Transcutaneous CO₂ application combined with low-intensity pulsed ultrasound accelerates bone fracture healing in rats

doi:10.21203/rs.3.rs-1863438/v1

Download PDF

Research Article

Transcutaneous CO₂ application combined with low-intensity pulsed ultrasound accelerates bone fracture healing in rats

https://doi.org/10.21203/rs.3.rs-1863438/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Low-intensity pulsed ultrasound (LIPUS) is a non-invasive therapy that accelerates fracture healing by promoting endochondral ossification, osteoblast differentiation, and angiogenesis. We recently reported that the transcutaneous application of CO₂ using a hydrogel accelerated fracture healing in association with the promotion of angiogenesis, blood flow, and endochondral ossification. We hypothesized that transcutaneous CO₂ application, combined with LIPUS, would promote bone fracture healing more than the single treatment with either of them.

Methods

Femoral shaft fractures were produced using drop weight in twelve-week-old rats. Animals were randomly divided into four groups: the combination of CO₂ and LIPUS, CO₂, LIPUS, and control groups. After the CO₂ absorption-enhancing hydrogel was applied, the limb was sealed in a CO₂-filled bag for 20 min. LIPUS was applied for 20 minutes. At weeks 1, 2, 3, and 4 after the fractures, we assessed the bone union rate and fracture healing score using radiography. We histologically assessed the degree of fracture healing and evaluated gene expression by real-time PCR to assess chondrogenic differentiation, osteogenic differentiation, and angiogenesis at weeks 1, 2, 3, and 4. For the biomechanical assessment, a three-point bending test was performed at week 4.

Results

The fracture healing score using radiographs in the combination group was significantly higher than that in the control group at all time points and those in both the LIPUS and CO₂ groups at weeks 1, 2, and 4. The degree of bone fracture healing in the histological assessment was significantly higher in the combination group than that in the control group at weeks 2, 3, and 4. In the gene expression assessment, significant upregulation of Runx2 and VEGF was detected in the combination group compared to the LIPUS and CO₂ monotherapy groups. In the biomechanical assessment, the ultimate stress was significantly higher in the combination group than in the LIPUS and CO₂ groups.

Conclusions

Bone

Fracture healing

Carbon dioxide

Low-intensity pulsed ultrasound

Combination therapy

Approximately 5–10% of fractures do not heal normally, resulting in delayed union or nonunion [1]. The process of fracture healing is complex and various factors are necessary for successful fracture treatment, including mechanical stability, osteogenic cells, osteoinductive growth factors, osteoconductive scaffolds, and vascularity [2, 3].

The development and clinical application of fracture healing promotion methods can contribute to the early recovery of patients' daily life activities, early return to social activities, and improvement of their quality of life. Tools currently available in the clinical setting for promoting fracture healing include low-intensity pulsed ultrasound (LIPUS) [4], parathyroid hormone (PTH) treatment [5], and bone morphogenetic proteins (BMPs) treatment [6], depending on the country.

LIPUS is a non-invasive therapy that can accelerate fracture healing by physical stimulation of the fracture site. Although the actual determinants of bone healing by LIPUS are not fully understood, several sources explain the possible mechanisms. LIPUS waves cause nano-motion at the fracture site and mechanical signals are translated into biochemical signals through integrin mechanoreceptors [7]. Multiple pathways are initiated in the cells, leading to the transcription of genes in the nucleus, primarily cyclooxygenase 2 (COX-2). As a result of enhanced intracellular COX-2 production, prostaglandin E2 is released from the cells and promotes osteogenic genes through various pathways. Osteogenic genes stimulate endochondral ossification at the fracture site, resulting in accelerated bone remodeling and fracture healing. Several reports have shown that LIPUS significantly promotes osteoblast differentiation, mainly in mesenchymal stem cells [8, 9], induces angiogenesis, and improves tissue perfusion [10].

Our research group has reported the transcutaneous application of CO₂ using hydrogel as a new tool to promote bone fracture healing. By applying the hydrogel to the skin, CO₂ can dissolve into the gel and pass through the skin to reach deep tissue. e have confirmed that transcutaneous application of CO₂ has tissue regeneration effects, including local tissue oxygenation through the Bohr effect, increased blood flow, and angiogenesis [11, 12]. Our previous studies using a rat femoral fracture model, a rat femoral defect model, and a rabbit tibia distraction osteogenesis model showed that transcutaneous application of CO₂ accelerated fracture repair by promoting angiogenesis, blood flow, and endochondral ossification at the fracture, bone defect, and distraction osteogenesis sites [13–15].

We hypothesized that transcutaneous CO₂ application combined with LIPUS would promote more bone fracture healing than the single treatment with either of them. We asked the following questions: (1) Do transcutaneous CO₂ application and LIPUS cancel each other out during combination therapy? (2) Are there additive or synergistic effects of transcutaneous CO₂ application and LIPUS in combination therapies? This study aimed to investigate these questions using experimental fracture model in rats.

