Protective efficacy of Toxoplasma gondii bivalent MAG1 and SAG1 DNA vaccine against acute toxoplasmosis in BALB/c mice

doi:10.21203/rs.3.rs-1863360/v1

Download PDF

Research Article

Protective efficacy of Toxoplasma gondii bivalent MAG1 and SAG1 DNA vaccine against acute toxoplasmosis in BALB/c mice

https://doi.org/10.21203/rs.3.rs-1863360/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 05 Jan, 2023

Read the published version in Parasitology Research →

You are reading this latest preprint version

Background: Toxoplasma gondii is capable of infecting a wide range of warm-blooded animals, causing a worldwide epidemic of zoonotic toxoplasmosis. SAG1 protein is expressed at the proliferative tachyzoite stage, whereas MAG1 is expressed at the bradyzoite and tachyzoite stages. These two proteins display protective roles in previous studies, however, there synergetic protective efficacy as a DNA vaccine against toxoplasmosis has not been clarified.

Methods: In this study, we amplified TgMAG1 and TgSAG1 genes and inserted into eukaryotic expression vector pcDNA3.1(+). The pcDNA3.1(+)-TgMAG1 (pMAG1), pcDNA3.1(+)-TgSAG1 (pSAG1), pcDNA3.1(+)-TgMAG1-TgSAG1 (pMAG1-SAG1) plasmids were transfected into HEK-293 cells and each protein was verified in vitro through western blot. Then, mice were intramuscularly immunized with pMAG1, pSGA1 or pMAG1-SGA1, and anti-T. gondii IgG levels were measured in the serum. Cytokines levels of IL-4, IL-10 and IFN-γ in mice splenocytes culturing supernatants were measured using commercial ELISA kits. Immunized mice were challenged with T. gondii tachyzoites with lethal doses followed by determination of mortality, whereas mice infected with low dose tachyzoites followed by monitoring the parameters of survival rate and parasites burden analysis of brains and livers.

Results: The pMAG1, pSGA1 or pMAG1-SGA1 exhibited well reactogenicity with expected band sizes of 17.843 kDa, 15.572 kDa, 33.415 kDa, respectively. The immunized mice triggered significantly high levels of anti-T. gondii IgG antibodies in comparison with that in the negative control groups, moreover pMAG1-SGA1 immune achieved the highest levels. The DNA vaccines also led to obvious IFN-γ release from splenocytes culturing supernatants, whereas had no role in the IL-4 and IL-10. The protective efficacy results showed that DNA vaccines immunization prolonged the acute infection mice survival time to 14 d, 16 d, 32 d. Consistently, the liver and brain parasites in each immunization group were significantly reduced comparing with PBS control group.

Conclusions: This study revealed that bivalent TgMAG1 and TgSAG1 DNA vaccine displayed excellent protective immunity against toxoplasmosis in mice. These data provide new sight into the development of Toxoplasma gondii vaccines.

TgMAG1

TgSAG1

protective efficacy

toxoplasmosis

Toxoplasma gondii (T. gondii), a member of the phylum Apicomplexa intracellular protozoan parasite, developed the ability to infect humans especially in immunocompromised individuals and other warm-blood animals, leading to zoonotic toxoplasmosis [1]. As an opportunistic pathogen, it is reported that T. gondii infection in human varieties from 10% to 60% and the infection rate even reaches to 95% in some high virulence areas [2, 3, 4]. In general, there is no less than one-third of the world's population has a history of T. gondii infection, making it being a public health threat [5]. Pregnant individuals are easily to bring out health-threatening sequelae for the fetus, or even make abortion [6]. Chronic and long-term T. gondii infections may also trigger severe symptoms, such as encephalitis or neurological symptoms in immune systems and young individuals with congenital infection [7, 8, 9]. However, the available drugs for treatment against toxoplasmosis is not recommended for their toxic effects. Therefore, effective vaccines are far more important for prevention against toxoplasmosis.

There are three T. gondii developmental stages in their life-cycle that are infective, namely the tachyzoite stage, bradyzoite stage, and sporozoite stage. The tachyzoite stage occurs at the acute infection cases, whereas the bradyzoite stage occurs at the chronic infection cases. For the sporozoite stage, they are only produced by the definitive host under sexual reproduction condition [10]. Thus, T. gondii at the tachyzoite stage and bradyzoite stage are far more important for development antigen targets against toxoplasmosis.

