c-Myc-activated miR-3682-3p aggravates the metastasis and stemness in hepatocellular carcinoma cells by regulating PTEN/PI3K/AKT signaling

doi:10.21203/rs.3.rs-1856521/v1

Download PDF

Research Article

c-Myc-activated miR-3682-3p aggravates the metastasis and stemness in hepatocellular carcinoma cells by regulating PTEN/PI3K/AKT signaling

https://doi.org/10.21203/rs.3.rs-1856521/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Objective: To elusive the underlying mechanism and functions of miR-3682-3p in hepatocellular carcinoma (HCC).

Methods: Thirty pairs of tumor tissues and adjacent tissues were obtained from HCC patients. mRNA and protein expressions were detected by quantitative real-time PCR and western blot, respectively. The migration and invasion were measured using transwell or wound healing assays. Dual luciferase and ChIP assays were utilized to detect gene interactions.

Results: miR-3682-3p was highly expressed in HCC tissues and cell lines. Silencing of miR-3682-3p prevented cell migration and invasion, and induced the enhancement of E-cadherin expression and the decreased levels of N-cadherin, Vimentin and Snail as well as expressions of SOX2, OCT4 and Bmi1, restraining metastasis and stemness of HCC in vitro. Mechanistically, miR-3682-3p was positively activated by c-Myc, and could directly target PTEN to activate PI3K/AKT pathway. In addition, inhibition of PTEN weakened the anti-metastatic and anti-stemness effects of miR-3682-3p downregulation in HCC cells.

Conclusion: From these findings, we concluded that miR-3682-3p promoted HCC metastasis and stemness through PTEN/PI3K/AKT signaling, implying that miR-3682-3p might be a promising target for HCC clinical treatment.

c-Myc

miR-3682-3p

metastasis

stemness

Hepatocellular carcinoma

Hepatocellular carcinoma (HCC) is one of the most common malignancies and ranks the third leading cause of cancer-related mortality worldwide [1, 2]. Unfortunately, since the lesions in the early stages are always asymptomatic, lots of HCC patients are diagnosed at advanced stages, for which current treatments lack of efficiency, leading to a poor prognosis and high frequency of metastasis and recurrence [3–5]. Although surgical techniques and novel tyrosine kinase inhibitors have partially improved the prognosis of HCC patients, there has been no significant improvement in the recurrence and survival rate of HCC patients. Thus, it is urgent to explore the molecular mechanism of HCC progression, especially for HCC metastasis and recurrence, and develop new strategies for HCC treatments.

Epithelial mesenchymal transition (EMT) is important in early steps of HCC metastasis [6], resulting in invasive and metastatic malignancies, in which cells lose contacts, epithelial cells significantly alter their shape, loss epithelial characteristics and acquire a mesenchymal phenotype [7–10]. Several studies have reported that some transcription factors were involved in EMT, including Slug, Snail and Twist1 [11]. Besides, during EMT, epithelial marker E-cadherin (E-cad) is inhibited and mesenchymal markers, like N-cadherin (N-cad), Vimentin and Fibronectin are promoted [11]. Stemness is essential for cancer recurrence and cells with the expression of hepatic stem/progenitor cell-related markers in HCC cancer stem cells (CSCs), is tightly correlated with the aggressive clinical behaviors [12, 13]. However, the molecular mechanism underlying the EMT and stemness of HCC is still largely unknown.

MicroRNAs (miRNAs) are small RNA molecules with 19–22 nucleotides, and post-transcriptionally silence specific genes to regulate various processes in cancer, such as proliferation, apoptosis, particularly in metastasis and stemness [14–16]. For example, miR-206 was revealed to suppress metastasis and stemness of breast cancer via modulating MKL1/IL11 signaling pathway, implying miR-206-TWF1-MKL1-SRF/IL11 signaling pathway was a potential therapeutic target for breast cancer [14]. Besides, in HCC metastasis and stemness, miRNAs also exhibited important functions. MiR-106b-5p was uncovered to enhance HCC metastasis and stemness via regulating FOG2 [15], and by inhibiting PTEN through PI3K/Akt pathway, miR-106b-5p improved stem cell-like properties of HCC cells [16]. Furthermore, miR-3682-3p was recently discovered highly expressed in colon adenocarcinoma (CA) and promoted CA progression [17]. Surprisingly, predictive data form TCGA database revealed that miR-3682-3p was highly expressed in HCC patients, and closely correlated with shorter overall survival. However, miR-3682-3p is rarely reported in HCC development. In this paper, the design was aimed to demonstrated the underlying mechanism of miR-3682-3p in HCC. By preliminary experiment, we have found that the overexpression of miR-3682-3p was closely regulated by c-Myc, which was reported to play crucial role in HCC stemness and EMT. PTEN was identified as a tumor suppressor that could response to the inactivation of PI3K/AKT pathway[18]. Strikingly, Previous prediction showed a direct targeting relationship between miR-3682-3p and PTEN. Therefore, we speculated that miR-3682-3p may affect HCC progression through the PTEN/PI3K/AKT signaling pathway.