Animal model

A total of 180 male, 12 weeks old Sprague–Dawley rats (SLC Japan, Shizuoka, Japan) with an average weight of 398.2 g (± 5.6 g) were used under a research protocol approved by the institutional ethical committee. Medetomidine (0.15 mg/kg), midazolam (2 mg/kg), and butorphanol (2.5 mg/kg) were administered intraperitoneally for preoperative anesthesia and sedation, following which we shaved the hairs on the rat's lower limbs. A 1.25 mm diameter K-wire was retrogradely inserted into the femoral intramedullary canal to produce a standard stabilized closed femoral fracture model. By fixing the femur with a three-point bender and dropping weight at the center of the femoral bone, a transverse femoral shaft fracture was produced [16]. After waking up from anesthesia, weight-bearing restrictions, plaster casts, or other external fixations were not applied. The rats were euthanized using an overdose of pentobarbital for subsequent assessments.

Procedure for the transcutaneous CO₂ application and LIPUS

Animals were randomly divided into four groups: the combination of CO₂ and LIPUS treatment group (CO₂ + LIPUS group), CO₂ treatment group (CO₂ group), LIPUS treatment group (LIPUS group), and sham treatment group (control group). In the CO₂ + LIPUS group, transcutaneous application of CO₂ to the fractured lower limbs of the rats was performed at first. After induction of sedation with a minimum dose of isoflurane, the CO₂ absorption-enhancing hydrogel was applied to the shaved fractured limb and the limbs were packed in a polyethylene bag filled with 100% CO₂ for 20 min [13]. The hydrogel (pH 5.5) consisted of carbomer, glycerin, sodium hydroxide, sodium alginate, sodium dihydrogen phosphate, methylparaben, and deionized water. After CO₂ application, LIPUS was applied to the fracture site for 20 minutes. In the CO₂ group, we performed CO₂ application only; in the LIPUS group, we performed LIPUS only. The CO₂ and LIPUS treatments were performed five times per week. Control animals were subjected to sham treatment.

Radiographic assessment

At weeks 1, 2, 3, and 4 after the fractures, radiographs of the fractured limbs were obtained (n = 10 in each group). Fracture union was identified by the presence of bridging callus formation in the four cortices on anteroposterior and lateral views [17]. In addition, we assessed fracture healing using the Radiographic Union Score for Tibial fracture (RUST) [18], which evaluates fracture healing by assigning a score (ranging from 4 to 12) based callus formation and fracture line visibility on orthogonal views of the anterior, posterior, medial, and lateral cortices on radiographs. RUST was originally used to assess bone healing in human tibial fractures; however, it can also be used in non-human animals and fractures other than the tibia [19]. The inter-examiner error in RUST is reported to be small [20], and it correlates well with the mechanical properties of the fracture site [21]. Three blinded examiners with more than 10 years of clinical experience as orthopedic surgeons assessed fracture union and RUST.

Histological assessment

Fractured femurs were harvested at weeks 1, 2, 3, and 4 (n = 5 in each group). Harvested femurs were fixed in 4% paraformaldehyde for 24 h at room temperature and demineralized using a demineralization solution (10% formic acid and 10% formalin; 1:1 ratio). After embedding in paraffin wax, femurs were processed to obtain 6-µm sagittal sections. Sections were deparaffinized in xylene, dehydrated in a graded alcohol series, and stained with Safranin-O/Fast Green. Light microscopy was used to visualize detailed histological structures and cartilage regions. The degree of fracture healing was assessed using the Allen’s grading system, which uses a five-point scale (grade 0: pseudoarthrosis; grade 1: incomplete cartilaginous union; grade 2: complete cartilaginous union; grade 3: incomplete bone union; grade 4: complete bone union) [22]. Three blinded examiners with experience in basic research regarding fracture repair scored the degree of fracture repair using the Allen’s grading system.

Gene expression assessment

We measured the expression of several genes using real-time PCR at weeks 1, 2, 3, and 4 after the fracture (n = 5 in each group). Tissue around the fracture was harvested and homogenized using TRIzol (Invitrogen, Carlsbad, California, USA) with a T18 ULTRA-TURRAX homogenizer (IKA Werke, Staufen, Germany). Total cellular RNA was extracted from the collected tissues using the acid guanidinium thiocyanate-phenol-chloroform method and purified using RNeasy Mini Kit (Qiagen, Valencia, California, USA). On-column digestion was performed using RNase-free DNase kit (Qiagen) to prevent contamination with genomic DNA. RNA samples were reverse-transcribed to synthesize single-stranded complementary DNA (cDNA) using a high-capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, California, USA). Real-time PCRs were performed in duplicates using the ABI PRISM7700 Sequence Detection System and SYBR Green reagent (Applied Biosystems). All primer sequences are shown in Table 1.

