4 mins in a thermal cycler. Immediately the tubes were placed on ice for 2 mins. The tubes were centrifuged briefly to collect the condensation. Reverse Transcription reagents were added and all the contents were mixed and centrifuged briefly. The tubes were incubated at 42°C for 60 mins. Again it was incubated at 95°C for 5-10 mins to inactivate the reverse transcriptase enzyme. It was stored at -20°C or directly carried for PCR amplification.

Q- PCR Amplification

The PCR mixture consisted of 150 ng and above genomic DNA in each samples, 2.5μl of PCR reaction buffer, 1μl of 6 pmol primers Forward (5'-ATAAATATAAAATATAAATAACAGAATTCGCCCGGCCTGGTACAC-3') and Reverse (5'-TAAGCTTGGCACGGCTGTCCAAAGA-3'), 200 μM of each dNTPs accounting to 4μl and 1.0 unit Taq DNA polymerase making up to the final volume of 25μl. PCR reaction was performed for 30 cycles of denaturation at 94˚C for 1 min, annealing at 58.6˚C for 1.5 min and extension a 72˚C for 1 min and the reaction mixture consisted of the following mixture. A final extension step of 72˚C for 5min was also included. The PCR products were separated by 2% agarose gel electrophoresis and visualized by ethidium bromide staining in AGE.

The DNA pellet retrieved from the D. melanogaster both control and treated was air-dried and re-suspended in 20µL TE buffer supplemented with 2µl of sample buffer (0.25% bromophenol blue, 30% glycerol). The suspended DNA was electrophoretically separated on a 2% agarose gel containing 1µg/ml ethidium bromide and was visualized under the ultraviolet Tran illumination for analysis.

Gut microbiome Study

5 μL of isolated DNA was added in 25 μL of PCR reaction solution (1.5 μL of Forward Primer and Reverse Primer, 5 μL of deionized water, and 12 μL of Taq Master Mix). The primers used for the amplification system includes 27F -5'AGAGTTTGATCMTGGCTCAG3'- and 1492R-5'AAGGAGGTGATCCAGCCGCA3'. Unincorporated PCR primers and dNTPs from PCR products were removed by using Montage PCR Clean up kit. The quality, quantity (App.100ng/μl) and formulation of the PCR product was checked using Qubit Fluorometer 3.0.

Sequencing protocol and Bioinformatic analysis

Nanopore sequencing was performed by using 1μg of DNA template. EPI2ME 16S analysis workflow allows users to perform genus-level identification from single reads; with access to basecalled files for detailed investigations at the species and sub-species level. The phylogeny analysis of query sequence with the closely related sequence of blast results was performed followed by multiple sequence alignment. The workflow is designed to BLAST basecalled sequence against the NCBI 16S bacterial database, which contains 16S sequences from different organisms. Each read is classified based on % coverage and identity. The 16S workflow will be useful in identifying pathogens in a mixed sample or understanding the composition of a microbial community.

Statistical Analysis

The data were analyzed by using Statistical Packages for Social Sciences (SPSS 20.0). One way ANOVA was performed for antioxidant data and the values were represented significant when p<0.05%. The data used were mean of three/five replications. The graphical representations of data were performed using Microsoft Excel.

In vivo cytotoxic potential of the grapheme oxide (GO) on Drosophila melanogaster was tested in the present investigation. Researchers have studied the impact of GO on various model organisms (Wu et al., 2013; Xiaohui et al., 2018; Qiang et al., 2012).

Characterization of Graphene Oxide

A detailed characterization of graphene oxide used in the present study was represented in our previous work Vasanthakumar et al. (2022)

Bioassay

The data on bioassay revealed no significant mortality to larvae whereas in a study by Souza (2018) reported the EC₅₀ value of 1.25mg/L for GO treated against Ceriodaphnia dubia. Similarly, LC₅₀ value of 45.4mg/L was recorded against Daphnia treated with GO. In the present investigation, GO at 300µg/mL was not found lethal to D. melanogaster. Silver nano particle at 20mg/L could able to kill 50% of the D. melanogaster (Panacek et al., 2011) and no pupal formation was noticed. In contrast to the study, the formation of pupa from the control group was declined little i.e., around 7.5% in the pupal formation in the treatment group compared to control (Table 1). Alaraby (2015) recorded reduction in larval growth and flies viability which was almost similar to that of the present study as shown in table 1. Siddique et al, (2013) in their study recorded tissue damage exerted by grapheme copper nanocomposite. Similarly, GO exhibited functional damage to primary and secondary organs in C. elagans (Zhi et al., 2017). Chen, (2014) also have noticed the developmental delay in D. melanogaster treated with Magnetite nanoparticle.