Tissue samples

We collected 30 pairs of HCC and their adjacent normal liver tissues from HCC patients undergoing liver resections at the Hunan Provincial People’s Hospital from June 2017 to August 2019. All of these 30 patients had not received any antitumor therapy before the tissues were collected. This study was approved by the Ethics Committee of Hunan Provincial People’s Hospital (Department of Ethical Review 2018 No. 100) and all the patients were informed and then signed informed consent forms.

Cell culture

The human HCC cell lines (SK-hep1, SNU387, Huh7, HepG2) and normal hepatocytes (THLE-2) were obtained from Cell Bank of China Science Academy (Shanghai, China). THLE-2 cells were cultured in BEGM medium (Gibco, USA), SNU387 cells were growth in RPMI-1640 medium (Gibco) and SK-hep1, Huh7 and HepG2 cells were grown in DEME medium (Gibco). All cells mediums were contained with 10% fetal bovine serum (FBS, HyClone, USA) and 1% penicillin/streptomycin at 37°C in a humidified atmosphere containing 5% CO₂.

Cell transfection

In this experiments, the small interfering RNAs targeting PTEN and c-Myc, miR-3682-3p mimics/inhibitor as well as negative controls (siNC, mimics/ inhibitor NC) were gained from GenePharma (Shanghai, China). For cell transfections, 2×10⁵ cells were planted on six well plates. Upon reaching ~ 70–80% confluence, the RNAs were transfected into cells using the Lipofectamine 2000 reagent (Invitrogen, USA) as the manufacturer’s instruction.

RNA isolation and quantitative real-time PCR (qRT-PCR)

Total RNA was extracted from HCC tissues and cells by using Trizol® reagent (Invitrogen, USA). The concentration of total RNA was detected by microplate absorbance reader (Bio-RAD Model 680). cDNA was synthesized using TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems, USA). Real-time PCR was conducted with the SYBR Premix Ex Tag Kit (TaKaRa, Japan). The relative expression level was calculated by using 2^−∆∆Ct method. β-actin was used as an internal reference, and the U6 gene was identified as a control of miRNA. The primer sequences used in the current experiments were listed as follows: miR-3682-3p (F): 5’- GCCGAGTGATGATACAGGTGG-3’, (RT): 5’- GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTACCT-3’; U6 (F): 5’- GCTTCGGCAGCACATATACTAAAAT-3’, (R): 5’- CGCTTCACGAATTTGCGTGTCAT-3’; c-Myc (F): 5’-GGACTTGTTGCGGAAACGAC-3’, (R): 5’-CTCAGCCAAGGTTGTGAGGT-3’; PTEN (F): 5’- CGACGGGAAGAAGACAAGTTCAT-3’, (R): 5’-aggtttcctctggtcctggt-3’; β-actin (F): 5’-CCCTGGAGAAGAGCTACGAG-3’, (R): 5’-CGTACAGGTCTTTGCGGATG-3’.

Western blot

HCC cells were lysed with RIPA lysis buffer to obtain total proteins. After quantifying by BCA assay (Pierce, USA), the equal proteins were isolated by 10% SDS-PAGE and transferred onto PVDF membranes (Millipore, USA). The membranes were following incubated with 5% nonfat milk and incubated with primary antibodies at 4°C for overnight. Primary antibodies (1:1000) specific to E-cadherin (Cat# 14472), N-cadherin (Cat# 13116), Vimentin (Cat# 5741), Snail (Cat# 3879), SOX2 (Cat# 3579), OCT4 (Cat# 2750), Bmi1 (Cat# 6964), PTEN (Cat# 9188), p-PI3K (Cat# 17366), PI3K (Cat# 4255), p-AKT (Cat# 4060) and AKT (Cat# 4685) were bought from Cell Signaling Technology (Boston, USA). Afterwards, the membranes were washed and incubated with corresponding HRP-conjugated secondary antibodies (1:5000; Sigma-Aldrich) for 1h at room temperature. ECL detection reagent (Amersham Biosciences, Castle Hill, Australia) was employed to visualize the bands. β-actin was as an internal reference. Image J software was used to calculated the band intensity.