Table 1

Details of the primers used for amplification.
Gene	Primer sequences (5' to 3') (forward/reverse)
GAPDH	AAATGGTGAAGGTCGGTGTG
	TGAAGGGGTCGTTGATGG
Collagen Ⅱ	GGGCTCCCAGAACATCACCTACCA
	TCGGCCCTCATCTCCACATCATTG
Collagen Ⅹ	GGCAGCAGCACTATGACCCAA
	ACAGGCCTACCCAAACGTGAGTCC
MMP-13	CCCTGGAGCCCTGATGTTT
	CTCTGGTGTTTTGGGGTGCT
ALP	TCCCAAAGGCTTCTTCTTGC
	ATGGCCTCATCCATCTCCAC
Runx2	GCGTCAACACCATCATTCTG
	CAGACCAGCAGCACTCCATC
Osterix	AGCTCTTCTGACTGCCTGCCTA
	TGGGTGCGCTGATGTTTGCT
VEGF	TGCACTGGACCCTGGCTTTAC
	CGGCAGTAGCTTCGCTGGTAG
eNOS	GACCCTCACCGATACAACATAC
	CATACAGGATAGTCGCCTTCAC
TSP-1	GAGTGTCACTGCCAGAACTCA
	GTCTGTACTGAAGAGCCCTCA

GAPDH, glyceraldehyde-3-phosphate dehydrogenase; MMP-13, matrix metalloproteinase-13; ALP, alkaline phosphatase; Runx2, runt-related transcription factor 2; VEGF, vascular endothelial growth factor; eNOS, endothelial nitric oxide synthase; TSP-1, thrombospondin-1.

The gene expression levels of collagen II, collagen X, and matrix metalloproteinase-13 (MMP-13) were used to assess chondrogenic differentiation. Alkaline phosphatase (ALP), runt-related transcription factor 2 (Runx2), and osterix were used to assess osteogenic differentiation. We also examined the following genes: vascular endothelial growth factor (VEGF), which is involved in angiogenesis; endothelial nitric oxide synthase (eNOS), which contributes to vasodilation [23]; and thrombospondin-1 (TSP-1), which is a potent endogenous inhibitor of angiogenesis [24].

The expression level of each gene was normalized to that of glyceraldehyde-3-phosphate dehydrogenase, a housekeeping gene, and expressed relative to the control. Gene expression was quantified using the ΔΔCT method (Applied Biosystems) and results are presented as the fold change relative to one randomly selected sample from the control group at week 1 [25].

Biomechanical assessment

A standardized three-point bending test was performed using a load torsion and bending tester 4 weeks after the fracture. The bending force was applied with a crosshead at a speed of 2 mm/min until rupture occurred. The ultimate stress (N), extrinsic stiffness (N/mm), and failure energy (N · mm) were measured (n = 5 in each group). The ratio of each parameter of the fractured femur to that in the left femur, which was the healthy limb of the same rat, was calculated.

Statistics Analysis

Fisher's exact test, followed by the post hoc Bonferroni test, was used to compare the fracture union rate on the radiographic assessment between groups at each time point. The Kruskal–Wallis test with Steel–Dwass post hoc test was used to compare RUST on radiographic assessment, the Allen’s grading score on the histological assessment, gene expression results, and biomechanical results between the groups at each time point. Statistical significance was set at P < 0.05. Columns and error bars indicate mean and standard error.

Radiographic assessment

Representative radiographs from each group and at each time point are shown in Fig. 1A. At week 1, there was no periosteal callus formation in the control group, while periosteal callus formation was found in 1–2 of the four cortical bones on the anterior, posterior, medial, and lateral sides in the LIPUS and CO₂ groups. In the CO₂ + LIPUS group, periosteal callus formation was observed in two of the four cortical bones in most cases. At week 2, all groups showed enlargement of the callus formation; however, none in the control groups showed bridging calli in all four locations. The bone healing rate in the CO₂ + LIPUS group was 80%, which was significantly higher than that of the control group (Table 2).

Table 2

Bone union rate in each group at each time point
Group	Week 1	Week 2	Week 3	Week 4
Control	0/10 (0%)	0/10 (0%)	3/10 (30%)	10/10 (100%)
LIPUS group	0/10 (0%)	2/10 (20%)	7/10 (70%)	10/10 (100%)
CO₂ group	0/10 (0%)	4/10 (40%)	10/10 (100%)	10/10 (100%)
CO₂ + LIPUS group	0/10 (0%)	8/10 (80%)	10/10 (100%)	10/10 (100%)

At week 2, the bone healing rate in the CO₂+LIPUS group was significantly higher than that of the control group. At week 3, the bone healing rates in CO₂+LIPUS and CO₂ groups were significantly higher than that in the control group.

At week 3, bone healing was achieved in all rats in the CO₂ and CO₂+LIPUS groups, and the bone healing rates in both groups were significantly higher than that in the control group (30%). At week 4, bone healing was observed in all rats. The RUST results are shown in Figure 1B. The CO₂+LIPUS group had significantly higher scores than the control group at all time points, and significantly higher scores than the LIPUS and CO₂ groups at weeks 1, 2, and 4. At weeks 2 and 3, the CO₂ group scored higher than the control group, and the LIPUS group at week 2 scored higher than the control group. At week 4, the CO₂+LIPUS group showed bridging callus and disappearance of the fracture lines in all cases.