Surface antigen 1 (SAG1) was focused for it could interact with host cells and take part in the process of adhesion, invasion, and regulation of host immune responses [11]. Previous study prepared subunit vaccines based on the SAG1 antigen and achieved good performance in the protection of limiting maternofetal transmission [12]. However, it was rigorous for adjuvants choice to boost immunogenicity to induce long-lasting protective immunity [13]. SAG1-based DNA vaccines had been verified to be effectively prevented from lethal T. gondii infection [14, 15, 16]. Moreover, to produce enhanced protection, SAG1 was combined with rhoptry antigen 2 (ROP2) to prepare multivalent vaccine and this combination significantly blocked the T. gondii infection [17]. Matrix antigen 1 (MAG1) was a kind of dense granular proteins that constructed the parasitophorous vacuolar matrix in tachyzoite vacuoles. In addition, MAG1 was also abundant in the cyst wall and matrix in bradyzoite vacuoles [18, 19]. It had been shown that MAG1 induced cell responses throughout T. gondii infection periods [20]. Immunization with MAG1 induced immune protective effects when using murine as a model [19]. In infected humans as well as pigs, high levels of anti-MAG1 IgG antibody generation were detected [21]. MAG1-deletion T. gondii infection exhibited obviously reduced virulence in the acute stage and generated almost no brain cysts in the chronic stage. The immunomodulatory effect of MAG1 favored the survival of T. gondii and the establishment of latent infection was through suppressing inflammasome activation [22]. All these findings suggested that MAG1 displayed good immunogenic being promising targets against toxoplasmosis. However, the effect of bivalent DNA vaccine of T. gondii SAG1 and MAG1 has not been determined.

In this study, the plasmids of pMAG1, pSGA1 and pMAG1-SGA1 were constructed and used as DNA vaccines to immunize mice. The specific antibody generation levels were determined in immunized mice by measuring serum anti-T. gondii IgG levels and splenocytes secreted cytokines levels. The protective efficacy was determined by analyzing the survival rate and parasites burden in T. gondii challenged mice after immunization. This study for the first time assessed the protective ability of TgMAG1 and TgSAG1 bivalent DNA vaccine in mice, aiming to lay a foundation for developing protective strategies against toxoplasmosis.

Ethics statements

The T. gondii passage assays were performed using female Kuming mice (8-12 weeks old, SPF grade). The immunization experiments utilized six to eight week BALB/c mice (SPF grade). All mice were maintained with adequate diet and strictly abided by the guidelines of Experimental Animals Center, Jilin University, Changchun, China. All mouse experiments strictly comply with the animal ethics enforcement of the Animal Welfare and Research Ethics Committee of Jilin University.

Cells, parasites and STAg preparation

HEK-293 cells were conserved in our laboratory. Cells were cultured using DMEM complete medium (Invitrogen, California) containing 10% FBS and used for plasmid transfection. Highly virulent T. gondii (type I) RH strain was kept in our lab. T. gondii tachyzoites were used for plasmid construction and mice challenge. Trophozoites were enriched in infected Kunming mice and the peritoneal fluid was harvested. Cell debris was removed by low-speed centrifugation, and trophozoites were collected from the supernatant by high-speed centrifugation. The trophozoites pellets were resuspended using PBS, and soluble tachyzoite antigen (STAg) was obtained after ultrasonic fragmentation, and the collected STAg was stored at -80℃ for following experiments.

Preparation of recombinant plasmids of pMAG1, pSGA1 or pMAG1-SGA1

To construct the eukaryotic expression plasmids of pMAG1, pSGA1 and pMAG1-SGA1, gene specific primers were designed targeting to the sequences (Genbank Nos. AF251813 and S76248). The primer sets information were shown in Table 1 and synthesized by Sangon Biotech (Changchun). T. gondii tachyzoites RNA was obtained with Trizol (TaKaRa, Dalian). cDNA was prepared with M-MLV reverse transcriptase (TaKaRa). TgMAG1 and TgSAG1 DNA fragments were cloned through PCR assay using T. gondii cDNA followed by purification with TIANgel Midi Purification Kit (TIANGEN, Beijing). The purified DNA fragments were inserted into pMD-18-T vector (TaKaRa). The PCR identified positive plasmids of pMD-MAG1 and pMD-SAG1 were further verified through sequencing. The plasmids of pMD-MAG1 and pcDNA3.1 (Invitrogen) were separately linerized by EcoR I and Hind III restriction enzymes, dephosphorylated by Fast AP (Invitrogen), and linked with T4 DNA ligase (TaKaRa) according to the manufacturer’s instructions. The positive recombinant expression plasmids of pcDNA3.1(+)-TgMAG1 (pMAG1) was identified through PCR. Similar procedures were carried out to construct pcDNA3.1(+)-TgSAG1 (pSAG1) and pcDNA3.1(+)-TgMAG1-TgSAG1 (pMAG1-SAG1) with restriction enzymes sets of Hind III/Xho I and EcoR I/Xho I, respectively. The endotoxin-free plasmid for transfection assays were prepared with commerical purification kit (TianGen).

