The role of Sonic Hedgehog pathway in the development of spinal cord injury in rat model

doi:10.21203/rs.3.rs-1884552/v2

Download PDF

Article

The role of Sonic Hedgehog pathway in the development of spinal cord injury in rat model

https://doi.org/10.21203/rs.3.rs-1884552/v2

This work is licensed under a CC BY 4.0 License

Version 2

posted

You are reading this latest preprint version

The purpose of this study was to explore whether and how the Shh pathway exert a neuroprotective effect in SCI. The SCI model of rat was established by a Allen's weight-drop method. Thirty rats were divided into 5 groups as follows: Control, Sham, SCI model, SCI + Shh activator, and SCI + Shh inbibitor. Rats in group of Shh activator or inbibitor were administrated with purmorphamine (10 mg/kg) or cyclopamine (10 mg/kg) respectively daily within one week after establishment of SCI model. Scores of BBB and Reuter were evaluated at the time-points of 1st, 3rd, 5th and 7th day. The pathological injury, the levels of IL-1β and TNF-α and the protein and mRNA expressions of Gli1, Shh and Smoothened in spinal cord tissue were assessed on 7th day, respectively. Rat treated with purmorphamine exhibited a significant increase in BBB score in comparison with SCI group. Interestingly, purmorphamine treatment declined SCI-induced increases in the levels of IL-1 β and TNF-α, whereas cyclopamine administration up-regulated their expressions of these inflammatory cytokines. The pyknotic neuronal cells in gray matter area of the spinal cord and the area of cavity in white matter area were reduced in purmorphamine treatment when compared with SCI group, whereas treatment with cyclopamine elicited an opposite changes. In conclusion, this study demonstrated that Shh activator plays an important protective role in the development of SCI in rat model, which might provide a new strategy via targeting Shh pathway to prevent or treat SCI in the future.

Health sciences/Medical research/Experimental models of disease

Health sciences/Diseases/Trauma

Sonic Hedgehog

spinal cord injury

inflammatory

Traumatic spinal cord injury (SCI) is a severely disabling condition, which brings a heavy burden on individuals, families, and society as a whole because of the loss of workforce, long-term rehabilitation, diversion of significant medical resources and expensive medical costs[1, 2]. The annual incidence of traumatic SCI worldwide is estimated ranged with 10.4ཞ83.0 cases per 1 million people[3, 4],while it was increased rapidly from 2009 (45.1 cases per million population) to 2018 (66.5 cases per million population) in China[5]. As a traumatic disease with high disability rate, SCI reduces the quality of life of patients to a great extent[6], while its clinical treatment is limited. Thus, it is very significant to explore the potential mechanisms of SCI development and effective treatments[7].

Sonic Hedgehog (Shh) is a multifunctional growth factor that exerts various functions through its binding with the smoothened and patched transmembrane proteins[8]. During embryogenesis in neural tissue, it promotes the differentiation of progenitor cells to neuronal or oligodendrocyte lineages, while it inhibits the differentiation of astrocytic lineage[9, 10]. Amankulor et al[11] have shown that Shh was induced in reactive astrocytes in mice following cerebral cortex injury and responded to neural tissue damage by regulating the proliferation of Olig2-expressing cells after brain injury. Previous studies have provided evidence that treatment with Shh activator improved neurological function in diabetic models of neuropathy[12]. Moreover, administration of exogenous Shh led to increased survival and proliferation of endogenous neural and oligodendrocyte precursors, and also potentially improved functional recovery in animal models of SCI [13–15]. Shh signaling pathway may play an important role in nerve regeneration after injury. However, its effects on neuroinflammation and neuroreparation after SCI and related mechanisms are still unclear. An in-depth understanding of the regulatory role of the Shh signaling pathway in the inflammatory response after SCI might be beneficial to clarify its pathological mechanisms and provide new strategies.

In our current study, we aimed to explore whether the Shh pathway exerts a neuroprotective effect by regulating neuroinflammation in a rat model of SCI.

2.1 Animal

Thirty SPF SD rats (male, weighing 180-220g) were purchased from Shanghai SLAC Laboratory Animal Co.,Ltd (Shanghai, China) [license number: SCXK (Shanghai) 2017-0005]. All rats were cultured in the environment of 12 h alternating light and dark, 20–25 ℃ and 40–70% relative humidity, and the rats had free access to food and water. After one week after adaptation, the rats were prepared for usage. The animal experiments in this study were approved by the Laboratory Animal Ethics Committee of Hangzhou HIBIO Technology Co.,LTD, and all animal care and experiments were conducted in accordance with the following Chinese laboratory animal standards: Guideline for ethical review of animal welfare [GB/T 35892 − 2018] and General requirements for animal experiment [GB/T 35823 − 2018].

