Targeting Aurora-A Inhibits Tumor Progression and Sensitizes Thyroid Carcinoma to sorafenib by decreasing PFKFB3-mediated glycolysis

doi:10.21203/rs.3.rs-1887350/v1

Download PDF

Article

Targeting Aurora-A Inhibits Tumor Progression and Sensitizes Thyroid Carcinoma to sorafenib by decreasing PFKFB3-mediated glycolysis

https://doi.org/10.21203/rs.3.rs-1887350/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 29 Mar, 2023

Read the published version in Cell Death & Disease →

You are reading this latest preprint version

Background

Thyroid cancer (TC) is the most common endocrine tumor, amongst which anaplastic thyroid carcinoma (ATC) is the most deadly. Aurora-A usually functions as oncogenes, and its inhibitor Alisertib exerts a powerful antitumor effect in various tumors. However, the mechanism of Aurora-A in regulating TC cell energy supply remains unclear.

Methods

Phosphoproteome and proteome analyses and RNA-seq were performed to investigate the molecular mechanisms of Aurora-A-induced tumor cell progression, which were further verified by in vitro modulations of Aurora-A and related pathways. An immunohistochemistry assay was carried out to evaluate the relationship between Aurora-A and patient prognosis. Finally, the antitumor efficacy of the Alisertib/Sorafenib combination was assessed in vitro and in vivo.

Results

We demonstrated the antitumor effect of Alisertib and an association between high Aurora-A expression and shorter survival. Multi-omics data and in vitro validation data suggested that Aurora-A induced PFKFB3-mediated glycolysis to increase ATP supply, which significantly upregulated the phosphorylation of ERK and AKT. The combination of Alisertib and Sorafenib had a synergistic effect, further confirmed in xenograft models and in vitro.

Conclusions

We provide compelling evidence of the prognostic value of Aurora-A expression and suggest that Aurora-A upregulates PFKFB3-mediated glycolysis to enhance ATP supply and promote TC progression. Combining Alisertib with Sorafenib has huge prospects for application in treating advanced thyroid carcinoma.

Thyroid carcinoma

Aurora-A

Glycolysis

combination strategy

Thyroid cancer (TC) is the most common endocrine tumor worldwide and can be divided into differentiated thyroid cancer (DTC), anaplastic thyroid carcinoma (ATC), and medullary thyroid carcinoma (MTC) (1, 2). Differentiated thyroid cancer (DTC), including papillary thyroid carcinoma (PTC) and follicular thyroid carcinoma (FTC), account for 95% of all TC cases. After conventional treatment, a small portion of patients (5–10%) experience disease recurrence and progression. Multimodal therapy, including surgery, external beam radiation, watchful waiting and experimental trials, is indicated for advanced and treatment-refractory diseases and is associated with marginal survival benefits (3). Although ATC and DTC are of the same origin, they exhibit different differentiation degrees and biological behaviors. Current evidence suggests albeit ATC accounts for only 1–2% of thyroid cancer cases, it is associated with 15–39% of thyroid cancer–related deaths. ATC patients have a 1-year overall survival of 20% and a historical median survival of about 5 months (4). Understanding the underlying molecular mechanisms and identifying novel drug targets of advanced DTC and ATC are essential to developing novel prognostic evaluation and therapy strategies.

In mammals, the Aurora serine/threonine kinase family includes Aurora-A, Aurora-b and Aurora-c. It is well-established that Aurora-A and Aurora-B regulate the cell cycle from G2 to cytokinesis and play prominent roles in most cell types. (5). Moreover, Aurora-A is required for many important mitotic events, including centrosome maturation, mitotic entry, mitotic spindle formation, and cytokinesis (6).

Overexpression or amplification of Aurora-A has been reported in many tumors, affecting various biological behaviors of tumor cells, such as activating cell cycle progression, promoting cell survival, inducing anti-apoptotic signaling, maintaining genomic instability, developing epithelial-mesenchymal transition (EMT), and maintaining cancer stemness (7, 8). It acts as an oncogene and promotes tumorigenesis, suggesting it is a potential target for cancer treatment. Interestingly, several small-molecule Aurora-A inhibitors have been developed in recent years with promising antitumor activity in various tumors, including thyroid cancer (9, 10). Alisertib has demonstrated remarkable anticancer activities by selectively inhibiting AURKA in preclinical studies and is the most advanced drug associated with 32 clinical trials (9). Our previous study screened a small molecule inhibitor library and revealed that Alisertib yielded a superior inhibitory effect on the proliferation of ATC cells (11). Nonetheless, the role of Aurora-A in advanced DTC and ATC progression and the potential clinical significance of Alisertib remain unclear.