Cell Counting kit-8 (CCK-8)

For the CCK8 assay, cells were seeded into 96-well plates and normally cultured overnight, following the treatment of serial concentrations of agents for 48 hours. CCK8 (20 mL) solution was added into each well in a dark environment and then cells were cultured in a 5% CO₂ humidified incubator at 37℃. The absorbance at 450 nm was measured using a Multiskan Spectrum (Thermo Electron Corporation) until the absorbance values remained unchanged.

Cell migration and invasion assay

Transwell assay was taken to detect the migration and invasion of HCC cells. About 2×10⁵ cells cultured in 200 µL medium without FBS were seeded into the upper chamber of Transwell plate (24-well, 8 µm pore size, Millipore, USA). 600µL medium with 10% FBS were used to fulfill lower chamber. As for invasion assay, upper chambers were pre-coated with 8µL Matrigel (BD Biosciences, USA). The equal amounts of cells were seeded into the upper chamber and following were performed as above described. After 24 hours, cells on the lower chamber were fixed by 4% paraformaldehyde and we stained the cells with methylene blue. Cells were photographed and the total numbers of stained cells were quantified by counting with an inverted light microscope (Olympus, Long Island, NY).

Wound-healing assay

HCC cells were planted in 24-well plates in complete culture medium. After the cells grew to confluence, they were serum starved for 12 hours. Then HCC cells were wounded by scratching with a sterilized 200 mL pipette tip and medium was changed to fresh complete culture medium. After 12 hours, cells were photographed with a LEICA DMI 4000B microscope (Leica, Germany).

Luciferase reporting experiment

The mutation type 3'untranslated region (UTR) of PTEN and miR-3682-3p genes were made by the QuikChange SiteDirected Mutagenesis kit (Agilent Technologies; USA). The wild-type or mutant (MUT) 3'UTR were cloned into psiCHECK™2 vector (Promega Corporation). Huh7 cells were planted in 96-well plates at 5×10³ cells per well. Cells of several wells were subsequently co-transfected with wild-type or MUT plasmids (200 ng) miR-3682-3p 3’-UTR vectors and c-Myc mimic or NC mimic employing Lipofectamine® 2000 (Invitrogen; USA) at 37˚C for 48 hours. Some cells were co-transfected with wild-type or MUT plasmids (200 ng) PTEN 3’-UTR vectors and miR-3682-3p mimics or mimics NC. The firefly luciferase activity of HCC cells was evaluated by luciferase assay system (Promega Corporation), comparing with renilla luciferase activity.

The sequence of miR-3682-3p transcription promoter was gained from NCBI (https://www.ncbi.nlm.nih.gov/gene). The putative c-Myc and miR-3682-3p binding regions were analyzed by Jaspar database (http://jaspar.genereg.net/). To validate the targeting relationship, the sequences containing binding regions were cloned into psiCHECK™2 vector, and co-transfected into HCC cells with si-c-Myc or si-NC. After 48 h, the firefly luciferase activity of HCC cells was evaluated by luciferase assay system.

Chromatin immunoprecipitation assay(ChIP)

ChIP assay was conducted with an EZ ChlP Kit (Abcam, Cambridge, MA, USA, Cat. No. ab500) based on the protocol. In short, 5×10⁶ cells were cross-linked with 1% formaldehyde for 15 minutes. Cross-linked chromatin was sonicated and then incubated using anti-IgG, anti-c-Myc (CST, Cat# 9402). The immunoprecipitated DNA was purified and quantified by qRT-PCR.

Statistical analysis

GraphPad Prism 7 (GraphPad Software, Inc.) was employed to analysis data. The data was presented as mean ± standard deviation (SD) from three independent tests. Significant differences between groups were conducted by Student’s t-test or one-way ANOVA followed by Tukey’s post hoc test for multiple comparisons. It was identified as a statistically significant difference when P < 0.05. All experiments were repeated more than 3 times.

miR-3682-3p was highly expressed in HCC

By TCGA database predictions, miR-3682-3p was found to be upregulated in HCC patients. To confirm this finding, we conducted qRT-PCR assay to assess the expression of miR-3682-3p in tumor and normal tissues form 30 pairs of HCC patients, respectively. As shown in Fig. 1A, miR-3682-3p was highly expressed in HCC cancer tissues compare with normal tissues. Subsequently, we also observed that miR-3682-3p was upregulated in HepG2, Huh7, SNU387 and SK-hep1 compared to THLE-2 cells (Fig. 1B), especially in Huh7 and SK-hep1 cells.