Behavioral Assay: Crawling Assay and Climbing assay

The study recorded the antics of head lifting, turning, and crawling over the sides of the petriplate. The movement exhibited by larvae of control group was 17 while larvae treated with high concentration of GO took around 21 movements (Table 1). Sabat et al. (2016) reported the inactive movement in D. melanogaster treated with TiO2 with 250mg/L concentration while in the present study only reduction in the movement as well as time was noticed. Sabat et al., (2016) reported the decreased crawling potential in D. melanogaster treated with TiO₂.

Climbing Assay:

Climbing assay was performed with adult D. melanogaster emerged from the larvae treated with and without GO (Table 1). The control flies were endowed with rapid movement compared to the treated flies. Sabat et al. (2016) reported the decreased crawling potential in D. melanogaster treated with TiO2. Liu et al. (2009) noticed the locomotor impairment in D. melanogaster treated with Fullerene C60 and is similar to that of the present investigation. In hemocyte estimation, it was observed that in treatment group there was gradual increase in the concentration of hemocyte with respect to the concentration of GO. A similar condition was noticed and recorded by Carmona et al. (2015) in D. melanogaster treated with TiO₂. The protein from the D. melanogaster adult flies in control and treated group was found that the treated fly groups had higher protein concentration compared to control group. It was relatively attributed to the up-regulation of protein due to the treatment with GO. A similar up-regulation in heat shock protein was noticed by Ahmed et al. (2010), Vecchio et al. (2012) and Alaraby et al. (2015).

Table 1. Performance of Drosophila melanogaster (larvae and Adult) treated with and without GO (Control)

Values are mean and in percentage with Standard Deviation in bracket; *Significant at 0.05 (One-Way ANOVA); n=No. of larvae/adult per treatment.

Tests		(n)	Control (SD)	GO Treated (µl/mL) (SD)			ANOVA
Tests		(n)	Control (SD)	50	150	300	ANOVA
Developmental Studies	Pupa Formation	5	80 (28.28)%	80(16.32)%	75(30)%	72.5(28.28)%	p=0.972>0.05
	Adult Formation	3	50(10)%	30(10)%	35(25)%	40(20)%	p=0.933>0.05
Movement Studies	Crawling Performance (Sec)	5	15.04	26.3	50.6	29.6
	Crawling Performance (No. of Movement-Larvae)	5	17	18	21	17
	Flight Performance (Adult)	7	38.09(0.74)%	72.22(0.98)%			p=0.952>0.05
	Flight Performance (Adult) (Sec)	7	10.99(1.9)%	14.45(2.6)%*			p=0.040<0.05

Expression of AchE and Gstd1

The flies emerged from with and without graphene oxide treatment were analysed for the expression of Glutathione S transferase D 1 (Gstd1) (Figure 1) and Acetylcholine Esterase (AchE) (Figure 2) gene.

Similar to the present study, CuO recorded the Gstd1 expression in D. melanogaster. Sykiotis and Bohmann (2008) found the induction of Gstd1 expression in D. melanogaster treated with cap-n-collar isoform C. Gstd1 is a promising indicator of the oxidative stress.

AchE gene expression in the treated flies found higher compared to the control group (Figure 3). A similar study was done by Senger et al. (2011) who treated Danio rerio and recorded increased AchE that was associated with decreased locomotor activity which was also noticed in the present study. In contrast to the present study, D. melanogaster treated with carbon black shows AchE inhibition and was upto 34% (Mesaric et al., 2013). The expression of Gstd1 and AchE are the indicators of the impact of the GO on the D. melanogaster. The expression level of Gstd1 portrays the lesser oxidative stress induction. So the expression of Gstd1 and AchE gene level indicates the internalized oxidative stress and its associated damages to the cells in the internal organ. It may also attribute to the changes in the climbing and other movement changes in the treated group compared to the control.

Gut-microbiome analysis:

GO’s biological interplay has been demonstrated little, but on microbiome of Drosophila melanogaster, the fruitfly, is not yet performed. Since D. melanogaster, is the mirror of 60% of the human disease gene, it is a propitious model used for scaling up the innocuous or maleficent effect of natural, synthetic and beneficial compounds/chemicals etc.

Its entrenched gut microbiome is the codon that readout the message of healthy or disease condition proffered by the any foreign materials/substance. GO diet fed D. melanogaster exhibited aggrandized microbiome compared to control fed with normal diet. The number of reads classified in the control group was 10636 (Figure 3) while in treated group it was 19944 reads. The unclassified reads was found also doubled (12401 reads) in GO treated group compared to control group (6579 reads) (Figure 4).