Histological assessment

Representative histological images of each group and time point are shown in Fig. 2A. At week 1, cartilage formation in the woven bone was observed in all groups, particularly in the CO₂ + LIPUS group. At week 2, cartilage union was observed in some samples from the CO₂ and CO₂ + LIPUS groups. At week 3, there was little cartilage in the CO₂ + LIPUS group, indicating that endochondral ossification was progressing. At 4 weeks, there was little cartilage in the control group and bone healing was observed in the other three groups. The Allen’s grading system scores were significantly higher in the CO₂ + LIPUS group than those in the control group at weeks 2, 3, and 4 and were significantly higher in the LIPUS and CO₂ groups than in the control group at week 3 (Fig. 2B).

Gene expression assessment

Gene expression levels in tissues around the fracture sites assessed by real-time PCR are shown in Fig. 3.

As for genes related to chondrogenic differentiation, gene expression of collagen II was significantly higher in the CO₂ + LIPUS group than those in the control group at weeks 1 and 2, and significantly higher in the LIPUS and CO₂ groups than that in the control group at week 2. Collagen Ⅹ expression was higher in the CO₂ + LIPUS group than those in the control and LIPUS groups at week 2, and in the CO₂ group than that in the control group at week 3. The gene expression of MMP-13 was significantly higher in the CO₂ and CO₂ + LIPUS groups that than in the control group at week 3.

Regarding genes related to osteoblast differentiation, the expression of ALP at weeks 2 and 3 were higher in the LIPUS, CO₂, and CO₂ + LIPUS groups than that in the control group. Runx2 expression in the CO₂ + LIPUS group was higher than those in the control and LIPUS groups at weeks 2 and 3, and higher than that in the CO₂ group at week 3; at week 2, the CO₂ group showed a higher expression than the LIPUS group. The osterix levels in the LIPUS and CO₂ + LIPUS groups were significantly higher than that in the control group at week 3.

The gene expression of VEGF was significantly higher in the LIPUS, CO₂, and CO₂ + LIPUS groups than those in the control group at all time points and was also higher in the CO₂ + LIPUS group than those in the LIPUS and CO₂ groups at week 2. The gene expression of eNOS at week 2 was higher in the CO₂ + LIPUS group than those in the control and LIPUS groups. There were no significant differences in TSP-1 expression levels among the groups at any time point.

Biomechanical assessment

The three biomechanical assessment parameters at week 4 are shown in Fig. 4. The ultimate stress and extrinsic stiffness were significantly higher in the LIPUS, CO₂, and CO₂ + LIPUS groups than those in the control group. The ultimate stress was also higher in the CO₂ + LIPUS group than those in the LIPUS and CO₂ groups. The failure energy was higher in the CO₂ + LIPUS group than that in the control group.

LIPUS therapy is a non-invasive treatment that can shorten the bone healing period by mechanical stimulation of the fracture site with pulsed ultrasound waves emitted from a probe placed on the body surface. The promotion of fracture healing has been proven in rat and rabbit fracture models [26, 27], and LIPUS has been shown to be effective throughout the fracture healing process, including the inflammation, reparative, and remodeling phases [28]. LIPUS enhances the gene expression of ALP and Runx2 in rat bone marrow-derived stromal cells [8], promotes osteoblast differentiation [9], increases the expression of osterix in ROS17/2.8, a rat osteoblast-like cell line [29], and upregulates VEGF expression around the fracture site in a rat fracture model [30]. It has also been reported to promote the expression of collagen II in human chondrocytes [31] but reduce the expression of MMP-13, which is necessary for normal bone regeneration through proper resorption of hypertrophic cartilage and endochondral ossification [32]. On the other hand, CO₂ therapy has been reported to have therapeutic effects in various pathological conditions. Carbonated spring has long been applied to the treatment of peripheral arterial disease as it is expected to increase blood flow [33]. In recent years, transcutaneous application of CO₂ has been used in the treatment of wounds such as bedsores and skin ulcers [34]. We have designed a system for local absorption of CO₂ through the skin using a hydrogel in which CO₂ is readily dissolved and reported that transcutaneous application of CO₂ has a tissue regenerative effect via local tissue oxygenation by the Bohr effect, which is expressed as a shift in the oxygen dissociation curve of hemoglobin with pH and CO₂ concentration, increased blood flow, and angiogenesis [12]. We have also demonstrated that transcutaneous application of CO₂ promotes bone healing in a rat femur fracture model and a diabetic rat fracture model [35] and concluded that this is achieved by increasing angiogenesis, promoting endochondral ossification, and differentiating osteoblasts. There are only a few reports on combination therapy to promote fracture healing [36, 37], and to our knowledge, this is the first report on the combination therapy of transcutaneous CO₂ application and LIPUS. In this study, the combination of transcutaneous CO₂ application and LIPUS treatment was superior to the control in all assessments. In addition, the combination therapy had a significantly higher score on the radiographic evaluation of RUST at weeks 1, 2, and 4, gene expression of VEGF at week 2 and Runx2 at week 3 on real-time PCR, and ultimate stress at week 4 on mechanical evaluation than monotherapy. In summary, these results suggest that transcutaneous CO₂ application in combination with LIPUS can accelerate fracture healing.