Table 1 Primer sets information for TgMAG1 and TgSAG1

Primer name	Sequence (5'-3')
MAG1-F	GGAATTCAGCCAGCGCGTGCCGGAACT
MAG1-R	AAGCTTGCTGCCCTGCACACGCAGAAT
SAG1-F	AAGCTTGATCCGCCGCTGGTTGCCAAC
SAG1-R	CCTCGAGCAGGGTGCTATCGGCACCATAG

¹F represented forward;

²R represented reverse.

Expression of MAG1, SAG1, MAG1 and SAG1 in HEK-293 cells

The endotoxin-free plasmids of pMAG1, pSGA1, and pMAG1-SGA1 and the empty vector were in vitro expressed in HEK-293 cells through transfection assays with lipofectamine 2000 (Invitrogen). The protein expression levels of MAG, SGA1, MAG and SGA1 were detected by western blot at 48 h. The primary antibody was 100 times diluted goat anti-T. gondii antiserum (Sigma) and the secondary detection antibody was 500 times diluted HRP-labeled rabbit anti-goat IgG (Proteintech).

Mice immunization

The endotoxin-free plasmids of pMAG1, pSGA1, and pMAG1-SGA1 and the empty vector of pcDNA3.1 were separately immunized into BALB/c mice. Mice were randomly selected and divided into pMAG1 immunity group (100 μg/mice, i.m.), pSGA1 immunity group (100 μg/mice, i.m.), pMAG1-SGA1 immunity group (100 μg/mice, i.m.), pcDNA3.1 treatment group (100 μg/mice, i.m.), and PBS treatment group (100 µL/mice) with 21 mice per group. Mice in each group were received three injections on the last day of the 0, 2nd and 4th weeks, respectively. Prior to immunization, blood samples were collected, and serum samples were separated for further use.

Measurement of specific anti-T. gondii IgG antibody

To determine pMAG1, pSGA1, pMAG1-SGA1 triggered anti-T. gondii IgG antibody levels, ELISA experiments were carried out. STAg with a concentration of 10 µg/mL was added into ELISA plates and incubated overnight at 4°C.ELISA plates were removed on alternate days and closed with 5% bovine serum albumin (BSA) for 2 hours at room temperature. The plates are then incubated with 500 times diluted mouse tail vein serum for 1 h at 37°C and then assayed with 2000 times diluted HRP-labeled goat anti-mouse IgG (Sigma-Aldrich) for 1 h. A substrate solution, containing 15 μL H₂O₂, 10 mL citrate phosphate and 4 mg o-phenylenediamine, was used for 30 min at room temperature and finally terminated by 2 M H₂SO₄. The absorptance at 490 nm was measured and all samples were made in two extra copies just in case.

Measurement of cytokines release from splenocytes supernatants

To evaluate the cytokines production, splenocytes were gathered at two weeks after the last immunization (before the challenge) from three mice in each group. Briefly, fresh spleen tissues were isolated and prepared into suspension by wire mesh. The red blood cells in the mixture were removed with RBC lysis solution (Sigma-Aldrich). The purified splenocyte suspensions were prepared in DMEM medium containing 10% FBS and coated with 1×105 cells/well in 96-well tissue culture plates (Costar, Henan) [23]. After STAg (5 mg/mL) stimuli treatment, the cell supernatants were collected at 1 d, 3 d and 4 d, and analyzed for IL-4, IL-10 and IFN-γ contents with corresponding commercial ELISA kits (R＆D systems, Minnesota).