2.2 A rat model establishment of SCI and Experimental Design

The SCI model of rat was generated with a modified Allen’s method as described in previous studies[16, 17]. In brief, we anesthetized the rats with intraperitoneal injection of pentobarbital (30mg/kg), and open the skin of the T9-11 spinous process on the back, separated the muscles on both sides of the spinous process to expose the spinous process and vertebral arch plate, and bite off the spinous process and lamina with rongeur to expose the spinal cord, and then hit the T10 spinal cord vertically with an Allen's batter with a hitting height of 5 cm, a weight of 10 g, and a diameter of 2 mm. The model was considered successful when there were contusions in the injured site, spasm of both lower limbs and continuous swinging of the tail[18]. The paraspinal muscles and skin of rats were sutured layer by layer. Within 1 h after SCI, all rats were intraperitoneally injected with penicillin 200 U/100g for 3 days. After operation, the bladder of the rats was squeezed to perform artificial urinary aid until the spontaneous urination of the rats was restored.

Rats were divided into following groups: Control group, in which rats were received no surgical treatment or drug intervention; Sham group, in which the spinal cord of rats was exposed but not injured according to the above methods; SCI group, in which the rats were established of SCI model; SCI + Activator group, in which Shh Activator purmorphamine (10 mg/kg) was injected intraperitoneally every day for one week after establishment of SCI model; SCI + Inhibitor group, in which Shh inhibitor cyclopamine (10 mg/kg) was injected intraperitoneally every day for one week after establishment of SCI model.

2.3 Behavioral scores

The functional scores of rats were evaluated on the 1st, 3rd, 5th and 7th day after SCI. The evaluation criteria of hindlimb motor function are based on the 21-point Basso, Beattie, Bresnahan (BBB) locomotor rating scale[18, 19]. The evaluation criteria of hindlimb muscle tension, motor and sensory function and spinal cord reflex function are based on the 11-point Reuter scoring system[20, 21]. The behavioral scores were performed by three colleagues who were blind to our current study, and then the average value was calculated.

2.4 ELISA

The levels of IL-1β and TNF-α were detected by ELISA kits (Jianglaibio, Shanghai, China) according to the manufacturer’s protocols.

2.5 HE staining of spinal cord tissue

Paraffin-embedded spinal cord tissue sections (5 µm) were stained with H&E (Sigma-Aldrich) to observe pathomorphological changes on the 7th day after SCI.

2.6 Western Blot

Isolated injured spinal cord tissues were homogenized and lysed. Equal amounts of proteins were boiled and separated by SDS-PAGE and subsequently transferred to polyvinylidene fluoride membrane. The blots were incubated with primary antibodies at 4℃ overnight after blocking. Western blotting bands were detected using electrochemiluminescence. The dilutions of primary antibodies were 1:1000 for Gli (Santa Cruz Biotechnology), 1:1000 for Shh (Cell Signaling Technology), 1:10,000 for Smo (Santa Cruz Biotechnology), and 1:1000 for GAPDH (Beoytime). Horseradish peroxidase-conjugated secondary antibodies were used at 1:5000.

2.7 RT-qPCR

Total RNA was extracted from the injured spinal cord tissues with Trizol reagent according to the manufacturer’s protocol. One microgram RNA was reverse-transcribed into cDNA using the Prim Script RT. After reverse transcription, quantitative real-time PCR was performed using ChamQ SYBR Color qPCR Master Mix. Primer sequences for the analyzed genes were shown in Table 1.

Table 1

Primer Sequences
Gli 1	forward	TCCCCAGCATGGGAACAGAA
	reverse	GAGGAAAGAGTGACCCCTCAGT
Shh	forward	GGGAATGGCAGTCAAGTCCA
	reverse	CGCTTTCCCGGTTGCTTATC
Smo	forward	CGTGAGTGGCATCTGCTTTG
	reverse	CAGAGTCATGACCCCTCGGA
β-Actin	forward	CCCATCTATGAGGGTTACGC
	reverse	TTTAATGTCACGCACGATTTC

2.8 Statistical analysis

The data were expressed as mean ± standard deviation and analyzed by SPSS 24.0 software. One-way ANOVA or two-way ANOVA and Turkey test were used for comparison among groups. The difference was statistically significant as a P value < 0.05.