Knockdown of miR-3682-3p ameliorated the metastasis and stemness in HCC cells

Since metastasis and stemness are highly associated with the malignancy of cancer, we wanted to study the effect of miR-3682-3p on HCC metastasis and stemness. Figure 2A firstly revealed that miR-3682-3p inhibitor remarkably downregulated miR-3682-3p expression in Huh7 and SK-hep1 cells. CCK-8 analysis showed that inhibition of miR-3682-3p led to a significant decrease of cell viability in Huh7 and SK-Hep1 cells (Fig. 2B). Following detections discovered that inhibition of miR-3682-3p strikingly inhibited the migratory and invade cell numbers and migratory distances (Fig. 2C-F). Since EMT is an important regulator in early steps of metastasis, we further examined the protein expressions of EMT markers in HCC cells. As shown in Fig. 2G-H, the expression of epithelial marker E-cad was significantly enhanced and the expressions of mesenchymal marker N-cad, Vimentin and EMT associated downstream transcription factor Snail were hugely downregulated after transfection with miR-3682-3p inhibitor. Next, the effect of miR-3682-3p on stemness related markers were quantified. As shown in Fig. 2I-J, downregulation of miR-3682-3p induced a sharp decline of the expression of SOX2, OCT4 and Bmil compared to inhibitor NC group. In conclusion, the above data demonstrated that repression of miR-3682-3p reduced tumor metastasis and stemness in vitro.

miR-3682-3p was positively regulated by c-Myc

To explore the mechanism underlying the metastasis and stemness triggered by miR-3682-3p, we are firstly doubted about the upstream of miR-3682-3p. A lot of literatures uncovered that c-Myc could manipulate miRNAs in both metastasis and stemness of cancer [19]. Meanwhile, data from Jaspar software revealed a high binding potential site between MIR3682 and c-Myc (Fig. 3A). Thus, we subsequently studied the relationship between miR-3682-3p and c-Myc in HCC. As shown in Fig. 3B, miR-3682-3p was significantly highly expressed in the complex of specific antibody targeting c-Myc compared to IgG group. Then, we introduced c-Myc siRNA into Huh7 and SK-Hep1 cells, respectively. qRT-PCR and western blot assays disclosed that si-c-Myc transfection dramatically downregulated the expression of c-Myc (Fig. 3C-3E). Doul luciferase assay further verified that knockdown of c-Myc markedly reduced the luciferase activity of Huh7 and SK-hep1 cells expressed miR-3682 promoter sequences (Fig. 3F). In addition, miR-3682-3p was significantly decreased after c-Myc silence (Fig. 3G). Meanwhile, it was observed that c-Myc was overexpressed in HCC tissues (Fig. 3H), and showed a positive correlation with miR-3682-3p (Fig. 3I). Consequently, these results implied that miR-3682-3p was positively regulated by c-Myc.

miR-3682-3p directly targeted PTEN and restrained its expression

To further gain insight into the mechanism, we were prompted to investigate the downstream of miR-3682-3p and how to modulate metastasis and stemness in HCC. As expected, we found a potential binding site in miR-3682-3p and PTEN using bioinformatics methods (Fig. 4A). Given that PTEN was implicated to be targeted by miRNA and then promote HCC stemness maintenance and metastasis [15], We hypothesized that miR-3682-3p might facilitate HCC metastasis and stemness by targeting PTEN. To address the predicted results, we transfected Huh7 cells with PTEN-wt gene or PTEN-mut luciferase vector with or without miR-3682-3p mimics. Dual reporter assay revealed that miR-3682-3p mimics decreased luciferase activity in PTEN-wt group, but not effect in PTEN-mut group (Fig. 4B). Furthermore, the result of qRT-PCR assay indicated that miR-3682-3p inhibitor induced a sharp elevation of PTEN mRNA expression, while overexpression of miR-3682-3p contributed to lower PTEN expression (Fig. 4C). Similar results were observed in western blot assay (Fig. 4D-4E). To extend our observation in clinical research, we detected the mRNA expression of PTEN in HCC tissues. As shown in Fig. 4F-4G, PTEN was lowly expressed in HCC tissues and was negatively correlated with miR-3682-3p expression. In conclude, we revealed that miR-3682-3p directly targeted PTEN and restrained its expression.