Monitoring of immunized mice survival time and parasites burden after challenging with T. gondii

Fifteen mice were challenged with 1×10⁴ tachyzoites in each group at weeks 6. Mice that were unable to take in food and water or the body weight loss more than 20% were given euthanasia. Finally, twelve mice were randomly selected to check the mortality daily, and record the number of days survived and compare the experimental groups and control groups. The brain tissues and liver tissues were isolated from the remaining three mice at day 3 after challenging among the experimental groups and control groups. Meanwhile, the TIANamp Genomic DNA Kit (TIANGEN) was used to extract genomic DNA from brain tissue and liver tissue. The parasites burden was quantified as described previously with a Real-time fluorescence quantitative PCR (qPCR) method [24]. The qPCR primer sets for T. gondii B1 gene were as follows: 5’-AACGGGCGAGTAGCACCTGAGGAGA-3’ (forward primer) and 5’-TGGGTCTACGTCGATGGCATGACAAC-3’ (reverse primer). The parasites burden per mg of tissue was calculated to determine the final rate of parasite reduction in comparison with the control group.

Statistical analysis

All data were analyzed by SPSS 14.0 using a one-way analysis of variance (ANOVA). P values no more than 0.05 were considered to be significant difference (* means p < 0.05 and ** means p < 0.01). Graphs or curves were generated by GraphPad Prism 7.00 (GraphPad Software Inc., La Jolla, CA, USA).

Identification the expression of MAG1, SAG1, MAG1 and SAG1 protein

The plasmids of pMAG1, pSGA1 and pMAG1-SGA1 were transformed into HEK-293 cells. After 48 h of incubation, the cell lysates at the 12% SDS-PAGE gel were ran, which were transferred to NC membranes, and analyzed for protein expression by reacting with goat anti-T. gondii antibody. Results were shown in Fig. 1, the pMAG1, pSGA1 or pMAG1-SGA1 transfection cell lysates exhibited well reactogenicity with anti-T. gondii antibody and obtained the expected protein sizes of 17.843 kDa, 15.572 kDa, 33.415 kDa, respectively. There were no specific reaction bands occurred in the HEK-293 and pcDNA3.1(+) cell lysates. These data illustrated that pMAG1, pSGA1 and pMAG1-SGA1 were successfully expressed in vitro.

Specific IgG antibody response

Three mice were selected from every group and then serum was collected on the last day of 0, 2nd, 4th and 6th week, and detected by ELISA to measure the levels of anti-T. gondii IgG. Results were shown in Fig. 2, mice with PBS or pcDNA3.1 (+) control could generate significantly lower levels of IgG antibodies than that in the pMAG1, pSGA1 or pMAG1-SGA1 immunization groups (p < 0.01). The levels of IgG in the single antigenic groups (pMAG1 or pSGA1) were lower than the single antigenic groups (pMAG1-SGA1, p < 0.05), but there was no significant difference between pMAG1 group and pSGA1 group (p > 0.05).

Immune sera were collected from 3 mice on 0, 2nd, 4th and 6th weeks after the first immunization. Results were shown as means of OD 490±SD and statistical differences (p<0.01) were indicated by * as compared to the control (PBS and pcDNA3.1). # (p<0.05) as compare with pMAG1, pSGA1 and pMAG1-SGA1.

Cytokine production

Splenocytes were prepared after two weeks since the mice last immunization and respectively collected in the culturing supernatants at 24 h, 72 h and 96 h after STAg stimulation. The IFN-γ, IL-4 and IL-10 levels were assessed and results were displayed in Fig. 3. The pMAG1, pSGA1 or pMAG1-SGA1 immunized mice splenocytes generated higher IFN-γ release than that in the pcDNA3.1 and PBS control groups (p＜0.01). The MAG1-SAG1 DNA vaccine group was more than the T. gondii monovalent MAG1 or SAG1 DNA vaccine groups (p＜0.05). Moreover, the IL-4 and IL-10 test results showed no significant differences in the experimental groups.

Evaluating the protective efficacy of pMAG1, pSGA1 or pMAG1-SGA1

In order to assess the protective efficacy of DNA vaccines, mice (n=10) in all groups were challenged with lethal doses T. gondii tachyzoites (1×10⁴/mice) at the 2nd week after the final immunization, and the survival days and percentages in different groups were monitored. As shown in Fig. 4, the pMAG1, pSGA1 and pMAG1-SGA1 immunization significantly prolonged the mice survival days compared to the pcDNA3.1 and PBS control groups (P<0.05). Death of both pcDNA3.1 and PBS control mice occurred within 4-7 days, whereas mice immunized with pMAG1-SGA1 increased the survival days to 16-32 days and mice immunized with pMAG1 or pSGA1 extended the survival time to 7-16 days. Moreover, differences among the different immunization ways groups were also analyzed and results indicated that the pMAG1-SGA1 immunization way had better performance in prolonging survival time than pMAG1 or pSGA1 immunization (P<0.05). All mice were dead within 32 days post-infection.