3.1 Shh activator can improve functional recovery after SCI in rats.

After the establishment of the model, all rats were paralyzed in both lower limbs, displaying no activity, decreased muscle tension below the injury plane, and no obvious response to acupuncture. These rats showed less activity, less intake of food and water, and urinary retention, accompanied with hematuria, pyuria, abdominal flatulence, defecation difficulty, a few appeared urinary incontinence, limb autophagy and so on. No rats in the sham group showed neurologic impairment symptoms. BBB scores were significantly lower, while Retuer scores were significantly higher in SCI group at indicated timepoints of 1 day, 3 days, 5 days and 7 days after SCI in comparison with Sham group (all P < 0.001) (Fig. 1A, B). Compared to the SCI group, purmorphamine treatment showed significantly improved BBB score and Retuer score from the third day after SCI (P < 0.01) (Fig. 1A, B). However, cyclopamine treatment had no significant effects on the SCI-induced decrease or increase in BBB score and Reture score (Fig. 1A, B).

3.2 Shh activator can reduce inflammation after SCI in rats.

Spinal cord expression of IL-1 β and TNF-α were significantly enhanced in the SCI group compared with the Sham group on the 7th days (11.90 ± 1.79 vs. 1.93 ± 0.31, 125.54 ± 15.15 vs. 22.67 ± 5.73 respectively, both P < 0.01). In comparision with the SCI group, the expressions of IL-1 β and TNF-α were significantly reduced after purmorphamine treatment(6.98 ± 0.82 vs.11.90 ± 1.79, and 75.32 ± 12.23 vs. 125.54 ± 15.15 respectively, both P < 0.01), while cyclopamine treatment significantly increased the expressions of IL-1β and TNF-α (15.83 ± 3.57 vs. 11.90 ± 1.79, and 160.99 ± 26.63 vs. 125.54 ± 15.15 respectively, both P < 0.01) (Fig. 2A, B).

3.3 Shh activator improves the histopathological changes of spinal cord after SCI in rats

Normal pathological structures of spinal cord tissue were observed in both Control group (Fig. 3A) and Sham group (Fig. 3B). In SCI group, severe pathological damage, evidenced by the severely pyknotic neuronal cells in gray matter area, small area hemorrhage, macrophage infiltration, and white matter demyelination to cavity formation were observed (Fig. 3C), whereas these changes was reduced after purmorphamine treatment (Fig. 3C, E). However, cyclopamine treatment further promoted the SCI-induced injury of spinal cord tissue, with most serious lesions characterized by hemorrhagic necrosis of the central gray matter of the spinal cord, disappearance of structure, severe pyknosis of neurons, infiltration of many inflammatory cells, and demyelination to cavity formation in the white matter area (Fig. 3C, D).

3.4 The improvement of SCI in rats is related to the activation of Shh pathway.

As shown in Fig. 4, the protein and mRNA levels of Gli1, Shh, Smo in SCI group were significantly higher than those in Sham group (0.55 ± 0.06 vs. 0.11 + 0.00, 0.55 ± 0.03 vs. 0.14 ± 0.01, and 0.47 ± 0.11 vs. 0.09 ± 0.00 respectively, all P < 0.01), whereas these SCI-induced increases in protein and mRNA expression levels of Gli1, Shh, Smo were further increased significantly after purmorphamine treatment (1.00 ± 0.01 vvs. 0.55 ± 0.06, 0.98 ± 0.06 vs. 0.55 ± 0.03, and 1.01 ± 0.02 vs. 0.47 ± 0.11 respectively, all P < 0.01), but decreased significantly after cyclopamine treatment (0.29 ± 0.03 vs. 0.55 ± 0.06, 0.30 ± 0.03 vs. 0.55 ± 0.03, and 0.29 ± 0.02 versus vs.0.47 ± 0.11 respectively, all P < 0.01).

In the present study, we demonstrated that purmorphamine can improve functional recovery and histopathological changes of spinal cord after SCI in rats. Injury- induced inflammation can result in neuropathology after traumatic SCI. The present study provides evidence that purmorphamine may be able to protect injured spinal cord tissue by reducing the inflammatory response after SCI in rats. Furthermore, the improvement of SCI in rats is related to the activation of Shh pathway.