c-Myc/miR-3682-3p activated PI3K/AKT pathway by suppressing PTEN

Based on previous findings, we firstly asked whether c-Myc controlled PTEN expression. As show in Fig. 5A, a negative association was observed in c-Myc and PTEN expression in clinical HCC tissues. Importantly, qRT-PCR assay showed that knockdown of c-Myc elevated the expression of PTEN, while this effect was restrained by co-transfection of miR-3682-3p mimics (Fig. 5B). Moreover, we assessed the effects of miR-3682-3p on PTEN mediated PI3K/AKT pathway. As displayed in Fig. 5C-5D, miR-3682-3p inhibitor suppressed the phosphorylation of PI3K, AKT, which then rescued by PTEN knockdown. These findings revealed that c-Myc/miR-3682-3p could regulated PTEN/ PI3K/AKT pathway in HCC.

PTEN/PI3K/AKT signaling was involved in the regulation of miR-3682-3p on the metastasis and stemness in HCC

To further explore whether miR-3682-3p enhanced HCC metastasis and stemness via PTEN-PI3K/AKT pathway, we treated cells which miR-3682-3p inhibitor with or without PTEN siRNA. Firstly, CCK-8 assay showed that knockdown of PTEN remarkably reversed the inhibitory effect on cell viability caused by miR-3682-3p inhibitor (Fig. 6A). Transwell assay found that miR-3682-3p inhibitor dramatically restrained migration and invasion of HCC cells, whereas these effects were all rescued by PTEN knockdown (Fig. 6B-6E). In line with the results of transwell assay, the results of western blot further illustrated that E-cad expression was significantly elevated and the protein expression of N-cad, Vimentin and Snail were sharply refrained by miR-3682-3p inhibition, which were then reversed by PTEN silence (Fig. 6F-6G). Similarly, Fig. 6H-6I showed that inhibition of PTEN remarkably stimulated the expression of SOX2, OCT4 and Bmi1, partly reversing the inhibitory effects of miR-3682-3p inhibitor. In summary, these findings suggested that miR-3682-3p targeted PTEN/PI3K/AKT signaling to promote metastasis and stemness in HCC.

EMT is a complex progression, which is a crucial progression for the alteration of early-stage tumors to metastatic cancers [20–22]. During EMT, several transcription factors as Slug, Snail were promoted, resulting the decline of epithelial markers, as E-cad, and the elevation of mesenchymal markers, like Fibronectin, N-cad and Vimentin. Mounts of evidence confirmed the crucial role of EMT in HCC progression, and attempted to explore new strategies to target HCC EMT [23, 24]. In addition, cancer stem cells have the ability of tumorigenicity, self-renewal, metastasis and chemotherapeutic drug resistance, are widely believed to drive HCC progression [25]. Some proteins, including SOX2, OCT4 and Bmi1 have been identified as liver CSC markers. In this paper, we are the first to find that inhibition of miR-3682-3p restrained cell migration, invasion, EMT and stem cell phenotypes in HCC.

c-Myc is one of the most popular oncogene in various cancers [26, 27], also in HCC [28]. Amounts of reports demonstrated c-Myc could modulate the expression of miRNA to mediate the tumor development [29–32]. For example, Elektra et al. reported that through regulation of c-Myc/miR-146a-5p axis, KDM2B participated in cervical cancer [29]. Besides, the Cdk2-c-Myc-miR-571 axis was showed to regulate DNA replication and genomic stability in cancers [30]. In addition, PLGF promoted EMT and tumor sphere formation through upregulated c-Myc, subsequently induced miR-19a activated in gallbladder cancer [31]. Furthermore, miR-17-5p was reported to inhibit invasion and metastasis of HCC cells through c-Myc, and meanwhile, miR-17-5p was enhanced by c-Myc role as a transcription factor, suggesting c-Myc/miR-17-5p feedback loop could modulate HCC metastasis and invasion [32]. In this study, we also revealed that c-Myc was overexpressed in HCC patients, and expressed with a positively correlation with miR-3682-3p. In additon, knockdown of c-Myc drastically inhibited the expression of miR-3682-3p HCC cells. From these observations, we concluded that c-Myc was a driven gene in HCC.