It was substantiated that an increase in intestinal age portrays increased intestinal microbial load (Ren et al., 2007; Clark et al., 2015; Broderick et al., 2014; Buchon et al., 2009; Guo et al., 2014). In addition to that, vitiated intestinal barrier often increased gut microbiome (Clark et al., 2015). The association of microbiome with genetics and physiology of host was already established (Corby-Harris et al., 2007). Lactobacillaceae, Anaplasmataceae and Enterobacteriaceae have dominated the control while Lactobacillaceae, Ruminococcaceae and Enterobacteriaceae occupied GO diet fed flies. In particular, Lactobacillus plantarum, found reduced drastically (r=13) in GO treated compared to Control (r=23), as per Storelli et al. (2011), an essential and only member for producing ecdysone and insulin in larvae. This lead to impeded larval development and adult metamorphosis rate as well. A great fall in Wolbachia density in GO diet fed flies are also strongly support the developmental delays since it involved in enhanced stem cell proliferation and decrease the programmed cell death. So GO induced changes in the microenvironment of gut on the other hand increased the interesting butyrate producing microbes, Faecalibacterium prausnitzii and Dialister sp. F. prausnitzii is one of the butyrate producing organism in the human colon (Sokol et al., 2008; Louis and Flint, 2009; Duncan et al., 2002) and savior of colon from cancer and inflammation (Gibson and Roberfroid, 1995; Miquel et al., 2014, Jandhyala et al., 2015). Similarly, Dialister sp. is also found depleted under depressed condition (Valles-Colomer et al., 2019). So the increase in F. prausnitzii and Dialister sp. added advantage to the GO diet fed flies to overcome consequences of the encountered intestinal dysfunction. It may be the reason for decrease in progression of the intestinal damages that lead to survival of the larvae and no mortality record at 300µg/mL. Higher Acetobacteraceae, in GO treated flies, are also the reason to survive in the stress induced conditions since Acetobacteraceae are essential for the higher sugar intake and also a signaling molecule that changes insulin signaling and involved in regulation of lipid storage (Shin et al., 2011). So it was concluded that GO which was used mainly for the drug delivery tool or carrier are not lethal at the 300µg/mL. It also confirms the dysfunction of intestinal barrier that could potentially increase the microbial load and the dysfunction was in association with decreased stem cell proliferating member of bacteria, Wolbachia, while F. prausnitzii and Dialister sp. boosting the larvae and stabilizes it. Since very little quantity of carrier molecules were used for the drug delivery studies and it also used for targeted drug delivery, it may cause the cellular damage when bioaccumulation and non-specific binding occur.

So it was concluded that GO which was used mainly for the drug delivery tool or carrier are not lethal at the 300µg/mL. Instead it can able to induce oxidative stress and changes in the regulation of gene attributed to the oxidative stress and loco motor behavior. It also confirms the dysfunction of intestinal barrier that could potentially increase the microbial load and the dysfunction was in association with decreased stem cell proliferating member of bacteria, Wolbachia. Since very little quantity of carrier molecules were used for the drug delivery studies and it also used for targeted drug delivery, it may cause the cellular damage when bioaccumulation and non-specific binding occur.

Acknowledgement:

Authors thank the authorities for necessary permission to conduct the work

Funding Detail:

This work was not funded by any funding agency.

Availability of data and materials

All data of this study given in this article is available upon request.

Ethical Approval and Consent to Participate

Not applicable

Conflict of Interest:

Authors have no conflict of Interest

Consent to Publish

Not applicable

Authors Contribution

Dr. Arumugam Vijaya Anand and Dr. Puthamohan Vinayaga Moorthi: Conceptualization, Methodology, Supervision, Manuscript Writing and Editing: Ajith, Preethi, Ilakkiyapavai, Kavipriya and Vasanthakumar, Dr. P. Kamalakkannan: Visualization, Investigation, Validation and Writing - Draft preparation.