Radiographic assessment of the combination group showed early callus formation at week 1, bridging callus formation in the four cortices in the anteroposterior and lateral views in 80% of samples at week 2 and in all samples at week 3, and complete disappearance of the fracture lines in all week 4 samples. In contrast, in the LIPUS or CO₂ monotherapy groups, callus formation began at week 2 in most samples, callus bridging in all four cortices was not obtained in some samples at week 3, and callus bridging was completed at week 4, although the fracture lines did not completely disappear. In the control group, there were no cases of callus bridging in all of the four bone cortices at week 2, and only 30% at week 3 achieved bone union. As with monotherapy, callus bridging was observed at week 4, but the fracture lines did not completely disappear. Only the combined group at weeks 2 and 3 and the CO₂ monotherapy group at week 3 showed significant differences in bone union rates from the control group. RUST demonstrated significantly higher scores in the combination therapy group than in the other three groups at weeks 1, 2, and 4. At week 3, the combination group and CO₂ monotherapy group showed significant differences from the control group, whereas the LIPUS monotherapy group showed no difference. These radiographic results indicated that combination therapy significantly accelerated fracture healing compared to monotherapy at most time points. In addition, the femurs that were treated with combination therapy were mechanically stronger than those treated with monotherapies, as the combination therapy outperformed the monotherapies at week 4 of ultimate stress. The Allen’s grading system scores in histological evaluation showed that combination therapy had comparable or better scores at all time points than monotherapies, although no significant differences were observed.

The fracture healing process consists of three main stages: the inflammatory phase, reparative phase, and remodeling phase, in which various types of cells cooperate to repair the tissue [38]. In the inflammatory phase, a hematoma is formed immediately after the fracture and fills the defect between the bone fragments and the area around the fracture. Inflammatory cells, such as macrophages and lymphocytes, and mesenchymal cells infiltrate the hematoma [39]. Local oxygen deprivation due to vascular injury stimulates the expression of hypoxia-inducible factor (HIF), which induces VEGF expression. VEGF plays an important role in angiogenesis and blood flow, which are essential for fracture repair [40, 41]. It has been reported that LIPUS causes an increased VEGF expression through nitric oxide and HIF 1-alpha [42], and VEGF is induced by acidosis in cells around the fracture site [43]. We previously reported that transcutaneous CO₂ application increased local oxygen partial pressure via the Bohr effect, resulting in a lower local pH [12]. In this study, VEGF expression was upregulated in the combination therapy group compared to that in the control group at all time points and in either monotherapy with LIPUS or CO₂ at week 2. These results suggest that the combination of LIPUS and CO₂ treatments has a superior effect in stimulating VEGF expression compared to monotherapies. eNOS is known to be involved in vasodilation and osteoblast maturation [44] and is upregulated by increased blood flow and VEGF [45]. In the current study, the gene expression of eNOS at week 2 was higher in the combination therapy group than in the control and LIPUS groups, although there was no significant difference between the LIPUS and CO₂ groups. These results suggest that the addition of CO₂ transcutaneous application could accelerate fracture repair promotion by LIPUS through vasodilation and osteoblast maturation and activation.

In the reparative phase, undifferentiated mesenchymal cells, osteoblast progenitor cells, and new blood vessels that are induced in the injured area begin to repair the damaged area. In the deep area under the periosteum and bone marrow with inadequate blood supply and low oxygen concentration, osteoblast progenitor cells are not induced, and chondrocytes appear. In the early stages of chondrogenesis during the reparative phase, mesenchymal stem cells form a chondrogenic matrix containing collagen II. The chondrogenic matrix proliferates and the center of the matrix differentiates into chondrocytes. After the formation of the cartilage matrix, collagen II expression decreases, collagen X expression increases, and chondrocytes mature into hypertrophic chondrocytes [46]. In our study, only the combined treatment group showed a significantly higher expression of collagen II than the control group at week 1, and the three groups other than the control group demonstrated significantly higher expression of collagen II at week 2. As for collagen X, the combined treatment group had significantly higher expression than the LIPUS and control groups at week 2. These results of real-time PCR were consistent with those of histological evaluation that higher Allen’s grading system scores were obtained in the combined therapy group than in the control group at all time points except week 1, and those in both monotherapies exceeded the control group only at week 3. The statistically significant difference between the combination therapy and either monotherapy was found to be small; however, it could be interpreted that these results indirectly demonstrated a superior chondrogenic differentiation accelerating effect in the combination therapy to not only the control groups but also monotherapies. MMP-13 is required for the proper resorption of hypertrophic cartilage and normal bone remodeling during endochondral ossification [47]. It has been reported that MMP-13 is upregulated by transcutaneous CO₂ application in bone fractures of diabetic rats [35] and downregulated by LIPUS in a rabbit knee osteoarthritis model [48]. In our study, MMP-13 expression at week 3 was higher in the combination and LIPUS groups than in the control group, and it was not significantly downregulated by LIPUS. The reason why no negative influence on MMP-13 expression by LIPUS was detected might be that the animal model of the current study was not an osteoarthritis model or that Runx2, which is reported to increase MMP-13 expression [49], was upregulated by LIPUS and transcutaneous CO₂ application. At least, it could be considered that LIPUS did not interfere with the increasing effect of CO₂ on MMP-13 expression in the current study.