miRNA was widely reported to participate in cancer developments, including proliferation, apoptosis, metastasis and stemness, etc [14, 16, 33]. miR-206 was indicated to inhibit metastasis and stemness of breast cancer by regulating MKL1/IL11 pathway [14]. miR-122 was the most common miRNA in the liver, and regarded as an important regulator in liver disease [33]. Furthermore, miR-106b-5p was recently reported that it highly expressed in HCC and promoted HCC metastasis and stemness by regulating PTEN through PI3K/AKT signaling pathway [16]. miR-3682-3p was a novel miRNA in cancer development and a few papers reported the function of miR-3682-3p in HCC. Dong et al. found miR-3682-3p inhibited angiogenesis by targeting ANGPT1 via the RAS-MEK1/2-ERK1/2 Pathway in HCC [34]. Yao et al. reveled miR-3682-3p was involved in high-expression-related poor prognosis in HCC tissues and cell lines [35]. Strikingly, our data demonstrated that miR-3682-3p was highly expressed in HCC and promoted metastasis and stemness in vitro, which further highlighted the oncogenic role of miR-3682-3p in HCC.

PTEN is located at 10q23.3, and its transcription product is a membrane-bound lipid phosphatase, which acts as a tumor suppressor and down-regulates PIP3 expression in a variety of systems, playing an important role in the regulation of embryonic development, cell growth, differentiation, apoptosis and migration. PTEN was reported to be targeted by miRNAs and then promote HCC stemness maintenance and metastasis. For example, Zhou et al. found HCC cells secreted exosomal miR-21 that directly targeted PTEN, leading to activation of PDK1/AKT signaling in hepatic stellate cells [36]. Besides, high-metastatic cancer cells derived exosomal miR-92a-3p promoted EMT and metastasis of low-metastatic cancer cells by regulating PTEN/Akt pathway in HCC [37]. Likewise, PTEN play as a key regulator factor of PI3K/AKT signaling, and its activation could enhance tumor stemness [38]. As kim et al’s reported, PTEN-loss activated AKT signaling, thus promoting cancer stemness of prostate cancer [39]. In this paper, our data illustrated that PTEN was a negative target of miR-3682-3p. Importantly, miR-3682-3p activated PI3K/AKT pathway by inhibiting PTEN, resulting in the metastasis and stemness of HCC.

Taken together, this paper demonstrated miR-3682-3p was facilitated by c-Myc to promote metastasis and stemness in HCC via suppression of PTEN and subsequently activation of PI3K/AKT signaling, suggesting targeting miR-3682-3p as a novel strategy for metastatic and recurrent HCC therapy.

CA, Colon adenocarcinoma

CSCs, Cancer stem cells

E-cad, E-cadherin

EMT, Epithelial mesenchymal transition

FBS, Fetal bovine serum

HCC, Hepatocellular carcinoma

miRNAs, MicroRNAs

N-cad, N-cadherin

qRT-PCR, Quantitative real-time PCR

Funding

This work was supported by Scientific Research Plan of Hunan Provincial Health Commission (B2019056) and Natural Science Foundation of Hunan Province (2017JJ2164).

Conflict

There is no conflict of interest to report.

Ethics approval and consent to participate

This study was approved by the Ethics Committee of Hunan Provincial People’s Hospital (Department of Ethical Review 2018 No. 100) and all the patients were informed and then signed informed consent forms.

Availability of data and material

All data generated or analyzed during this study are included in this article. The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