Assessment of neurological function is a common method to evaluate the extent of injury and the efficacy of treatment with medication. The results in Zhang’s study [22] showed that exogenous Shh could improve the functional recovery measured by the changes of BBB score after SCI. In the present study, results from BBB and Retuer scores indicated a significant improvement of locomotion occurring everyday post-treatment, suggesting that Shh activator treatment may improve the behavioral function in rats with SCI. Several studies[22, 23] have confirmed the evidence of edema, hyperemia, and incompact structure in SCI tissue. We also observed the same results in the rat model of SCI and found that Shh Activator significantly improved SCI. However, Shh inbibitor treatment further promoted the SCI-induced injury of spinal cord tissue. These results suggest that Shh pathway invlove a protective role of the histopathological changes of spinal cord after SCI in rats.

The secondary injury cascade in spinal cord injury includes neurogenic shock, vascular injury, cell death (necrosis and apoptosis), excitotoxicity, mitochondrial dysfunction, calcium-mediated secondary injury, inflammation, and various other processes [24]. Inflammation plays an important role in progressive secondary injury leading to neurological deficits [25]. The inflammatory response that occurs after SCI is mediated by immune cells, which cause secondary injury and inflammation through the release of cytokines such as tumor necrosis factor, interleukin-6, interleukin-1[26]. TNF-α is a key initiating factor in inflammatory response, which plays a pivotal role in inflammatory response and can regulate the expression level of other cytokines[27]. IL-1β is the main regulatory factor in inflammatory response. In the early stage of SCI, the level of IL-1β in local spinal cord tissue increased rapidly, and earlier than inflammatory cell infiltration, which was one of the main causes of neuronal apoptosis[28]. Zhang et al[29] found that activation of Shh pathway by silencing Patched-1 and Patched-2 may reduce inflammation and may ultimately promote SCI recovery. In the current study, we observed a significant increases in TNF-α and IL-1β expression after SCI. Purmorphamine treatment significantly decreased the SCI-induced up-regulations of TNF-α and IL-1β expressions, whereas cyclopamine administration up-regulated these expression of such cytokines. These results suggest that Shh activator could inhibit the inflammatory response after SCI and alleviate the further damage of spinal cord tissue structure, which is beneficial to the recovery of spinal cord function.

The Shh pathway is involved in the processes of embryonic morphogenesis, neuronal guidance, and tissue repair in mammals [30, 31]. It mainly includes four important signal molecules: secretory protein Shh, transmembrane receptor Ptch, transmembrane protein Smo and nuclear transcription factor Gli1. Sims et al[32] found that the expression of Shh and Gli-1 in the subgranular area of hippocampal dentate gyrus increased significantly after focal cerebral ischemia. In this study, Shh showed low expression in normal rats, and the Shh pathway was activated after SCI, which was highly consistent with the increased expression of Shh, Smo, Gli1 and other proteins observed in previous experiments[29], suggesting that Shh may be involved in the regulation of nerve repair after SCI. Some studies[33] have also shown that intracerebroventricular injection of human recombinant Shh can promote the activation of Shh pathway, thus reduce the degree of brain edema after cerebral ischemia, protect the blood-brain barrier and reduce the infarct size. In this study, Shh activator can activate Shh signal transduction pathway, including up-regulating the expression of Shh, Smo and Gli1 in Shh pathway. This concurs well with previous findings. Combining with the aforementioned modulation of inflammation by Shh pathway and changes in the rehabilitation outcome of the spinal cord, a schematic diagram of the possible mechanisms by which the Shh pathway regulates spinal cord repair after SCI is shown in Fig. 5.

Our study has also some limitations. First, we only performed behavioral observations on the first week after spinal cord injury in rats, and the observation time was short. Second, we only described the effects of Shh activator and inhibitors on inflammation and pathology in SCI model rats on the 7th day, but the dynamic changes by treatment of Shh activator or inhibitors were not observated. Third, the number of inflammatory factor indicators was low in the study and inhibitory inflammatory factors were not included, so the results were not comprehensive.

In conclusion, Shh pathway might elicit an important role in the development of SCI in rat model. Shh activator can significantly improve the morphology damage and function recovery after SCI via inhibiting inflammation.Thus, we provide a new strategy via targeting the Shh pathway for clinical treatment of SCI in the furture.