Metabolic reprogramming, characterized by changes in cellular metabolic patterns, is the central contributor to promoting cancer progression. It is widely thought that cancer-related metabolic reprogramming has profound implications for gene expression, cell differentiation, and the cancer microenvironment (12). Even under normal oxygenation, cancer cells still prefer to convert glucose to pyruvate through glycolysis, a phenomenon termed the Warburg effect, representing an essential part of metabolic reprogramming. Various mechanisms mediate glycolysis at different levels. The first rate-limiting step of glycolysis is the conversion of fructose-6-phosphate (F6P) to fructose-1,6-bisphosphate (F1,6P2) by 6-phosphofructo-1-kinase (PFK-1), which is activated by intracellular fructose 2,6- bisphosphate (F2,6BP). F2,6BP enhances the binding of PFK-1 for F6P and overrides the suppression of PFK-1 by ATP, enabling glycolytic flux through the PFK-1 checkpoint to F1,6P2 synthesis. The concentration of F2,6BP is controlled by phosphofructokinase 2/fructose-2,6-bisphosphatase (PFKFB). Though the four isozymes of PFKFB (PFKFB1–4) have high sequence homology (85%) of their core catalytic domains, they display distinct properties. Among them, PFKFB3 has the highest kinase/phosphatase ratio (710 times) and unique properties, being responsible for producing F2 and 6BP and promoting glycolytic flux (13). PFKFB3 has been reported to play an important role in promoting tumor progression. An increasing body of evidence suggests that inhibition of PFKFB3 by chemical inhibitors or genetic attenuation significantly reduced glycolytic flux, ras-based transformation, and tumor growth in athymic mice (14–16). In addition, inhibition of PFKFB3 has been reported to disrupt pathological angiogenesis and induce normalization of tumor vasculature, thereby reducing metastasis and improving chemotherapy efficacy (17). However, it remains unclear what role PFKFB3 plays in thyroid cancer.

Sorafenib is a multitarget TKI that inhibits VEGFR2, VEGFR3, KIT kinases, PDGFR, RET/ PTC, and the MAPK pathway. Owing to the promising preclinical and clinical results, Sorafenib was approved by US Food and Drug Administration (FDA) to treat ¹³¹I-refractory DTC in 2005 (18, 19). However, Sorafenib failed to induce a sustainable response in DTC, leading to drug resistance (20). In addition, preclinical studies suggested that Sorafenib has antitumor activity in ATC, and several drugs may exert a synergic effect with Sorafenib in reducing ATC cell growth. However, several clinical trials did not report favorable outcomes, suggesting that Sorafenib has a limited role in ATC (20). Further studies are urgently needed to develop an appropriate Sorafenib-based combination strategy for aggressive TCs based on molecular characteristics.

This study aimed to investigate the therapeutic potential of Alisertib and its combination with Sorafenib in thyroid cancer. Moreover, we analyzed factors that determined thyroid cancer cell response to Alisertib and elucidated the effects of Aurora-A mediated PFKFB3 phosphorylation on glycolysis and biological behavior in thyroid cancer cells.

Clinical data and tissue samples

This study was approved by the Tianjin Medical University Cancer Institute and the hospital ethics committee. Informed consent was obtained from each donor. 20 paracancerous thyroid samples, 126 DTC and 29 ATC samples were selected for immunohistochemistry (IHC) assays.

IHC

Sections from human thyroid cancer (DTC and ATC), paracancerous thyroid tissue and xenograft tumors from mice were stained with antibodies to p-Aurora-A (host species: Rat, 44-1210G Invitrogen), Aurora-A (host species: Rat, #ab52973, Abcam), Ki-67(host species: Rat,9027, CST) for IHC, according to a previously described protocol. Signals were visualized with a DAB substrate kit (Maixin Bio, China). Two experienced pathologists blinded to the patient information evaluated staining results. Aurora-A and p-Aurora-A expression levels were evaluated using the following criteria: The staining intensity was scored as 0 (negative), 1 (weak), 2 (moderate) and 3 (strong) points, while the positive cell count/total cell count (staining ratio) was evaluated with ImageJ software. The immunohistochemical score was obtained by the product of the staining intensity with the staining ratio; scores ≥ 150 were considered high expression. Ki-67 expression was quantified by the staining ratio. Hematoxylin and eosin staining was performed as previously described (3).

Cell line and cell culture

In this study, we used 1 normal thyroid follicular epithelial cell (Nthy-ori3-1), 3 DTC cell lines (K-1, KTC-1, TPC-1) and 3 anaplastic thyroid cancer cell lines (8305C, 8505C and CAL-62) that were purchased from the American Type Culture Collection. All cell lines were identified by STR analysis, cultured at 37°C and 5% CO₂ in RPMI-1640 or DMEM (Gibco) supplemented with 10% fetal bovine serum, penicillin/streptomycin (5000 units/mL; Gibco) and l-glutamine (2 mM; Gibco). Alisertib (Selleck), ATP (Sigma) and Sorafenib (Selleck) were used in this study.

Western blotting

Cells were lysed with RIPA lysis buffer (Beyotime), and protein concentrations were determined by BCA. The samples were separated by SDS-PAGE. Gel proteins were transferred to PVDF membranes (Millipore), sequentially blocked with 5% nonfat milk (Solarbio), and then incubated with primary antibodies overnight at 4°C. PVDF membranes were further incubated with secondary antibodies, and chemiluminescent detection was performed using the Western Blotting Detection Kit ECL (Human IgG) (Solarbio). Primary antibodies used for western blot included p-Aurora-A (host species: Rat, #3079, CST), Aurora-A (host species: Rat, #ab52973, Abcam),, GAPDH (host species: Rabbit, #ab181602, Abcam), PFKFB3 (host species: Rat, # ab181861, Abcam), p-PFKFB3 (host species: Rat, # ab202291, Abcam), p-ERK (host species: Rat, #4370, CST), ERK (host species: Rat, #4695, CST), p-AKT (host species: Rat, #a4060, CST), and AKT (host species: Rat, #4685, CST).