guarantor of integrity of the entire study：Yu Zhang

study concepts：Hua Cai, Ming-Hao Wu

study design：Dan-Hua Zhu, Xiang-Yang Wang

definition of intellectual content：Zhi-Yuan Chen, Li Yang

literature research：Peng Liu, Zhan Liu

clinical studies：Yu Zhang, Hua Cai, Ming-Hao Wu

experimental studies：Dan-Hua Zhu, Xiang-Yang Wang, Zhi-Yuan Chen

data acquisition： Li Yang, Peng Liu, Zhan Liu

data analysis：Yu Zhang, Dan-Hua Zhu

statistical analysis：Hua Cai, Xiang-Yang Wang

manuscript preparation：Peng Liu, Zhan Liu

manuscript editing：Yu Zhang

manuscript review：Zhan Liu, Peng Liu,

Zhu, H., et al., Multikinase Inhibitor CT-707 Targets Liver Cancer by Interrupting the Hypoxia-Activated IGF-1R-YAP Axis. Cancer Res, 2018. 78(14): p. 3995-4006.
Cancer Genome Atlas Research Network. Electronic address, w.b.e. and N. Cancer Genome Atlas Research, Comprehensive and Integrative Genomic Characterization of Hepatocellular Carcinoma. Cell, 2017. 169(7): p. 1327-1341 e23.
Maluccio, M. and A. Covey, Recent progress in understanding, diagnosing, and treating hepatocellular carcinoma. CA Cancer J Clin, 2012. 62(6): p. 394-9.
Dou, C., et al., SHMT1 inhibits the metastasis of HCC by repressing NOX1-mediated ROS production. J Exp Clin Cancer Res, 2019. 38(1): p. 70.
Fang, T., et al., Tumor-derived exosomal miR-1247-3p induces cancer-associated fibroblast activation to foster lung metastasis of liver cancer. Nat Commun, 2018. 9(1): p. 191.
Yuan, J.H., et al., A long noncoding RNA activated by TGF-beta promotes the invasion-metastasis cascade in hepatocellular carcinoma. Cancer Cell, 2014. 25(5): p. 666-81.
Meng, J., et al., Twist1 Regulates Vimentin through Cul2 Circular RNA to Promote EMT in Hepatocellular Carcinoma. Cancer Res, 2018. 78(15): p. 4150-4162.
Chen, Y., et al., MDM2 promotes epithelial-mesenchymal transition and metastasis of ovarian cancer SKOV3 cells. Br J Cancer, 2017. 117(8): p. 1192-1201.
Zhang, G. and G. Zhang, Upregulation of FoxP4 in HCC promotes migration and invasion through regulation of EMT. Oncol Lett, 2019. 17(4): p. 3944-3951.
Yang, Y., et al., Connexin 32 downregulation is critical for chemoresistance in oxaliplatin-resistant HCC cells associated with EMT. Cancer Manag Res, 2019. 11: p. 5133-5146.
Lamouille, S., J. Xu, and R. Derynck, Molecular mechanisms of epithelial-mesenchymal transition. Nat Rev Mol Cell Biol, 2014. 15(3): p. 178-96.
Shao, X.J., et al., Inhibition of M2-like macrophages by all-trans retinoic acid prevents cancer initiation and stemness in osteosarcoma cells. Acta Pharmacol Sin, 2019. 40(10): p. 1343-1350.
Chaudhary, K., et al., Deep Learning-Based Multi-Omics Integration Robustly Predicts Survival in Liver Cancer. Clin Cancer Res, 2018. 24(6): p. 1248-1259.
Samaeekia, R., et al., miR-206 Inhibits Stemness and Metastasis of Breast Cancer by Targeting MKL1/IL11 Pathway. Clin Cancer Res, 2017. 23(4): p. 1091-1103.
Yu, L.X., et al., MicroRNA-106b-5p promotes hepatocellular carcinoma development via modulating FOG2. Onco Targets Ther, 2019. 12: p. 5639-5647.
Shi, D.M., et al., miR-106b-5p promotes stem cell-like properties of hepatocellular carcinoma cells by targeting PTEN via PI3K/Akt pathway. Onco Targets Ther, 2018. 11: p. 571-585.
Rong, Z., et al., Development of a Novel Six-miRNA-Based Model to Predict Overall Survival Among Colon Adenocarcinoma Patients. Front Oncol, 2020. 10: p. 26.
Papa, A. and P.P. Pandolfi, The PTEN(-)PI3K Axis in Cancer. Biomolecules, 2019. 9(4).
Quan, H., et al., LncRNA-AK131850 Sponges MiR-93-5p in Newborn and Mature Osteoclasts to Enhance the Secretion of Vascular Endothelial Growth Factor a Promoting Vasculogenesis of Endothelial Progenitor Cells. Cell Physiol Biochem, 2018. 46(1): p. 401-417.
Saitoh, M., Involvement of partial EMT in cancer progression. J Biochem, 2018. 164(4): p. 257-264.
Du, B. and J.S. Shim, Targeting Epithelial-Mesenchymal Transition (EMT) to Overcome Drug Resistance in Cancer. Molecules, 2016. 21(7).