Acknowledgements

Not applicable.

AUTHOR CONTRIBUTION

Weiting Chen performed the experiments and wrote the paper; Aini Lin and Bin Lin collected and analyzed the data; Min Tang and Jianping Chen designed the figure legends; Weiting Chen, Bin Lin, Hongyang Wang gave guidance on experimental technology; Weiting Chen Yesong Wang and Gensheng Zhang conceived the study. All authors read and approved the final manuscript.

Funding

This work was supported by grants from the Traditional Chinese Medicine of Zhejiang Province (2021ZB331), Science and Technology Planning Project of Taizhou (21ywb116), Science and Technology Planning Project of Wenling (2020S0180027), Science and Technology Planning Project of Wenling (2021S00124).

Data Availability

The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request.

Ethical approval

The work was supported by the Declaration of Helsinki and approved by the Laboratory Animal Ethics Committee of Hangzhou HIBIO Technology Co.,LTD. The animal study protocol was approved by the Ethics Committee (HB2104028).

Conflicts of interest

The authors declare that they have no competing interests.

Chamberlain, J. D., O. Deriaz, M. Hund-Georgiadis, S. Meier, A. Scheel-Sailer, M. Schubert, G. Stucki, and M. W. Brinkhof. 2015. Epidemiology and contemporary risk profile of traumatic spinal cord injury in Switzerland. Injury Epidemiology 2: 28. https://doi:10.1186/s40621-015-0061-4.
Singh, A., L. Tetreault, S. Kalsi-Ryan, A. Nouri, and M. G. Fehlings. 2014. Global prevalence and incidence of traumatic spinal cord injury. Clinical Epidemiology 6: 309–331. http://doi:10.1017/s0317167100014530.
J Jazayeri, S. B., S. Beygi, F. Shokraneh, E. M. Hagen, and V. Rahimi-Movaghar. 2015. Incidence of traumatic spinal cord injury worldwide: a systematic review. European Spine Journal 24: 905–918. http://doi:10.1007/s00586-014-3424-6.
Jackson, A. B., M. Dijkers, M. J. Devivo, and R. B. Poczatek. 2004. A demographic profile of new traumatic spinal cord injuries: change and stability over 30 years. Archives of Physical Medicine and Rehabilitation 85: 1740–1748. http://doi:10.1016/j.apmr.2004.04.035.
Hao, D., J. Du, L. Yan, B. He, X. Qi, S. Yu, J. Zhang, W. Zheng, R. Zhang, D. G. Huang, et al. 2021. Trends of epidemiological characteristics of traumatic spinal cord injury in China, 2009–2018. European Spine Journal 30: 3115–3127. http://doi:10.1007/s00586-021-06957-3.
Stephan, K., S. Huber, S. Häberle, K. G. Kanz, V. Bühren, M. van Griensven, B. Meyer, P. Biberthaler, R. Lefering, and S. Huber-Wagner. 2015. Spinal cord injury–incidence, prognosis, and outcome: an analysis of the TraumaRegister DGU. Spine Journal 15: 1994–2001. http://doi:10.1016/j.spinee.2015.04.041.
Snyder, R., T. Verla, and A. E. Ropper. 2020. Practical Application of Recent Advances in Diagnostic, Prognostic, and Therapeutic Modalities for Spinal Cord Injury. World Neurosurgery 136: 330–336. http://doi:10.1016/j.wneu.2020.01.011.
Kenney, Anna Marie and David H. Rowitch. Sonic hedgehog Promotes G1 Cyclin Expression and Sustained Cell Cycle Progression in Mammalian Neuronal Precursors. Molecular & Cellular Biology 20: 9055. http://doi:10.1128/MCB.20.23.9055-9067.2000.
Jessell, Thomas, and M. 2000. Neuronal specification in the spinal cord: inductive signals and transcriptional codes. Nature Reviews Genetics 1:20–29. http://doi:10.1038/35049541.
Caroline, R., Sussman, Jeannette, E., Davies, Robert, H., and Miller. 2002. Extracellular and intracellular regulation of oligodendrocyte development: Roles of Sonic hedgehog and expression of E proteins. Glia 40: 55–64. http://doi:10.1002/glia.10114.