Adair KL, Wilson M, Bost A and Douglas AE. 2018. Microbial community assembly in wild populations of the fruit fly Drosophila melanogaster. ISME J, 12: 959-972.
Ahamed M, Posgai R, Gorey TJ, Nielsen M, Hussain SM and Rowe JJ. 2010. Silver nanoparticles induced heat shock protein 70, oxidative stress and apoptosis in Drosophila melanogaster. Toxicology and Applied Pharmacology. 242; 263–269.
Alaraby M, Hernández A, Annangi B, Demir E, Bach J, Rubio L, et al. 2015. Antioxidant and antigenotoxic properties of CeO₂ NPs and cerium sulphate: Studies with Drosophila melanogaster as a promising in vivo model. Nanotoxicology, 9(6):749-59.
Bost A, Franzenburg S, Adair KL, Martinson VG, Loeb G, Douglas AE. 2017. How gut transcriptional function of Drosophila melanogaster varies with the presence and composition of the gut microbiota. Mol. Ecol, 27(8): 1848-1859.
Broderick NA, Buchon N, Lemaitre B. 2014. Microbiota-induced changes in Drosophila melanogaster host gene expression and gut morphology. MBio 5: 01117–14.
Buchon N, Broderick NA, Chakrabarti S, Lemaitre, B. 2009. Invasive and indigenous microbiota impact intestinal stem cell activity through multiple pathways in Drosophila. Genes Dev 23: 2333–2344.
Carmona ER, Escobar B, Vales G and Marco R. 2015. Genotoxic testing of titanium dioxide anatase nanoparticles using the wing-spot test and the comet assay in Drosophila. Mutation Research. 778: 12-29.
Chandler JA, Lang JM, Bhatnagar S, Eisen JA and Kopp A. 2011. Bacterial communities of diverse Drosophila species: ecological context of a host-microbe model system. PLoS Genet 7: e1002272.
Chaplinska M, Gerritsma S, Dini-Andreote F, Salles JF, Wertheim B. 2016. Bacterial Communities Differ among Drosophila melanogaster Populations and Affect Host Resistance against Parasitoids. PLOS ONE : 1-21.
Chiu N F, Huang T Y and Lai H C. 2013. Graphene oxide based surface Plasmon resonance biosensors, in: M. Aliofkhazraei (Ed.). Advances in Graphene Science. InTech, Rijeka. 8.
Clark, R. I. et al. 2015. Distinct Shifts in Microbiota Composition during Drosophila Aging Impair Intestinal Function and Drive Mortality. Cell Rep 12: 1656–1667.
Corby-Harris V et al. 2007. Geographical distribution and diversity of bacteria associated with natural populations of Drosophila melanogaster. Appl. Environ. Microbiol. 73: 3470–3479.
Dziewiecka M, Karpeta-Kaczmarek J, Augustyniak M, Majchrzycki L and Augustyniak-Jablokow M.A. 2016. Evaluation of in vivo graphene oxide toxicity for Acheta domesticus inrelation to nanomaterial purity and time passed from the exposure. Journal of Hazardous Materials. 305: 30–40.
Fast EM, Toomey ME, Panaram K, Desjardins D, Kolaczyk ED, Frydman HM. 2011. Wolbachia enhance Drosophila stem cell proliferation and target the germline stem cell niche. Science. 334: 990-992.
Feng L and Liu Z. 2011. Graphene in biomedicine: opportunities and challenges. 6(2):317-24.
Gao. 2015. The chemistry of graphene oxide, in: W. Gao (Ed.), Graphene Oxide: Reduction Recipes, Spectroscopy, and Applications. Cham. : 61–95.
Goenka S, Sant V and Sant S. 2014. Graphene-based nanomaterials for drug delivery and tissue engineering. J. Control. Release. 173: 75–88.
Guo L, Karpac J, Tran SL and Jasper H. 2014. PGRP-SC2 Promotes Gut Immune Homeostasis to Limit Commensal Dysbiosis and Extend Lifespan. Cell 156: 109–122.
Hummers WS. 1958. Offeman, R. E. Preparation of graphitic oxide. J Am Chem Soc 80: 1339-1339.
Karim K, Mehdi D E and Ali. E. 2019. Graphene surfaces: particles and catalysts. Interface and Technology. 29: 1–445.
Kusuma J, Balakrishna G R, Patil S, Jyothi M S and Chandan H R et al.. 2018. Exploration of graphene oxide nanoribbons as excellent electron conducting network for third generation solar cells. Sol. Energ. Mat. Sol. C. 183: 211–219.
Liu X, Vinson D, Dawn A B T, Robert H. Hurt, and David M. Rand. 2009. Differential Toxicity of Carbon Nanomaterials in Drosophila: Larval Dietary Uptake Is Benign, but Adult Exposure Causes Locomotor Impairment and Mortality. Environ. Sci. Technol.43: 6357–6363.