ALP, Runx2, and osterix play important roles in osteoblast differentiation and bone formation. The gene expression levels of ALP and Runx2, osteogenic markers of the early stage, demonstrated significant differences among the groups at weeks 2 and 3. As for ALP at weeks 2 and 3, the three groups other than the control group showed significantly higher expression. Regarding Runx2, the combination and CO₂ alone groups had higher expression than the other two groups at week 2, and the combination group significantly exceeded all three other groups at week 3. This suggests that combination therapy and CO₂ alone significantly promoted osteoblast differentiation more than the other two groups up to week 2; at week 3, combination therapy promoted differentiation more than CO₂ alone. The gene expression levels of osterix, an osteogenic marker of late-stage [50], were also higher in the combination therapy group at week 3, and there was no significant difference among the three groups other than the control group. The gene expression assessment suggests that combination therapy upregulates angiogenesis early in the healing process and osteogenesis in the middle to late stages by promoting osteoblast differentiation, resulting in accelerated fracture healing.

Although not the main purpose of this study, a direct comparison between transcutaneous CO₂ application and LIPUS treatment showed a significant difference only in the gene expression during osteoblast differentiation. Therefore, it can be inferred that there was no significant difference between these two monotherapies in terms of promoting fracture healing.

This study has some limitations. First, in this study, the effects were only assessed using male rats, and the results might be different if female rats or other animals were used. Second, transcutaneous CO₂ application and LIPUS could not be performed simultaneously because of procedural difficulties. In terms of clinical application, the combination treatment used in this study requires a long intervention time of 40 min per day, which might be a heavy burden for patients. It is possible that combination therapy can be performed simultaneously in larger animals; however, further studies are needed.

The combination therapy of transcutaneous CO₂ application and LIPUS had a superior effect in promoting fracture healing through the promotion of angiogenesis and osteoblast differentiation compared to the monotherapies. More research on the mechanisms of transcutaneous CO₂ application and animal-to-human translational studies are needed before it can be used in clinical practice in the future. However, the combination of transcutaneous CO₂ application and LIPUS has the potential to accelerate fracture healing and may be more beneficial to patients than monotherapy.

Ethics approval: This study was approved by the Institutional Animal Care and Use Committee (Permission number: P180609) and carried out according to the Kobe University Animal Experimentation Regulation.

Consent for publication: Not applicable.

Availability of data and materials: The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Competing interest: The authors declare that they have no competing interests.

Funding: No funding was received for this study.

Author contributions: TF, KO, and TN conceived and designed the study; acquired, analyzed, and interpreted the data; and drafted and critically revised the manuscript. RK conceived and designed the study and drafted and critically revised the manuscript. KS acquired, analyzed, and interpreted the data and drafted and revised the manuscript. TO, RY, KT, YY, SI, TM, TM, and SH acquired, analyzed, and interpreted the data. All authors read and approved the final manuscript.

Acknowledgments: We thank Minako Nagata and Maya Yasuda for their kind support with histological assessment and real-time RT-PCR assessment. We would like to thank Editage (www.editage.jp) for English language editing.