To evaluate the number of parasites burden in mice brains and livers, 1×10⁴ T. gondii tachyzoites were challenged in all groups of mice (n=3) at the 2nd week after the final immunization. Real-time PCR quantified the number of parasites in the brain and liver of three mice in every group. As shown in Table 2, the mice that received the pMAG1, pSGA1 and pMAG1-SGA1groups showed a significant reduction in parasite in all tissues, compared to the control (pcDNA3.1 and PBS) (p < 0.01). The pMAG1-SGA1groups were significant reduction compared to the pMAG1, pSGA1(p < 0.05). No differences were significantly found between the pMAG1and the pSGA1 groups (p > 0.05).

Table 2 Parasites load of brain and liver in immunized mice after challenge with 1×10⁴tachyzoites of T. gondii RH strain

Challenged group	brain	liver
Challenged group	CT (Mean of parasite load)
PBS	21.38±1.31	20.14±0.74
pcDNA3.1	21.21±0.59	20.23±0.66
pMAG1	27.09±0.68^a,b	26.29±0.51^a,b
pSGA1	26.61±0.26^a,b	26.16±1.36^a,b
pMAG1-SGA1	28.47±0.29^a,b,*	28.09±0.19^a,b,*

The CT is the qPCR threshold cycle and the number of parasites is per mg of tissue. The statistical differences (p < 0.01) between the vaccinated and control groups were made with (a, b, c, d, e). The statistical differences (p<0.05) between the pMAG1, pSGA1 and pMAG1-SGA1 groups were made with (*) (a=PBS, b=pcDNA3.1, c=pMAG1, d=pSGA1, e=pMAG1-SGA1).

DNA vaccines were firstly developed since 1990s, being the third generation of vaccine followed by pathogen vaccines and subunit vaccines. Nucleic acid vaccine could express the targets molecules into the eukaryotic system and simulate the natural counterparts to effectively induce immune responses in hosts. It shares the excellent advantages of simple preparation, low cost and friendliness to operators, and is suitable for large-scale production. DNA vaccination had been verified to share protective roles against pathogenic microorganisms, especially the intracellular parasite T. gondii infection, in animals and human beings [25]. T. gondii experiences several stages and develops into diverse morphology during its life cycle. Previous studies have manifested that hosts vaccinated with different stage-specific targets would bring out T. gondii stage limited growth and protect hosts from infection [26, 27]. Several studies have indicated that DNA vaccines with multi-antigens exhibit better immune effects than vaccination with single antigen in the protection against toxoplasmosis [28, 29]. Thus, we consider that developing a DNA vaccine with multi-antigens that both involved in the growth stage and invasion stage will compensate for the use of a single antigen as a DNA vaccine. It was reported that SAG1 located on the surface of T. gondii tachyzoites, induces both effective and durable humoral and cellular immune responses in the immunized mice [15, 30, 31], whereas MAG1 is localized in the matrix and the wall of tissue cysts, and it is also synthetized in tachyzoites [18, 19]. In this study, we prepared a T. gondii bivalent MAG1 and SAG1 DNA vaccine which are expressed in tachyzoites growth stage and tissue cysts infectious stages, and evaluated whether it could be a potent vaccine against acute and chronic T. gondii infection in mice. Meanwhile, single SAG1 or MAG1 immunization were both set as controls to compare the bivalent DNA vaccine effects with single DNA vaccine. Results showed that mice immunized with pSAG1, pMAG1, or pMAG1-SGA1 plasmids produced specific antibodies against T. gondii and induced protection against T. gondii challenge. Moreover, immunization with the multi-antigen plasmid pMAG1-SGA1 induced a stronger humoral and cellular immune response, increased the survival days and decreased the parasites burden of brain and liver tissues in T. gondii tachyzoites challenged mice compared with single antigen groups.

The level of anti-T. gondii IgG antibody was evaluated in this study. Significant increasing IgG levels were observed in the pSAG1-MAG1 group since the 4th week after immunization and reached the highest level at the 6th week. It was suggested that all these three DNA vaccines produced strong parasite-specific humoral immunity against T. gondii, especially the multi-antigen DNA vaccine. Cytokines play important roles in regulating the T helper cells activities. According to their function difference, they are mainly classified into Th1 type and Th2 type cytokines. IFN-γ is known to be a dominant product of Th1-type cytokines that suppress Th2-type immune responses, while the presence of IL-4 in the early stages of infection will inhibit the differentiation of protective Th1 cells [32, 33]. IFN-γ and IL-4 act as regulatory factors and mediate the dynamic balance between Th1 and Th2 immune responses [34]. In this study, immunization with the pSAG1-MAG1 vaccine produced high levels of IFN-γ, which significantly enhanced Th1 cell-mediated immunity compared with the other groups. However, there was no significant difference in the production of IL-4 and IL-10 in any of the groups. It was shown that Th1 type cellular immune responses in BALB/c mice can be induced by pSAG1-MAG1 vaccine.