Cell transfection and lentivirus infection

Small Interfering RNAs (siRNAs) were synthesized by GenePharma, Shanghai, China. siRNAs were transfected into cells using Lipofectamine 2000 (Invitrogen, Shanghai, China) according to the manufacturer's instructions. After 48 h, the cells were collected for subsequent experiments. siRNAs were transfected into cells using Lipofectamine 3000 (Invitrogen) according to the manufacturer's instructions. After 2 days, cells were collected for subsequent experiments. The human Aurora-A sequences were cloned into the PCDH vector (Addgene) and delivered by lentiviral infection. shRNA sequences were cloned into the PLKO.1 vector (Addgene) and delivered by lentiviral infection with lentiviruses generated by transfection of 293T cells. The sequences of siRNA and shRNA are listed in Table 1 and Table 2

Table 1

The shRNA targeting sequence
	Forward	Reverse
Aurora-A	CACATACCAAGAGACCTACAA	TTGTAGGTCTCTTGGTATGTG

Table 2

The siRNA sequences
	Forward	Reverse
siPFKFB3-1	AGUUGUAGGAGCUGUACUG	CAGUACAGCUCCUACAACU
siPFKFB3-2	CGGGUGCAUGAUUGUGCUUAA	UUAAGCACAAUCAUGCACCCG

RT-PCR

RT-PCR assays were performed as previously described (3). Briefly, total RNA was extracted from cells using an RNeasy Mini Kit (Qiagen). Transcriptor First Strand cDNA Synthesis Kit (Takara) was performed to complete cDNA synthesis. FastStart Universal SYBR Green Master Mix (Takara) was used during PCR on an ABI ViiA7 system. The primers used are listed in Table 3.

Table 3

The primers of RT-PCR assays
	Forward	Reverse
Aurora-A	GCAACCAGTGTACCTCATCCTG	AAGTCTTCCAAAGCCCACTGCC
Actin	CACCATTGGCAATGAGCGGTTC	AGGTCTTTGCGGATGTCCACGT

Cell viability assay

A total of 1000–1500 cells were seeded per well in a 96-well plate. Then the viability of the cells was detected by Cell Counting Kit-8 (Cell Counting Kit-8, CCK-8) according to the manufacturer's instructions.

Transwell assay

Cell migration assays were performed using Transwell cells with 24-well polycarbonate membranes (8 mm pore size; Corning, USA). RPMI 1640 medium (500 µl) containing 10% fetal bovine serum was added to the lower chamber. 150 µl of cell suspension (1 × 10⁶ cells/ml) without serum was collected and incubated in the upper chamber at 37°C, 5% CO₂ for 24 hours. Transwell cell chambers were fixed with 5% glutaraldehyde and stained with 0.1% crystal violet. For the cell invasion assay, the Transwell chamber was coated with Matrigel (BD Biosciences) before adding the cell suspension.

ADP/ATP ratio

ADP/ATP ratios were measured using a commercial ADP/ATP kit obtained from Sigma-Aldrich (Darmstadt, Germany) according to the manufacturer's instructions. Briefly, cells were incubated with ATP reagent for 1 min, and the luminescence was read for ATP detection. Cells were incubated with luminescence as background for 10 minutes prior to ADP measurements. Finally, the ADP reagent was added and incubated for 1 min. The luminescence was read, and ADP/ATP ratios were calculated according to the manufacturer's instructions.

Multi-omics analysis

Phosphoproteome and proteome analyses and RNA-seq were performed as previously described (21, 22). After adjudgment of proteome data, phosphoproteome data was used to compare the phosphorylation of protein in Aurora-A knockdown TPC1 cells with the control group. Proteome analysis combined with RNA-seq was applied to compare the protein expression profile in TPC1 cells with Aurora-A knockdown and the control group. To analyze The Cancer Genome Atlas (TCGA) data, we downloaded TCGA database data and divided the patients into two groups according to the expression level of Aurora-A. GSEA analysis was utilized in both groups to identify significantly enriched pathways in the Aurora-A upregulation group.

Immunoprecipitation (IP)

Immunoprecipitation was performed as previously described (23). Briefly, cells were lysed with IP lysis buffer (Thermo Scientific, USA) containing the cocktail. Cell lysates were incubated with anti-Aurora A antibody or PFKFB3 overnight at 4°C, followed by immunoprecipitation with protein A + G agarose beads (Thermo Scientific, USA) for 2 hours at 4°C with shaking and washed 3 times with IP lysis buffer. The immunoprecipitates were eluted and analyzed by western blotting.

Animal studies

The animal experiments were performed according to the IACUC protocol and approved by the Tianjin Medical University Cancer Institute and the Hospital Animal Care and Use Committee.

NSG female mice (4 weeks old) were injected subcutaneously at 100µl PBS with 1×105 CAL-62 or 8305C cells to generate the xenograft model. When the average tumor volume reached 15 mm3, mice were randomly divided into a control group and several experimental groups. To evaluate the effect of Alisertib, mice were fed 2% hydroxymethylcellulose (HMC) or 1% HMC + 30 mg/kg of Alisertib daily. To confirm the synergistic effect of Alisertib and Sorafenib in vivo, mice were treated with 2% HMC, 1% HMC with 30 mg/kg Alisertib, 1% HMC with 30 mg/kg Sorafenib, and both Sorafenib and Alisertib, daily. Tumor growth was measured and recorded before the treatment began. After 12 days of treatment, the mice were sacrificed. The tumors were excised and fixed with 4% paraformaldehyde for further study.