Manjila, S. B., Kuruvilla, M., Ferveur, J. F., Sane, S. P. and Hasan, G. 2018. Extended flight bouts require disinhibition from GABAergic mushroom body neurons. Curr Biol. PubMed ID: 30612904.
Mesaric T, Baweja L, Drasler B, Drobne D and Makovec D et al. 2013. Effects of surface curvature and surface characteristics of carbon-based nanomaterials on the adsorption and activity of acetylcholinesterase. Carbon. 62: 222-232.
Panacek A, Prucek R, Safarova D, Dittrich M, Richtrova J, Benickova K, Zboril R, Kvitek L.2011. Acute and Chronic Toxicity Effects of Silver Nanoparticles (NPs) on Drosophila melanogaster. Environ. Sci. Technol. 45: 4974–4979.
Pompa P P, Vecchio G, Galeone A, Brunetti V and Sabella S et al. 2011. In Vivo Toxicity Assessment of Gold Nanoparticles in Drosophila Melanogaster. Nano Res. 4(4): 405–413.
Chen L, Hu PP, Zhang L, Huang SH, Luo LF and Huang CZ. 2012. Toxicity of graphene oxide and multi-walled carbon nano tubes against human cells and Zebrafish. Sci China Chem. 55(10): 2209-2216.
Ren C, Webster P, Finkel SE and Tower J. 2007. Increased internal and external bacterial load during Drosophila aging without life-span trade-off. Cell Metab 6: 144–152.
Sabat D, Patnaik A, Ekka B, Dash P and Mishra M. 2016. Investigation of titania nanoparticles on behaviour and mechanosensoryorgan of Drosophila melanogaster. Physiology and Behavior. 167: 76–85.
Senger MR., Seibt KJ., Ghisleni GC., Dias RD., Bogo M.R., and Bonan C.D. 2011. Aluminum exposure alters behavioral parameters and increases acetylcholinesterase activity in Zebrafish (Danio rerio) brain. Cell Biol Toxicol., 27:199–205
Shin SC, Kim SH, You H, Kim B, Kim AC, Lee KA, Yoon JH, Ryu JH, Lee WJ. 2011. Drosophila microbiome modulates host developmental and metabolic homeostasis via insulin signaling. Science 334: 670–674.
Siddique YH, Fatima A, Jyoti S, Naz F and Rahul et al. 2013. Evaluation of the Toxic Potential of Graphene Copper Nanocomposite (GCNC) in the Third Instar Larvae of Transgenic Drosophila melanogaster (hsp70-lacZ)Bg9. PLoS ONE. 8(12): e80944.
Storelli G, Defaye A, Erkosar B, Hols P, Royet J, Leulier F. 2011. Lactobacillus plantarum promotes Drosophila systemic growth by modulating hormonal signals through TOR-dependent nutrient sensing. Cell Metab. 14(3): 403-414.
Sykiotis GP, Bohmann D. 2008. Keap1/Nrf2 signaling regulates oxidative stress tolerance and lifespan in Drosophila.Dev Cell. 14: 76–85.
Tian J, Wu S, Yin X and Wu W. 2019. Novel preparation of hydrophilic graphene/ graphene oxide nanosheets for supercapacitor electrode. Applied Surface Science. 496: 143696.
Vecchio G, Galeone A, Brunetti V, Maiorano G, Sabella S, Cingolani R, Pompa PP. 2012. Concentration-Dependent, Size-Independent Toxicity of Citrate Capped AuNPs in Drosophila melanogaster. PLoS ONE. 7(1): e29980.
Wang Y, Wang H, Liu D, Song S and Wang X et al., 2013. Graphene oxide covalently grafted up conversion nanoparticles for combined NIR mediated imaging and photothermal/photodynamic cancer therapy. Biomaterials. 34: 7715–7724.
Wu S Y, An SSA and Hulme J. 2015. Current applications of graphene oxide in nanomedicine, Int. J. Nanomedicine. 10: 9–24.
Lv X, Yang Y, Tao Y, Jiang Y, Chen B, Zhu X, Cai Z, Li B. 2018. A mechanism study on toxicity of graphene oxide to Daphnia magna: Direct link between bioaccumulation and oxidative stress. Environ Pollut.234: 953-959.
Yang K, Zhang S, Zhang G, Sun X and Lee S T. et al., 2010. Graphene in Mice: Ultrahigh In vivo Tumor Uptake and Efficient Photothermal Therapy. Nano Lett. 10: 3318–3323.
Zhi L, Qu M, Ren M, Zhao L, Li, Y. Wang D. 2017. Graphene oxide induces canonical Wnt/b-catenin signaling-dependent toxicity in Caenorhabditis elegans. Carbon. 113: 122-131.

No competing interests reported.

Epi2MeLink.docx

PDF

Version 1

posted 22 Jul, 2022

You are reading this latest preprint version

Graphene Oxide Induced Oxidative Stress Gene Expression and Gut Microbiome Profiling in in Vivo Drosophila Melanogaster Model

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results And Discussion

Declarations

References

Competing Interests

Supplementary Files

Status:

Version 1