Amankulor, N. M., Stephanie M. Hambardzumyan D Fau - Pyonteck, Oren J. Pyonteck Sm Fau - Becher, Johanna A. Becher Oj Fau - Joyce, Eric C. Joyce Ja Fau - Holland, and E. C. Holland. 2009. Sonic hedgehog pathway activation is induced by acute brain injury and regulated by injury-related inflammation. Journal of Neuroscience 33: 10299–10308. http://doi:10.1523/JNEUROSCI.2500-09.2009.
Kusano, K. F., William Allendoerfer Kl Fau - Munger, Roberto Munger W Fau - Pola, Marta Pola R Fau - Bosch-Marce, Rudolf Bosch-Marce M Fau - Kirchmair, Young-sup Kirchmair R Fau - Yoon, Cynthia Yoon Ys Fau - Curry, Marcy Curry C Fau - Silver, et al. Losordo. 2004. Sonic hedgehog induces arteriogenesis in diabetic vasa nervorum and restores function in diabetic neuropathy. Arteriosclerosis Thrombosis & Vascular Biology 24: 2102–2107. http://doi:10.1161/01.ATV.0000144813.44650.75.
Bambakidis, N. C., E. M. Horn, P. Nakaji, N. Theodore, E. Bless, T. Dellovade, C. Ma, X. Wang, M. C. Preul, S. W. Coons, et al. 2009. Endogenous stem cell proliferation induced by intravenous hedgehog agonist administration after contusion in the adult rat spinal cord. Journal of Neurosurgery Spine 10: 171–176. http://doi:10.3171/2008.10.SPI08231.
Lowry, N., S. K. Goderie, P. Lederman, C. Charniga, M. R. Gooch, K. D. Gracey, A. Banerjee, S. Punyani, J. Silver, R. S. Kane, et al. 2012. The effect of long-term release of Shh from implanted biodegradable microspheres on recovery from spinal cord injury in mice. Biomaterials 33: 2892–2901. http://doi:10.1016/j.biomaterials.2011.12.048.
Bambakidis, N. C., X. Wang, R. J. Lukas, R. F. Spetzler, V. K. Sonntag, and M. C. Preul. 2010. Intravenous hedgehog agonist induces proliferation of neural and oligodendrocyte precursors in rodent spinal cord injury. Neurosurgery 67: 1709–1715. http://doi:10.1227/NEU.0b013e3181f9b0a5.
Allen, A. R. 1911. Surgery of experimental lesion of spinal cord equivalent to crush injury of fractured is location of spinal column. The Journal of the American Medical Association 11: 878–880. http://doi:10.1001/jama.1911.04260090100008.
Fan, Y. and Y. Wu. 2017. Tetramethylpyrazine alleviates neural apoptosis in injured spinal cord via the downregulation of miR-214-3p. Biomedicine Pharmacother 94: 827–833. http://doi:10.1016/j.biopha.2017.07.162.
Zeng, H., N. Liu, Y. Y. Yang, H. Y. Xing, X. X. Liu, F. Li, G. Y. La, M. J. Huang, and M. W. Zhou. Lentivirus-mediated downregulation of α-synuclein reduces neuroinflammation and promotes functional recovery in rats with spinal cord injury. Journal of Neuroinflammation 16: 283. http://doi:10.1186/s12974-019-1658-2.
Basso, D. M., M. S. Beattie, and J. C. Bresnahan. 1995. A sensitive and reliable locomotor rating scale for open field testing in rats. Journal of Neurotrauma 12: 1–21. http://doi:10.1089/neu.1995.12.1.
Reuter, D. G., W. A. Tacker, Jr., S. F. Badylak, W. D. Voorhees, 3rd, and P. E. Konrad. 1992. Correlation of motor-evoked potential response to ischemic spinal cord damage. Journal of Thoracic Cardiovascular Surgery 104: 262–272.
Yang, C., G. Wang, F. Ma, B. Yu, F. Chen, J. Yang, J. Feng, and Q. Wang. 2018. Repeated injections of human umbilical cord blood-derived mesenchymal stem cells significantly promotes functional recovery in rabbits with spinal cord injury of two noncontinuous segments. Stem Cell Research Therapy 9: 136. http://doi:10.1186/s13287-018-0879-0.
Zhang, H., A. Younsi, G. Zheng, M. Tail, A. K. Harms, J. Roth, M. Hatami, T. Skutella, A. Unterberg, and K. Zweckberger. 2021. Sonic Hedgehog modulates the inflammatory response and improves functional recovery after spinal cord injury in a thoracic contusion-compression model. European Spine Journal 30: 1509–1520. http://doi:10.1007/s00586-021-06796-2.