Alisertib inhibits the proliferation, migration, invasion and Aurora-A phosphorylation of ATC cells in vitro and vivo

Our previous studies indicated that Alisertib could suppress CAL-62 proliferation (Table4) (11). Therefore, we sought to further analyze the antitumor activity of Alisertib in thyroid tumors. As expected, Alisertib could effectively inhibit the proliferation, invasion and migration of 8305C and CAL-62 cells in a dose-dependent manner in vitro (Figure 1A-D). We also detected the expression of Aurora-A and P-Aurora-A in ATC cells after Alisertib treatment in vitro and found that Alisertib could reduce the expression of p-Aurora-A (the active form of Aurora-A functioning as a kinase) in a dose-dependent manner, but had no significant effect on the expression of total Aurora-A (Supplemental Figure 1A). This finding demonstrated that Alisertib exerted an inhibitory effect on Aurora-A kinase activity in thyroid cancer.

Table4. Information of Alisertib in drug library

Inhibitor	CAS No.	Target	Cell viability(%)
MLN8237(Alisertib)	1028486-01-2	Aurora Kinase inhibitor	43.37

The tumor xenograft model was established by subcutaneous injection of CAL-62 cells in NSG mice, and Alisertib was administered after tumor formation. Alisertib effectively inhibited tumor proliferation in vivo, with a reduction in tumor size (Figure 1E-F) and weight (Figure 1G). Immunohistochemical staining showed that Ki67 and P-Aurora-A expression in the treatment group was significantly lower than in the control group (Figure 1H). This finding indicated that Alisertib exerts a potent inhibitory effect on Aurora-A activity, proliferation and migration in thyroid cancer cells in vivo and in vitro.

Aurora-A promotes the proliferation, migration and invasion of thyroid cancer cells, and its elevation is correlated to a poor prognosis in TC patients.

To corroborate our pharmacological results, we investigated the clinical relevance of Aurora-A expression in TC patients. The mRNA expression of Aurora-A in several TC cell lines (including DTC and ATC) was detected, suggesting that the expression of Aurora-A in ATC cell lines was significantly higher than in DTC cell lines and normal thyroid cell lines (Supplemental Figure 1B). Then we performed immunohistochemical staining for Aurora-A in DTC and ATC sections to understand the relationship between Aurora-A expression and clinicopathological features of TC. Higher Aurora-A expression was observed in ATC than in DTC and was associated with a poor prognosis in ATC patients (Figure 2A-C).

To further verify the biological function of Aurora-A in TC, we overexpressed Aurora-A in KTC-1 cell lines and found that Aurora-A overexpression significantly enhanced KTC-1 cell proliferation, migration and invasion ability (Figure 2D-G). Consistently, Aurora-A downregulation significantly reduced TPC-1 cell viability, migration and invasion. The above findings suggest that Aurora-A is a promising target in TC cells, and increased Aurora-A expression could be a potential marker of poor outcomes in TC patients.

Multiomics and bioinformatics analyses suggest Aurora-A regulates the glycolysis pathway in TC

To further explore the mechanism underlying the stimulatory effect of Aurora-A on TC progression, phosphoproteome profiling was performed on the Aurora-A-downregulated TPC-1 and the control group. 318 proteins with 423 sites showed significant changes in phosphorylation level (Figure 3A). KEGG analysis revealed that multiple pathways, including the glycolysis pathway, were significantly enriched (Figure 3B). PFKFB3 was further identified, and the phosphorylation level of the S461 site was significantly altered (Table 5). In addition, transcriptome analysis combined with protein profiling revealed significant enrichment of the glycolysis pathway (Figure 3C-D). For further confirmation, thyroid cancer data from TCGA database was obtained. GSEA analysis was performed according to Aurora-A expression. Glycolysis and gluconeogenesis pathway was also enriched in the Aurora-A high expression group (Figure 3E). The above data suggested that Aurora-A may promote TC progression via glycolysis, and PFKFB3 may be the candidate substrate.

Table5. PFKFB3 was identified by phosphoproteome and the phosphorylation level at S461 was significantly altered.

Protein accession	Q16875
Position	461
Amino acid	S
Protein description	6-phosphofructo-2-kinase / fructose-2,6-bisphosphatase
Gene name	PFKFB3
Localization probability	0.994515
TPC-1 shAurora-A/control Ratio	0.431
TPC-1 shAurora-A/control P value	13889999997507E-06

Aurora-A interacts with PFKFB3 and mediates PFKFB3 phosphorylation to regulate glycolysis in TC cells

Overwhelming evidence substantiates that increased expression or phosphorylation of PFKFB3 facilitates the progression and glycolysis in various cancers(24, 25). To confirm the tumor-promoting function of PFKFB3 in TC, we used two different siRNAs to knock down PFKFB3 in KTC-1 and found that PFKFB3 knockdown significantly increased the ADP/ATP ratio and reduced the phosphorylation level of ERK and AKT (Supplemental Figure 2A-B). These results indicated that PFKFB3 induced the activation of MAPK and PI3K-AKT signaling pathways by enhancing the energy supply in TC cells.