Survival days and parasite burden are the most important parameters to consider in order to assess the protective effect of pSAG1, pMAG1, and pSAG1-MAG1 vaccines against T. gondii challenge. Several studies demonstrated that vaccination with recombinant proteins encoding T. gondii antigens showed certain protection and increased the survival time of animals and reduced the parasites burden. These vaccines included the DNA vaccines encoding TgGRA14 [35], TgROP5 and TgGRA15 [36], TgROP5 and TgROP18 [37], and TgGRA1 and TgMIC3 [38]. In the present study, BALB/c mice were challenged with lethal dose of 1×10⁴ tachyzoites of T. gondii RH strain to evaluate the survival rate and analyze the parasite reduction. Mice immunized with the pSAG1-MAG1 DNA vaccine had prolonged survival time as well as fewer parasites burden both in the brain and liver tissues compared with the other groups. In terms of protection against the challenge of T. gondii, multi-antigen DNA vaccines perform better and more effectively during this research.

Taken together, both the production of specific cellular and humoral immune responses in pSAG1, BALB/c mice can be induced to occur by pSAG1, pMAG1, pSAG1-MAG1 DNA vaccines. The T. gondii bivalent MAG1 and SAG1 DNA vaccine provided more enhanced immunity against T. gondii infection in BALB/c mice. which suggested that it is more qualified to be studied as an anti-T. gondii vaccine. Other potent effective antigens, suitable adjuvants and other animal models can be further investigated later.

Acknowledgements

This work was supported by grants from the National Natural Science Foundation of China (No. 31302076), the scientific and technological planning project of Jilin province (No. 20200403041SF).

Authors’ contributions

Gong Pengtao: Conceptualization, Writing - Review & Editing, Project administration, Resources, Funding acquisition. Cao Lili, Juan Liu, Songgao Cao, Zhao Panpan, and Ding He: Methodology, Writing - Original Draft, Formal analysis, Software, Data Curation.Yuan Shuxian, Yao Xinhua, Sun Xingzhong, Dong Hang, Guo Yanbing, Shao Hongze and Wang Nan: Validation, Formal analysis, Investigation. Cao Lili and Gong Pengtao: Data Curation, Visualization, Supervision.

Funding

This work was supported by grants from the National Natural Science Foundation of China (No. 31302076), the scientific and technological planning project of Jilin province (No. 20200403041SF).

Availability of data and materials

The data supporting the conclusions of this article are provided within the article. The original datasets analyzed in the present study are available from the corresponding author upon request.

Ethics approval and consent to participate

All animal experiments were approved by the Animal Welfare and Research Ethics Committee of Jilin University (IACUC Permit Number: pzpx20190929065).