De Craene, B. and G. Berx, Regulatory networks defining EMT during cancer initiation and progression. Nat Rev Cancer, 2013. 13(2): p. 97-110.
Giannelli, G., et al., Role of epithelial to mesenchymal transition in hepatocellular carcinoma. J Hepatol, 2016. 65(4): p. 798-808.
Li, Z., et al., Individualized precision treatment: Targeting TAM in HCC. Cancer Lett, 2019. 458: p. 86-91.
Ling, S., et al., USP22 promotes hypoxia-induced hepatocellular carcinoma stemness by a HIF1alpha/USP22 positive feedback loop upon TP53 inactivation. Gut, 2020. 69(7): p. 1322-1334.
Dang, C.V., MYC on the path to cancer. Cell, 2012. 149(1): p. 22-35.
Hsu, T.Y., et al., The spliceosome is a therapeutic vulnerability in MYC-driven cancer. Nature, 2015. 525(7569): p. 384-8.
Xu, Z., et al., The mTORC2-Akt1 Cascade Is Crucial for c-Myc to Promote Hepatocarcinogenesis in Mice and Humans. Hepatology, 2019. 70(5): p. 1600-1613.
Peta, E., et al., HPV16 E6 and E7 upregulate the histone lysine demethylase KDM2B through the c-MYC/miR-146a-5p axys. Oncogene, 2018. 37(12): p. 1654-1668.
Zhang, Y., et al., The Cdk2-c-Myc-miR-571 Axis Regulates DNA Replication and Genomic Stability by Targeting Geminin. Cancer Res, 2019. 79(19): p. 4896-4910.
Li, H., et al., The PLGF/c-MYC/miR-19a axis promotes metastasis and stemness in gallbladder cancer. Cancer Sci, 2018. 109(5): p. 1532-1544.
Liu, D., et al., A c-Myc/miR-17-5p feedback loop regulates metastasis and invasion of hepatocellular carcinoma. Tumour Biol, 2016. 37(4): p. 5039-47.
Bandiera, S., et al., miR-122--a key factor and therapeutic target in liver disease. J Hepatol, 2015. 62(2): p. 448-57.
Dong, S.S., et al., Exosomal miR-3682-3p Suppresses Angiogenesis by Targeting ANGPT1 via the RAS-MEK1/2-ERK1/2 Pathway in Hepatocellular Carcinoma. Front Cell Dev Biol, 2021. 9: p. 633358.
Yao, B., et al., High-matrix-stiffness induces promotion of hepatocellular carcinoma proliferation and suppression of apoptosis via miR-3682-3p-PHLDA1-FAS pathway. J Cancer, 2020. 11(21): p. 6188-6203.
Zhou, Y., et al., Hepatocellular carcinoma-derived exosomal miRNA-21 contributes to tumor progression by converting hepatocyte stellate cells to cancer-associated fibroblasts. J Exp Clin Cancer Res, 2018. 37(1): p. 324.
Yang, B., et al., High-metastatic cancer cells derived exosomal miR92a-3p promotes epithelial-mesenchymal transition and metastasis of low-metastatic cancer cells by regulating PTEN/Akt pathway in hepatocellular carcinoma. Oncogene, 2020. 39(42): p. 6529-6543.
Luongo, F., et al., PTEN Tumor-Suppressor: The Dam of Stemness in Cancer. Cancers (Basel), 2019. 11(8).
Kim, R.J., et al., PTEN loss-mediated Akt activation increases the properties of cancer stem-like cell populations in prostate cancer. Oncology, 2014. 87(5): p. 270-9.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

c-Myc-activated miR-3682-3p aggravates the metastasis and stemness in hepatocellular carcinoma cells by regulating PTEN/PI3K/AKT signaling

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Tissue samples

Cell culture

Cell transfection

RNA isolation and quantitative real-time PCR (qRT-PCR)

Western blot

Cell Counting kit-8 (CCK-8)

Cell migration and invasion assay

Wound-healing assay

Luciferase reporting experiment

Chromatin immunoprecipitation assay(ChIP)

Statistical analysis

Results

miR-3682-3p was highly expressed in HCC

Knockdown of miR-3682-3p ameliorated the metastasis and stemness in HCC cells

miR-3682-3p was positively regulated by c-Myc

miR-3682-3p directly targeted PTEN and restrained its expression

c-Myc/miR-3682-3p activated PI3K/AKT pathway by suppressing PTEN

PTEN/PI3K/AKT signaling was involved in the regulation of miR-3682-3p on the metastasis and stemness in HCC

Discussion

Abbreviations

Declarations

References

Additional Declarations

Status:

Version 1