To determine the mechanism by which Aurora-A induces PFKFB3 activity, we initially validated the interaction between Aurora-A and PFKFB3 via IP experiments. As shown in Figure 4A, endogenous Aurora-A could interact with PFKFB3 to form a complex. Then we detected the expression changes of p-PFKFB3 and total PFKFB3 after treatment with Alisertib and found that Alisertib could reduce the level of p-PFKFB3 in a dose-dependent manner but had no effect on the level of total PFKFB3 (Figure 4B). Consistently, Aurora-A overexpression in KTC-1 cell lines induced PFKB3 phosphorylation without altering the total PFKB3 expression level (Figure 4B). As shown in Figure 4C-E, PFKB3 downregulation could reverse the activation of the MAPK pathway and PI3K-AKT pathway and the proliferation, migration and invasion ability in Aurora-A-overexpressed KTC-1 cells. To validate that Aurora-A-regulated PFKB3 phosphorylation played a carcinogenic role by affecting the energy supply of TC cells, we detected the ADP/ATP ratio after altering Aurora-A activity and found that Aurora-A activity was significantly negatively correlated with ADP/ATP ratio (Figure 4F). In addition, treatment with Alisertib significantly decreased the phosphorylation of ERK and AKT while exogenous ATP mitigated the repression effect. The suppressed cell proliferation, migration and invasion were also reversed by supplementation of ATP (Figure 4G-I). The above results suggest that Aurora-A-mediated PFKB3 phosphorylation affects the energy production of tumor cells by regulating glycolysis and thus plays a pro-carcinogenic role in tumor cells.

Targeting Aurora-A improves the efficacy of Sorafenib treatment in TC cells

To determine whether the combination of Alisertib and Sorafenib was more effective in TC cell lines, western blot, viability (CCK8) assay, and transwell assay were performed. As expected, compared with the monotherapy and control group, the combination strategy significantly inhibited the phosphorylation level of ERK AKT in both 8305c and TPC-1 cells (Figure5 A and D). Correspondingly, the proliferation (Figure 5B and E), migration and invasion ability (Figure 5C and F) of 8305c and TPC-1 cells were significantly suppressed in the combination group. These data suggest that the combination of Alisertib and Sorafenib could potently inhibit DTC cell proliferation in vitro.

To validate our results, mice bearing 8305c xenografts were analyzed to examine the antitumor activity of the Alisertib/Sorafenib combination strategy. Compared with mice in the monotherapy group, mice in the combination group exhibited markedly reduced tumor volumes and weight (P_s<0.05, Figure 5A-C). The expression of p-Aurora-A and Ki-67 in the combination group was significantly lower than in other groups (Figure 5D). The effects of Alisertib or Sorafenib alone were similar to the above in vitro results. These results indicated that the Aurora-A inhibitor combined with Sorafenib could serve as a powerful therapeutic approach for TC, especially in cases where monotherapy has limited efficacy.

In this study, we explored the expression pattern of Aurora-A in thyroid carcinoma and its relationship with patient prognosis. Importantly, we found that targeting Aurora-A by Alisertib can suppress the proliferation and epithelial-mesenchymal transformation of anaplastic thyroid cancer cells. Mechanistically, Aurora-A acts as a protein phosphorylation kinase that binds directly to PFKFB3 and promotes its phosphorylation, thus promoting the glycolysis process of tumor cells and causing metabolic reprogramming of tumor cells. More importantly, we substantiated that Alisertib significantly enhances the antitumor effect of Sorafenib, thus providing a new combination therapy strategy for thyroid cancer patients.

The abnormal upregulation of Aurora-A has been documented in tumors of the breast, ovary, prostate, cervix, lung, head, and neck and correlated with a poor prognosis. Our study yielded consistent results as the overexpression of Aurora-A correlated with a poor prognosis in TC patients, and Aurora-A expression in ATC was significantly higher than in DTC.

Aurora-A acts as a kinase, phosphorylates specific substrates and controls signal transduction in tumor cells. A previous study revealed that Aurora-A induced glycolysis-related gene expression by enhancing the Ser327 site phosphorylation level of sex determining region Y-box 8 (SOX8) in ovarian cancer (26). Our study corroborated that Aurora-A affects the glycolytic flow of tumor cells through distinct mechanisms. Multiomics experiments revealed that Aurora-A could bind PFKFB3 and regulate the phosphorylation level of the S461 site. In addition, mediating Aurora-A activity could significantly affect the phosphorylation level of the PFKFB3 S461 site and the lactate content of tumor cells. Dual mechanisms mediate glycolysis in cancer cells, including increased expression or phosphorylation of PFKFB3. S461 of PFKFB3 has been demonstrated as a key phosphorylation site for its stimulatory effect on F2,6BP production, lactate secretion, and proliferation in cancer cells (27, 28). Taken together, our findings suggest that Aurora-A promoted glycolysis by increasing the phosphorylation level of the PFKFB3 S461 site in TC cells.

The advantages of accelerated glycolytic flux in tumors remain controversial (29, 30). Our data suggested that PFKFB3-regulated glycolysis can promote the proliferation and invasion of TC cells by enhancing the energy supply, an important mechanism of Aurora-A-mediated TC cell progression. Sufficient ATP supplementation is necessary for protein phosphorylation to promote the activation of the cell signal transduction pathway (31). Our study revealed that PFKFB3-mediated ATP supply contributed to the stimulatory effect of Aurora-A on the MAPK pathway and PI3K pathway, which are sensitive to ATP levels. The supplementation of exogenous ATP in PFKFB3 knockdown thyroid cancer cells can effectively restore the tumor suppressive effect caused by its knockdown. Considering the specific and vital role of the MAPK and AKT pathways in thyroid cancer progression, inhibition of Aurora-A activity only or combined with other targeted drugs has potential clinical value for advanced TC therapy.