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Dubey JP. The history of Toxoplasma gondii–the first 100 years. J Eukaryot Microbiol. 2008;55(6):467–75.
Almería S, Cabezón O, Paniagua J, Cano-Terriza D, Jiménez-Ruiz S, Arenas-Montes A, et al. Toxoplasma gondii in sympatric domestic and wild ungulates in the Mediterranean ecosystem. Parasitol Res. 2018;117(3):665–71.
Pappas G, Roussos N, Falagas ME. Toxoplasmosis snapshots: global status of Toxoplasma gondii seroprevalence and implications for pregnancy and congenital toxoplasmosis. Int J Parasitol. 2009;39(12):1385–94.
Li Y, Zhou H. Moving towards improved vaccines for Toxoplasma gondii. Expert Opin Biol Ther. 2018;18(3):273–80.
Saadatnia G, Golkar M. A review on human toxoplasmosis. Scand J Infect Dis. 2012;44(11):805–14.
Milne G, Webster JP, Walker M. Toxoplasma gondii: An Underestimated Threat?. Trends Parasitol. 2020;36(12):959–69.
Dubey JP. Toxoplasma gondii infections in chickens (Gallus domesticus): prevalence, clinical disease, diagnosis and public health significance. Zoonoses Public Health. 2010;57(1):60–73.
Li XL, Wei HX, Zhang H, Peng HJ, Lindsay DS. A meta analysis on risks of adverse pregnancy outcomes in Toxoplasma gondii infection. PLoS One. 2014;9(5):e97775.
Rosenberg C, De Craeye S, Jongert E, Gargano N, Beghetto E, Del Porto P, et al. Induction of partial protection against infection with Toxoplasma gondii genotype II by DNA vaccination with recombinant chimeric tachyzoite antigens. Vaccine. 2009;27(18):2489–98.
Attias M, Teixeira DE, Benchimol M, Vommaro RC, Crepaldi PH, Souza WD. The life-cycle of Toxoplasma gondii reviewed using animations. Parasit Vectors. 2020;13(1):588.
Wang Y, Yin H. Research progress on surface antigen 1 (SAG1) of Toxoplasma gondii. Parasit Vectors. 2014;7:180.
Letscher-Bru V, Pfaff AW, Abou-Bacar A, Filisetti D, Antoni E, Villard O, et al. Vaccination with Toxoplasma gondii SAG-1 protein is protective against congenital toxoplasmosis in BALB/c mice but not in CBA/J mice. Infect Immun. 2003;71(11):6615–9.
Chuang SC, Ko JC, Chen CP, Du JT, Yang CD. Induction of long-lasting protective immunity against Toxoplasma gondii in BALB/c mice by recombinant surface antigen 1 protein encapsulated in poly (lactide-co-glycolide) microparticles. Parasit Vectors. 2013;6:34.
Saito S, Aosai F, Rikihisa N, Mun HS, Norose K, Chen M, et al. Establishment of gene vaccinated skin grafting against Toxoplasma gondii infection in mice. Vaccine. 2001;19(15–16):2172–80.
Nielsen HV, Lauemøller SL, Christiansen L, Buus S, Fomsgaard A, Petersen E. Complete protection against lethal Toxoplasma gondii infection in mice immunized with a plasmid encoding the SAG1 gene. Infect Immun. 1999;67(12):6358–63.
Ivory C, Chadee K. DNA vaccines: designing strategies against parasitic infections. Genet Vaccines Ther. 2004; 2(1):17–25.
Fachado A, Rodriguez A, Angel SO, Pinto DC, Vila I, Acosta A, et al. Protective effect of a naked DNA vaccine cocktail against lethal toxoplasmosis in mice. Vaccine. 2003;21(13–14):1327–35.
Ferguson DJ, Parmley SF. Toxoplasma gondii MAG1 protein expression. Trends Parasitol. 2002;18(11):482.
Parmley S, Slifer T, Araujo F. Protective effects of immunization with a recombinant cyst antigen in mouse models of infection with Toxoplasma gondii tissue cysts. J Infect Dis. 2002;185 Suppl 1:S90-5.
Cristina MD, Porto PD, Buffolano W, Beghetto E, Spadoni A, Guglietta S, et al. The Toxoplasma gondii bradyzoite antigens BAG1 and MAG1 induce early humoral and cellmediated immune responses upon human infection. Microbes Infect. 2004;6(2):164–71.
Gamble HR, Andrews CD, Dubey JP, Webert DW, Parmley SF. Use of recombinant antigens for detection of Toxoplasma gondii infection in swine. J Parasitol. 2000;86(3):459–62.
Tomita T, Mukhopadhyay D, Han B, Yakubu R, Tu V, Mayoral J, et al. Toxoplasma gondii Matrix Antigen 1 Is a Secreted Immunomodulatory Effector. mBio. 2021;12(3):e00603-21.
Fereig RM, Shimoda N, Abdelbaky HH, Kuroda Y, Nishikawa Y. Neospora GRA6 possesses immune-stimulating activity and confers efficient protection against Neospora caninum infection in mice. Vet Parasitol. 2019;267:61–8.