Yin, X., Y. Yin, F. L. Cao, Y. F. Chen, Y. Peng, W. G. Hou, S. K. Sun, and Z. J. Luo. 2012. Tanshinone IIA attenuates the inflammatory response and apoptosis after traumatic injury of the spinal cord in adult rats. PLoS One 7: e38381. http://doi:10.1371/journal.pone.0038381.
Hayta, E. and H. Elden. 2017. Acute spinal cord injury: A review of pathophysiology and potential of non-steroidal anti-inflammatory drugs for pharmacological intervention. Journal of Chemical Neuroanatomy 87: 25–31. http://doi:10.1016/j.jchemneu.2017.08.001.
Conti, A., S. Cardali, T. Genovese, R. Di Paola, and G. La Rosa. 2003. Role of inflammation in the secondary injury following experimental spinal cord trauma. Journal of Neurosurgery Science 47: 89–94.
Pineau, I. and S. Lacroix. 2007. Proinflammatory cytokine synthesis in the injured mouse spinal cord: multiphasic expression pattern and identification of the cell types involved. Journal of Comparative Neurology 500: 267–285. http://doi:10.1002/cne.21149.
Luo, Z., F. Wu, E. Xue, L. Huang, P. Yan, X. Pan, and Y. Zhou. 2019. Hypoxia preconditioning promotes bone marrow mesenchymal stem cells survival by inducing HIF-1α in injured neuronal cells derived exosomes culture system. Cell Death Disease 10: 134. http://doi:10.1038/s41419-019-1410-y.
Ramer, L. M., M. S. Ramer, and E. J. Bradbury. 2014. Restoring function after spinal cord injury: towards clinical translation of experimental strategies. Lancet Neurology 13: 1241–1256. http://doi:10.1016/S1474-4422(14)70144-9.
Zhang, Y. D., Z. S. Zhu, D. Zhang, Z. Zhang, B. Ma, S. C. Zhao, and F. Xue. 2017. Lentivirus-mediated silencing of the PTC1 and PTC2 genes promotes recovery from spinal cord injury by activating the Hedgehog signaling pathway in a rat model. Experimental and Molecular Medicine 49: e412. http://doi:10.1038/emm.2017.220.
Placzek, M. and J. Briscoe. 2018. Sonic hedgehog in vertebrate neural tube development. International Journal of Developmental Biology 62: 225–234. http://doi:10.1387/ijdb.170293jb.
Papatriantafyllou, M. 2011. Neuroimmunology: a CNS guard as prickly as a hedgehog. Nat Rev Immunol 12: 4. http://doi:10.1038/nri3143.
Sims, J. R., S. W. Lee, K. Topalkara, J. Qiu, J. Xu, Z. Zhou, and M. A. Moskowitz. 2009. Sonic hedgehog regulates ischemia/hypoxia-induced neural progenitor proliferation. Stroke 40: 3618–3626. http://doi:10.1161/STROKEAHA.109.561951.
Mao, L., Y. P. Xia, Y. N. Zhou, R. L. Dai, X. Yang, Y. J. Wang, S. J. Duan, X. Qiao, Y. W. Mei, and B. Hu. 2009. Activation of sonic hedgehog signaling pathway in olfactory neuroblastoma. Oncology 77: 231–243. http://doi:10.1159/000236047.

(Not answered)

Download PDF

Version 2

posted

You are reading this latest preprint version

The role of Sonic Hedgehog pathway in the development of spinal cord injury in rat model

Status:

Version 2

Abstract

Figures

1 Introduction

2 Materials And Methods

2.1 Animal

2.2 A rat model establishment of SCI and Experimental Design

2.3 Behavioral scores

2.4 ELISA

2.5 HE staining of spinal cord tissue

2.6 Western Blot

2.7 RT-qPCR

2.8 Statistical analysis

3 Results

3.1 Shh activator can improve functional recovery after SCI in rats.

3.2 Shh activator can reduce inflammation after SCI in rats.

3.3 Shh activator improves the histopathological changes of spinal cord after SCI in rats

3.4 The improvement of SCI in rats is related to the activation of Shh pathway.

4 Discussion

Declarations

References

Additional Declarations

Status:

Version 2