Our study revealed a synergistic effect between Alisertib and Sorafenib in advanced DTC and ATC. Similar to our findings, Aurora-A inhibitors sensitized hepatocellular carcinoma to Sorafenib treatment by inhibiting the activities of p-AKT and p-P38 in hepatocellular carcinoma (32). Moreover, we demonstrated the efficacy of this combination in thyroid cancer and identified a new mechanism, indicating Aurora-A inhibitors have huge prospects for application in advanced TC therapy either alone or in combination. The combination of PFKFB3 inhibitor and Sorafenib has been demonstrated to have a synergistic effect on the treatment of liver cancer, consistent with the present study findings. Considering the limited role of Sorafenib in ATC, the combined strategy may be of great significance in effectively inhibiting the proliferation of ATC cells.

A previous study on thyroid cancer found that Aurora-A binding to c-MYC was an important mechanism of its carcinogenic effect (10). The present study provides hitherto undocumented evidence that Aurora-A binds to the PFKFB3 protein and mediates the regulation of glycolysis and metabolic reprogramming. We also found that targeting Aurora-A could effectively inhibit therapeutic resistance to Sorafenib caused by metabolic reprogramming. Our study provides novel insights into the mechanism by which Aurora-A exerts its carcinogenic effects.

In summary, our study uncovered the prognostic value of Aurora-A expression in thyroid cancer and a new carcinogenic mechanism: Aurora-A can increase PFKFB3-mediated glycolysis to activate the MAPK and AKT pathways. Interestingly, the combination of Aurora-A inhibitors and Sorafenib may be a promising treatment strategy for aggressive thyroid carcinoma.

thyroid cancer

DTC

differentiated thyroid cancer

ATC

anaplastic thyroid carcinoma

MTC

medullary thyroid carcinoma

PTC

papillary thyroid carcinoma

FTC

follicular thyroid carcinoma

EMT

epithelial-mesenchymal transition

ATP

adenosine-triphosphate

ADP

adenosine diphosphate

PFKFB

phosphofructokinase 2/fructose-2,6-bisphosphatase

Authorship contribution statement

Zhi Jingtai, Hu Linfei, and Kang Ning: Conceptualization, Methodology, Software, Writing-Original Draft. Ruan Xianhui, Huang Dongmei, Yang Weiwei, and Meng Xiangrui: Methodology. Wang Wei: Data Curation, Writing-Review & Editing. Zheng Xiangqian: Conceptualization, Writing-Review & Editing.

Declaration of Competing Interest

All authors have approved the manuscript's content for publication and have no conflicts of interest. This manuscript has not been previously published and is not currently being considered for publication elsewhere.

Acknowledgments

Not applicable.

Funding

This work was supported by grants from the National Natural Science Foundation of China (Grant No. 81872169, 82172821), Tianjin Municipal Science and Technology Project (19JCYBJC27400, 21JCYBJC01570), Beijing-Tianjin-Hebei Basic Research Cooperation Project(20JCZXJC00120), the Science &Technology Development Fund of Tianjin Education Commission for Higher Education (2021ZD033), Tianjin Medical Key Discipline (Specialty) Construction Project, Science and technology project of Tianjin Health Committee (TJWJ2021QN012).