Contini C, Seraceni S, Cultrera R, Incorvaia C, Sebastiani A, Picot S. Evaluation of a Real-time PCR-based assay using the lightcycler system for detection of Toxoplasma gondii bradyzoite genes in blood specimens from patients with toxoplasmic retinochoroiditis. Int J Parasitol. 2005;35(3):275–83.
Warner RC, Chapman RC, Davis BN, Davis PH. Review of DNA vaccine approaches against the parasite Toxoplasma gondii. J Parasitol. 2021;107(6):882–903.
Mevelec MN, Bout D, Desolme B, Marchand H, Magne R, Bruneel O, Buzoni-Gatel D. Evaluation of protective effect of DNA vaccination with genes encoding antigens GRA4 and SAG1 associated with GM-CSF plasmid, against acute, chronical and congenital toxoplasmosis in mice. Vaccine. 2005;23(36):4489–99.
Liu S, Shi L, Cheng YB, Fan GX, Ren HX, Yuan YK. Evaluation of protective effect of multi-epitope DNA vaccine encoding six antigen segments of Toxoplasma gondii in mice. Parasitol Res. 2009;105(1):267–74.
Beghetto E, Nielsen HV, Del Porto P, Buffolano W, Guglietta S, Felici F, Petersen E, Gargano N. A combination of antigenic regions of Toxoplasma gondii microneme proteins induces protective immunity against oral infection with parasite cysts. J Infect Dis. 2005;191(4):637–45.
Fachado A, Rodriguez A, Angel SO, Pinto DC, Vila I, Acosta A, Amendoeira RR, Lannes-Vieira J. Protective effect of a naked DNA vaccine cocktail against lethal toxoplasmosis in mice. Vaccine. 2003;21(13–14):1327–35.
Liu KY, Zhang DB, Wei QK, Li J, Li GP, Yu JZ. Biological role of surface Toxoplasma gondii antigen in development of vaccine. World J Gastroenterol. 2006;12(15):2363–8.
Siachoque H, Guzman F, Burgos J, Patarroyo ME, Gomez Marin JE. Toxoplasma gondii: immunogenicity and protection by P30 peptides in a murine model. Exp Parasitol. 2006;114(1):62–5.
Nakagome K, Okunishi K, Imamura M, Harada H, Matsumoto T, Tanaka R, Miyazaki J, Yamamoto K, Dohi M. IFN-gamma attenuates antigen-induced overall immune response in the airway as a Th1-type immune regulatory cytokine. J Immunol. 2009;183(1):209–20.
Nan CL, Lei ZL, Zhao ZJ, Shi LH, Ouyang YC, Song XF, Sun QY, Chen DY. Increased Th1/Th2 (IFN-gamma/IL-4) Cytokine mRNA ratio of rat embryos in the pregnant mouse uterus. J Reprod Dev. 2007;53(2):219–28.
Torres KC, Dutra WO, Gollob KJ. Endogenous IL-4 and IFN-gamma are essential for expression of Th2, but not Th1 cytokine message during the early differentiation of human CD4 + T helper cells. Hum Immunol. 2004;65(11):1328–35.
Ahmadpour E, Sarvi S, Hashemi Soteh MB, Sharif M, Rahimi MT, Valadan R, Tehrani M, Khalilian A, Montazeri M, Daryani A. Evaluation of the immune response in BALB/c mice induced by a novel DNA vaccine expressing GRA14 against Toxoplasma gondii. Parasite Immunol. 2017;39(4).
Chen J, Li ZY, Petersen E, Huang SY, Zhou DH, Zhu XQ. DNA vaccination with genes encoding Toxoplasma gondii antigens ROP5 and GRA15 induces protective immunity against toxoplasmosis in Kunming mice. Expert Rev Vaccines. 2015;14(4):617–24.
Grzybowski MM, Dziadek B, Dziadek J, Gatkowska J, Dzitko K, Długońska H. Towards vaccine against toxoplasmosis: evaluation of the immunogenic and protective activity of recombinant ROP5 and ROP18 Toxoplasma gondii proteins. Exp Parasitol. 2015;150:1–6.
Gong P, Cao L, Guo Y, Dong H, Yuan S, Yao X, Ren W, Yao L, Xu Z, Sun Q, Zhang X. Toxoplasma gondii: Protective immunity induced by a DNA vaccine expressing GRA1 and MIC3 against toxoplasmosis in BALB/c mice. Exp Parasitol. 2016;166:131–6.

No competing interests reported.

Download PDF

Journal Publication

published 05 Jan, 2023

Read the published version in Parasitology Research →

Editorial decision: Major revision
17 Jul, 2022
Editor assigned by journal
17 Jul, 2022
Submission checks completed at journal
17 Jul, 2022
First submitted to journal
15 Jul, 2022

You are reading this latest preprint version

Protective efficacy of Toxoplasma gondii bivalent MAG1 and SAG1 DNA vaccine against acute toxoplasmosis in BALB/c mice

Status:

Journal Publication

Version 1

Abstract

Figures

Background

Methods

Results

Discussion

Conclusions

Declarations

References

Additional Declarations

Status:

Journal Publication

Version 1