Zura R, Xiong Z, Einhorn T, Watson JT, Ostrum RF, Prayson MJ, et al. Epidemiology of Fracture Nonunion in 18 Human Bones. JAMA Surg. 2016;151:e162775.
Giannoudis PV, Einhorn TA, Marsh D. Fracture healing: the diamond concept. Injury. 2007;38:S3-6.
Giannoudis PV, Einhorn TA, Schmidmaier G, Marsh D. The diamond concept–open questions. Injury. 2008;39:S5-8.
Heckman JD, Ryaby JP, McCabe J, Frey JJ, Kilcoyne RF. Acceleration of tibial fracture-healing by non-invasive, low-intensity pulsed ultrasound. J Bone Joint Surg Am. 1994;76:26–34.
Kim SJ, Park HS, Lee DW, Lee JW. Short-term daily teriparatide improve postoperative functional outcome and fracture healing in unstable intertrochanteric fractures. Injury. 2019;50:1364–1370.
Govender S, Csimma C, Genant HK, Valentin-Opran A, Amit Y, Arbel R, et al. Recombinant human bone morphogenetic protein-2 for treatment of open tibial fractures: a prospective, controlled, randomized study of four hundred and fifty patients. J Bone Joint Surg Am. 2002;84:2123–2134.
Harrison A, Lin S, Pounder N, Mikuni-Takagaki Y. Mode & mechanism of low intensity pulsed ultrasound (LIPUS) in fracture repair. Ultrasonics. 2016;70:45–52.
Sant’Anna EF, Leven RM, Virdi AS, Sumner DR. Effect of low intensity pulsed ultrasound and BMP-2 on rat bone marrow stromal cell gene expression. J Orthop Res. 2005;23:646–652.
Sena K, Leven RM, Mazhar K, Sumner DR, Virdi AS. Early gene response to low-intensity pulsed ultrasound in rat osteoblastic cells. Ultrasound Med Biol. 2005;31:703–708.
Barzelai S, Sharabani-Yosef O, Holbova R, Castel D, Walden R, Engelberg S, et al. Low-intensity ultrasound induces angiogenesis in rat hind-limb ischemia. Ultrasound Med Biol. 2006;32:139–145.
Oe K, Ueha T, Sakai Y, Niikura T, Lee SY, Koh A, et al. The effect of transcutaneous application of carbon dioxide CO₂ on skeletal muscle. Biochem Biophys Res Commun. 2011;407:148–152
Sakai Y, Miwa M, Oe K, Ueha T, Koh A, Niikura T, et al. A novel system for transcutaneous application of carbon dioxide causing an “artificial Bohr effect” in the human body. PLoS One. 2011;6:e24137.
Koga T, Niikura T, Lee SY, Okumachi E, Ueha T, Iwakura T, et al. Topical cutaneous CO₂ application by means of a novel hydrogel accelerates fracture repair in rats. J Bone Joint Surg Am. 2014;96:2077–2084.
Kumabe Y, Fukui T, Takahara S, Kuroiwa Y, Arakura M, Oe K, et al. Percutaneous CO₂ Treatment Accelerates Bone Generation During Distraction Osteogenesis in Rabbits. Clin Orthop Relat Res. 2020;478:1922–1935.
Kuroiwa Y, Fukui T, Takahara S, Lee SY, Oe K, Arakura M, et al. Topical cutaneous application of CO₂ accelerates bone healing in a rat femoral defect model. BMC Musculoskelet Disord. 2019;20:237
Bonnarens F, Einhorn TA. Production of a standard closed fracture in laboratory animal bone. J Orthop Res. 1984;2:97–101.
Clatworthy MG, Clark DI, Gray DH, Hardy AE. Reamed versus unreamed femoral nails. A randomised, prospective trial. J Bone Joint Surg Br. 1998;80:485–489.
Kooistra BW, Dijkman BG, Busse JW, Sprague S, Schemitsch EH, Bhandari M. The radiographic union scale in tibial fractures: reliability and validity. J Orthop Trauma. 2010;24:S81-86.
Fiset S, Godbout C, Crookshank MC, Zdero R, Nauth A, Schemitsch EH. Experimental Validation of the Radiographic Union Score for Tibial Fractures (RUST) Using Micro-Computed Tomography Scanning and Biomechanical Testing in an in-Vivo Rat Model. J Bone Joint Surg Am. 2018;100:1871–1878.
Tawonsawatruk T, Hamilton DF, Simpson AH. Validation of the use of radiographic fracture-healing scores in a small animal model. J Orthop Res. 2014;32:1117–1119..
Cooke ME, Hussein AI, Lybrand KE, Wulff A, Simmons E, Choi JH, et al. Correlation between RUST assessments of fracture healing to structural and biomechanical properties. J Orthop Res. 2018;36:945–953.
Allen HL, Wase A, Bear WT. Indomethacin and aspirin: effect of nonsteroidal anti-inflammatory agents on the rate of fracture repair in the rat. Acta Orthop Scand. 1980;51:595–600.
Melikian N, Seddon MD, Casadei B, Chowienczyk PJ, Shah AM. Neuronal nitric oxide synthase and human vascular regulation. Trends Cardiovasc Med. 2009;19:256–262.
Lawler PR, Lawler J. Molecular basis for the regulation of angiogenesis by thrombospondin-1 and – 2. Cold Spring Harb Perspect Med. 2012;2:a006627.
Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25:402–408.
Duarte LR. The stimulation of bone growth by ultrasound. Arch Orthop Trauma Surg. 1983;101:153–159.
Yang KH, Parvizi J, Wang SJ, Lewallen DG, Kinnick RR, Greenleaf JF, et al. Exposure to low-intensity ultrasound increases aggrecan gene expression in a rat femur fracture model. J Orthop Res. 1996;14:802–809.
Azuma Y, Ito M, Harada Y, Takagi H, Ohta T, Jingushi S. Low-intensity pulsed ultrasound accelerates rat femoral fracture healing by acting on the various cellular reactions in the fracture callus. J Bone Miner Res. 2001;16:671–680.