Cabanillas ME, McFadden DG, Durante C. Thyroid cancer. Lancet (London, England). 2016;388(10061):2783-95. Epub 2016/06/01. doi: 10.1016/s0140-6736(16)30172-6. PubMed PMID: 27240885.
Siegel R, Miller K, Fuchs H, Jemal AJCacjfc. Cancer Statistics, 2021. 2021;71(1):7-33. doi: 10.3322/caac.21654. PubMed PMID: 33433946.
Zhi J, Yi J, Hou X, Wang W, Yang W, Hu L, et al. Targeting SHP2 sensitizes differentiated thyroid carcinoma to the MEK inhibitor. 2022;12(1):247-64. PubMed PMID: 35141016.
Bible KC, Kebebew E, Brierley J, Brito JP, Cabanillas ME, Clark TJ, Jr., et al. 2021 American Thyroid Association Guidelines for Management of Patients with Anaplastic Thyroid Cancer. Thyroid : official journal of the American Thyroid Association. 2021;31(3):337-86. Epub 2021/03/18. doi: 10.1089/thy.2020.0944. PubMed PMID: 33728999; PubMed Central PMCID: PMCPMC8349723.
Marumoto T, Zhang D, Saya H. Aurora-A - a guardian of poles. Nature reviews Cancer. 2005;5(1):42-50. Epub 2005/01/05. doi: 10.1038/nrc1526. PubMed PMID: 15630414.
Zheng XQ, Guo JP, Yang H, Kanai M, He LL, Li YY, et al. Aurora-A is a determinant of tamoxifen sensitivity through phosphorylation of ERα in breast cancer. Oncogene. 2014;33(42):4985-96. Epub 2013/10/30. doi: 10.1038/onc.2013.444. PubMed PMID: 24166501; PubMed Central PMCID: PMCPMC4002670.
Lin X, Xiang X, Hao L, Wang T, Lai Y, Abudoureyimu M, et al. The role of Aurora-A in human cancers and future therapeutics. American journal of cancer research. 2020;10(9):2705-29. Epub 2020/10/13. PubMed PMID: 33042612; PubMed Central PMCID: PMCPMC7539775.
Yan M, Wang C, He B, Yang M, Tong M, Long Z, et al. Aurora-A Kinase: A Potent Oncogene and Target for Cancer Therapy. Medicinal research reviews. 2016;36(6):1036-79. Epub 2016/10/21. doi: 10.1002/med.21399. PubMed PMID: 27406026.
Jing XL, Chen SW. Aurora kinase inhibitors: a patent review (2014-2020). Expert opinion on therapeutic patents. 2021;31(7):625-44. Epub 2021/02/13. doi: 10.1080/13543776.2021.1890027. PubMed PMID: 33573401.
Li Y, Li X, Pu J, Yang Q, Guan H, Ji M, et al. c-Myc Is a Major Determinant for Antitumor Activity of Aurora A Kinase Inhibitor MLN8237 in Thyroid Cancer. Thyroid : official journal of the American Thyroid Association. 2018;28(12):1642-54. Epub 2018/09/19. doi: 10.1089/thy.2018.0183. PubMed PMID: 30226440.
Cao X, Dang L, Zheng X, Lu Y, Lu Y, Ji R, et al. Targeting Super-Enhancer-Driven Oncogenic Transcription by CDK7 Inhibition in Anaplastic Thyroid Carcinoma. Thyroid : official journal of the American Thyroid Association. 2019;29(6):809-23. Epub 2019/03/30. doi: 10.1089/thy.2018.0550. PubMed PMID: 30924726.
Pavlova NN, Thompson CB. The Emerging Hallmarks of Cancer Metabolism. Cell metabolism. 2016;23(1):27-47. Epub 2016/01/16. doi: 10.1016/j.cmet.2015.12.006. PubMed PMID: 26771115; PubMed Central PMCID: PMCPMC4715268.
Okar DA, Manzano A, Navarro-Sabatè A, Riera L, Bartrons R, Lange AJ. PFK-2/FBPase-2: maker and breaker of the essential biofactor fructose-2,6-bisphosphate. Trends in biochemical sciences. 2001;26(1):30-5. Epub 2001/02/13. doi: 10.1016/s0968-0004(00)01699-6. PubMed PMID: 11165514.
Chesney J, Mitchell R, Benigni F, Bacher M, Spiegel L, Al-Abed Y, et al. An inducible gene product for 6-phosphofructo-2-kinase with an AU-rich instability element: role in tumor cell glycolysis and the Warburg effect. Proceedings of the National Academy of Sciences of the United States of America. 1999;96(6):3047-52. Epub 1999/03/17. doi: 10.1073/pnas.96.6.3047. PubMed PMID: 10077634; PubMed Central PMCID: PMCPMC15892.
Telang S, Yalcin A, Clem AL, Bucala R, Lane AN, Eaton JW, et al. Ras transformation requires metabolic control by 6-phosphofructo-2-kinase. Oncogene. 2006;25(55):7225-34. Epub 2006/05/23. doi: 10.1038/sj.onc.1209709. PubMed PMID: 16715124.
Clem B, Telang S, Clem A, Yalcin A, Meier J, Simmons A, et al. Small-molecule inhibition of 6-phosphofructo-2-kinase activity suppresses glycolytic flux and tumor growth. Molecular cancer therapeutics. 2008;7(1):110-20. Epub 2008/01/19. doi: 10.1158/1535-7163.Mct-07-0482. PubMed PMID: 18202014.
Cantelmo AR, Conradi LC, Brajic A, Goveia J, Kalucka J, Pircher A, et al. Inhibition of the Glycolytic Activator PFKFB3 in Endothelium Induces Tumor Vessel Normalization, Impairs metastasis, and Improves Chemotherapy. Cancer cell. 2016;30(6):968-85. Epub 2016/11/22. doi: 10.1016/j.ccell.2016.10.006. PubMed PMID: 27866851; PubMed Central PMCID: PMCPMC5675554.
Cabanillas ME, Ryder M, Jimenez C. Targeted Therapy for Advanced Thyroid Cancer: Kinase Inhibitors and Beyond. Endocrine reviews. 2019;40(6):1573-604. Epub 2019/07/20. doi: 10.1210/er.2019-00007. PubMed PMID: 31322645; PubMed Central PMCID: PMCPMC7341904.
Abdelgalil AA, Alkahtani HM, Al-Jenoobi FI. Sorafenib. Profiles of drug substances, excipients, and related methodology. 2019;44:239-66. Epub 2019/04/29. doi: 10.1016/bs.podrm.2018.11.003. PubMed PMID: 31029219.
Brose M, Nutting C, Jarzab B, Elisei R, Siena S, Bastholt L, et al. Sorafenib in radioactive iodine-refractory, locally advanced or metastatic differentiated thyroid cancer: a randomised, double-blind, phase 3 trial. 2014;384(9940):319-28. doi: 10.1016/s0140-6736(14)60421-9. PubMed PMID: 24768112.
Zhang W, Ruan X, Li Y, Zhi J, Hu L, Hou X, et al. KDM1A promotes thyroid cancer progression and maintains stemness through the Wnt/β-catenin signaling pathway. Theranostics. 2022;12(4):1500-17. Epub 2022/02/25. doi: 10.7150/thno.66142. PubMed PMID: 35198054; PubMed Central PMCID: PMCPMC8825597.
Song X, He H, Zhang Y, Fan J, Wang LJA. Mechanisms of action of triptolide against colorectal cancer: insights from proteomic and phosphoproteomic analyses. 2022;14(7):3084-104. doi: 10.18632/aging.203992. PubMed PMID: 35366242.
Hu L, Zhang J, Tian M, Kang N, Xu G, Zhi J, et al. Pharmacological inhibition of Ref-1 enhances the therapeutic sensitivity of papillary thyroid carcinoma to vemurafenib. Cell death & disease. 2022;13(2):124. Epub 2022/02/10. doi: 10.1038/s41419-022-04550-0. PubMed PMID: 35136031; PubMed Central PMCID: PMCPMC8825860.
Imbert-Fernandez Y, Clem BF, O'Neal J, Kerr DA, Spaulding R, Lanceta L, et al. Estradiol stimulates glucose metabolism via 6-phosphofructo-2-kinase (PFKFB3). The Journal of biological chemistry. 2014;289(13):9440-8. Epub 2014/02/12. doi: 10.1074/jbc.M113.529990. PubMed PMID: 24515104; PubMed Central PMCID: PMCPMC3979387.
Bartrons R, Rodríguez-García A, Simon-Molas H, Castaño E, Manzano A, Navarro-Sabaté ÀJEoott. The potential utility of PFKFB3 as a therapeutic target. 2018;22(8):659-74. doi: 10.1080/14728222.2018.1498082. PubMed PMID: 29985086.
Sun H, Wang H, Wang X, Aoki Y, Wang X, Yang Y, et al. Aurora-A/SOX8/FOXK1 signaling axis promotes chemoresistance via suppression of cell senescence and induction of glucose metabolism in ovarian cancer organoids and cells. 2020;10(15):6928-45. doi: 10.7150/thno.43811. PubMed PMID: 32550913.
Bando H, Atsumi T, Nishio T, Niwa H, Mishima S, Shimizu C, et al. Phosphorylation of the 6-phosphofructo-2-kinase/fructose 2,6-bisphosphatase/PFKFB3 family of glycolytic regulators in human cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 2005;11(16):5784-92. Epub 2005/08/24. doi: 10.1158/1078-0432.Ccr-05-0149. PubMed PMID: 16115917.
Bando H, Atsumi T, Nishio T, Niwa H, Mishima S, Shimizu C, et al. Phosphorylation of the 6-phosphofructo-2-kinase/fructose 2,6-bisphosphatase/PFKFB3 family of glycolytic regulators in human cancer. 2005;11(16):5784-92. doi: 10.1158/1078-0432.Ccr-05-0149. PubMed PMID: 16115917.
Lu C, Yang D, Klement J, Colson Y, Oberlies N, Pearce C, et al. H3K9me3 represses G6PD expression to suppress the pentose phosphate pathway and ROS production to promote human mesothelioma growth. 2022. doi: 10.1038/s41388-022-02283-0. PubMed PMID: 35351997.
Han X, Ren C, Lu C, Qiao P, Yang T, Yu ZJCd, et al. Deubiquitination of MYC by OTUB1 contributes to HK2 mediated glycolysis and breast tumorigenesis. 2022. doi: 10.1038/s41418-022-00971-8. PubMed PMID: 35296795.
Su X, Shen Z, Yang Q, Sui F, Pu J, Ma J, et al. Vitamin C kills thyroid cancer cells through ROS-dependent inhibition of MAPK/ERK and PI3K/AKT pathways via distinct mechanisms. Theranostics. 2019;9(15):4461-73. Epub 2019/07/10. doi: 10.7150/thno.35219. PubMed PMID: 31285773; PubMed Central PMCID: PMCPMC6599666.
Zhang K, Wang T, Zhou H, Feng B, Chen Y, Zhi Y, et al. A Novel Aurora-A Inhibitor (MLN8237) Synergistically Enhances the Antitumor Activity of Sorafenib in Hepatocellular Carcinoma. Molecular therapy Nucleic acids. 2018;13:176-88. Epub 2018/10/07. doi: 10.1016/j.omtn.2018.08.014. PubMed PMID: 30292139; PubMed Central PMCID: PMCPMC6172479.

(Not answered)

Supplementarydata.pdf
Supplementary dataWB original image
supplementalfigure1.tif
Supplementary FIG1A. The expression of Aurora-A and p-Aurora-A in 8305C and CAL-62 cells with or without 10μmol Alisertib treatment were detected by western blotting.B. Aurora A expression in Nthy-ori-3-1, DTC and ATC cell lines were detected by real-time PCR.
supplementalfigure2.tif
Supplementary FIG2A. The expression of PFKFB3, p-ERK, ERK, p-AKT and AKT in KTC-1 cells with or without siRNA targeting of PFKFB3 were detected by western blotting.B. The ADP/ATP ratio in KTC-1 cells with or without siRNA targeting of PFKFB3.

Download PDF

Journal Publication

published 29 Mar, 2023

Read the published version in Cell Death & Disease →

Editorial decision: revise
04 Oct, 2022
Review #2 received at journal
03 Oct, 2022
Reviewer #2 agreed at journal
30 Sep, 2022
Review #1 received at journal
31 Aug, 2022
Reviewer #1 agreed at journal
26 Aug, 2022
Reviewers invited by journal
20 Aug, 2022
Submission checks completed at journal
25 Jul, 2022
First submitted to journal
23 Jul, 2022
Editor assigned by journal
23 Jul, 2022

You are reading this latest preprint version

Targeting Aurora-A Inhibits Tumor Progression and Sensitizes Thyroid Carcinoma to sorafenib by decreasing PFKFB3-mediated glycolysis

Status:

Journal Publication

Version 1

Abstract

Background

Methods

Results

Conclusions

Figures

Introduction

Materials And Methods

Clinical data and tissue samples

IHC

Cell line and cell culture

Western blotting

Cell transfection and lentivirus infection

RT-PCR

Cell viability assay

Transwell assay

ADP/ATP ratio

Multi-omics analysis

Immunoprecipitation (IP)

Animal studies

Results

Discussion

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1