Takayama T, Suzuki N, Ikeda K, Shimada T, Suzuki A, Maeno M, et al. Low-intensity pulsed ultrasound stimulates osteogenic differentiation in ROS 17/2.8 cells. Life Sci. 2007;80:965–971.
Cheung WH, Leung KS, Chow SK. Ultrasound and fragility fracture: is there a role? Injury. 2016;47:S39-42.
Mukai S, Ito H, Nakagawa Y, Akiyama H, Miyamoto M, Nakamura T. Transforming growth factor-beta1 mediates the effects of low-intensity pulsed ultrasound in chondrocytes. Ultrasound Med Biol. 2005;31:1713–1721.
Sekino J, Nagao M, Kato S, Sakai M, Abe K, Nakayama E, et al. Low-intensity pulsed ultrasound induces cartilage matrix synthesis and reduced MMP13 expression in chondrocytes. Biochem Biophys Res Commun. 2018;506:290–297.
Hartmann BR, Bassenge E, Hartmann M. Effects of serial percutaneous application of carbon dioxide in intermittent claudication: results of a controlled trial. Angiology. 1997;48:957–963.
Piazzolla LP, Louzada LL, Scoralick FM, Martins ME, de Sousa JB. Preliminary experience with carbon dioxide therapy in the treatment of pressure ulcers in a bedridden elderly patient. J Am Geriatr Soc. 2012;60:378–379.
Oda T, Niikura T, Fukui T, Oe K, Kuroiwa Y, Kumabe Y, et al. Transcutaneous CO₂ application accelerates fracture repair in streptozotocin-induced type I diabetic rats. BMJ Open Diabetes Res Care. 2020;8:e001129..
Mansjur KQ, Kuroda S, Izawa T, Maeda Y, Sato M, Watanabe K, et al. The Effectiveness of Human Parathyroid Hormone and Low-Intensity Pulsed Ultrasound on the Fracture Healing in Osteoporotic. Bones Ann Biomed Eng. 2016;44:2480–2488.
Warden SJ, Komatsu DE, Rydberg J, Bond JL, Hassett SM. Recombinant human parathyroid hormone (PTH 1–34) and low-intensity pulsed ultrasound have contrasting additive effects during fracture healing. Bone. 2009;44:485–494..
Dimitriou R, Tsiridis E, Giannoudis PV. Current concepts of molecular aspects of bone healing. Injury. 2005;36:1392–1404.
Maruyama M, Rhee C, Utsunomiya T, Zhang N, Ueno M, Yao Z, et al. Modulation of the Inflammatory Response and Bone Healing. Front Endocrinol (Lausanne). 2020;11:386.
Hankenson KD, Dishowitz M, Gray C, Schenker M. Angiogenesis in bone regeneration. Injury. 2011;42:556–561.
Marsell R, Einhorn TA. The biology of fracture healing. Injury. 2011;42:551–555.
Wang FS, Kuo YR, Wang CJ, Yang KD, Chang PR, Huang YT, et al. Nitric oxide mediates ultrasound-induced hypoxia-inducible factor-1alpha activation and vascular endothelial growth factor-A expression in human osteoblasts. Bone. 2004;35:114–123.
D'Arcangelo D, Facchiano F, Barlucchi LM, Melillo G, Illi B, Testolin L, et al. Acidosis inhibits endothelial cell apoptosis and function and induces basic fibroblast growth factor and vascular endothelial growth factor expression. Circ Res. 2000;86:312–318.
Baum O, Da Silva-Azevedo L, Willerding G, Wöckel A, Planitzer G, Gossrau R, et al. Endothelial NOS is main mediator for shear stress-dependent angiogenesis in skeletal muscle after prazosin administration. Am J Physiol Heart Circ Physiol. 2004;287:H2300–2308.
Aguirre J, Buttery L, O'Shaughnessy M, Afzal F, Fernandez de Marticorena I, Hukkanen M, et al. Endothelial nitric oxide synthase gene-deficient mice demonstrate marked retardation in postnatal bone formation, reduced bone volume, and defects in osteoblast maturation and activity. Am J Pathol. 2001;158:247–257.
Shen G. The role of type X collagen in facilitating and regulating endochondral ossification of articular cartilage. Orthod Craniofac Res. 2005;8:11–17.
Behonick DJ, Xing Z, Lieu S, Buckley JM, Lotz JC, Marcucio RS, et al. Role of matrix metalloproteinase 13 in both endochondral and intramembranous ossification during skeletal regeneration. PLoS One. 2007;2:e1150.
Li X, Li J, Cheng K, Lin Q, Wang D, Zhang H, et al. Effect of low-intensity pulsed ultrasound on MMP-13 and MAPKs signaling pathway in rabbit knee osteoarthritis. Cell Biochem Biophys. 2011;61:427–434.
Wang X, Manner PA, Horner A, Shum L, Tuan RS, Nuckolls GH. Regulation of MMP-13 expression by RUNX2 and FGF2 in osteoarthritic cartilage. Osteoarthritis Cartilage. 2004;12:963–973.
Nakashima K, Zhou X, Kunkel G, Zhang Z, Deng JM, Behringer RR, et al. The novel zinc finger-containing transcription factor osterix is required for osteoblast differentiation and bone formation. Cell. 2002;108:17–29.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Transcutaneous CO₂ application combined with low-intensity pulsed ultrasound accelerates bone fracture healing in rats

Status:

Version 1

Abstract

Background

Methods

Results

Conclusions

Figures

Background

Methods

Animal model

Radiographic assessment

Histological assessment

Gene expression assessment

Biomechanical assessment

Statistics Analysis

Results

Radiographic assessment

Histological assessment

Gene expression assessment

Biomechanical assessment

Discussion

Conclusions

Declarations

References

Additional Declarations

Status:

Version 1