Enhancement of hyphae growth and medium optimization by Pleurotus eryngii-3 under submerged fermentation

doi:10.21203/rs.3.rs-1892021/v1

Download PDF

Research Article

Enhancement of hyphae growth and medium optimization by Pleurotus eryngii-3 under submerged fermentation

https://doi.org/10.21203/rs.3.rs-1892021/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

There were a variety of amino acids and polysaccharides in Pleurotus eryngii contained that could improve human immunity and prevent cancer. In this paper, the medium was screened and carton and nitrogen sources were screened and optimized as 40 g/L corn flour and soybean meal by P. eryngii-3. Then, the effect of pH, temperature, volume, and rotate speed were investigated, in which the suitable fermentation conditions were respectively pH = 6, 27 ℃, 90 mL of fermentation broth, and 150 r/min of rotate speed. Meanwhile, the transcription levels of lcc1, lcc5, lcc8, and lcc12 were up-regulated by 10.25-, 3.32-, 2.33- and 6.29-fold respectively after optimization. In addition, the box-behnken design was utilized to improve DCW (17.23 g/L). This research was optimized the medium and condition of fermentation by P. eryngii-3, which could shorten the ripening cycle of seeds and improve economic benefits for industries.

Pleurotus Eryngii-3

Fermentation optimization

Response surface method

Laccase

Biomass

Pleurotus eryngii was a large succulent toadstool with good quality, which was distributed in Europe, North Africa, and Central Asia (Wang et al., 2016). There were many nutritious in P. eryngii, in which the plant protein content was about 25%. Meanwhile, there were a variety of amino acids and oligosaccharides in P. eryngii, which had an effective function of promoting digestion and absorption (Deora et al., 2021; Niazi and Ghafoor, 2021).

There were many functional components in P. eryngii (such as polysaccharides, triterpenes, ergosterol), the medicinal function of which was hypolipidemic effects, antioxidant, anticancer activity, and lowering the risks of cardiovascular diseases (Stajic et al., 2009; Wei et al., 2018). A variety of functional enzymes were biosynthesized by P. eryngii (ligninolytic enzyme, laccase, Mn-oxidizing peroxidases, and aryl-alcohol oxidase), which were beneficial to decompose lignin and promote the use of biomass materials (Wang, 2020; Zeng et al., 2012; Wyman et al., 2018). In a word, P. eryngii was a popular edible fungus and had been widely researched by experts and scholars at home and abroad for unique flavor, high nutritional value, and numerous medicinal function (Zhang et al., 2020; Wang et al., 2021). However, there were few researches on cultivation and optimization of P. eryngii species. Therefore, the research of submerged cultivation on P. eryngii seed bioproduction technology urgently need to be optimized, which would improve the biomass yield of P. eryngii for its further industrial production.

The common and effective methods for enhancement of mycelial biomass and active metabolites of fungi were optimization of medium and culture process. There were many classic successful cases showing that optimization of biological fermentation was a significant promotion effect on the submerged fermentation of edible fungi (Zhang et al., 2016; Shenbhagaraman et al., 2012; Ge et al., 2020). The medium components (glucose, corn flour and glutinous rice flour) and culture conditions (temperature and agitation rate) were optimized for fermentation of Sparassis latifolia, which achieved the biomass production of 11.96 g/L after 15 days of fermentation under the optimal conditions (Ma et al., 2016). The exopolysaccharides (5.0 g/L) and cell growth of Ganoderma lucidum were improved in submerged cultivation system with optimization of carbon and nitrogen sources concentration and pH control (Alsaheb et al., 2020). The statistical design of experiments and mathematical modeling were utilized to increase biomass yield of Inonotus obliquus in the submerged cultivation, in which the bioreactor culture yielded 2.084 g/L after 15 days of cultivation (Petre et al., 2021). Thence, the optimization of medium components and fermentation conditions was significantly beneficial to enhancement of biomass yield by edible fungus.

In this work, the authors attempted to increase the mycelia of P. eryngii-3 by using single element inspection and statistical experiments for optimization of medium components and fermentation conditions. Through the above effective optimization experiments, the seed quality of P. eryngii was well optimized for industrial manufacture.

2.1. Microorganism

Pleurotus eryngii-3 cultured in this work was friendly provided by Jiangsu Jiuhe Biotechnology Development Co., Ltd., which was the special strain utilized in industrial production. P. eryngii-3 was activated in potato dextrose agar medium (PDA) from the seed tube. The inoculated cultures were cultivated at 25 ºC for 336 h. The grown colonies were sub-cultured on PDA agar medium, in which the mycelium was homogenized and used as inoculum to the fermentation medium.

2.2. Medium Screening for mycelium of P. eryngii-3

The screened medium was selected from the literature for enhancement of mycelium by P. eryngii-3. The compositions of nine different media were as follows in (g/L): Medium (1): glucose 30, corn flour 25, wheat bran 20, yeast extract 5, KH₂PO₄ 3, MgSO₄ 2; Medium (2): corn flour 30, peptone 5, glucose 20, potassium dihydrogen phosphate 1.5, magnesium sulfate 1, pH 6.0-6.5; Medium (3): soy flour 30, yeast extract 1, glucose 30, MgSO₄ 0.5, Fe₂(SO₄)₃ 0.1, KH₂PO₄ 0.5, vitamin B1 0.01; Medium (4): potato 100, wheat bran 30, sucrose 27, peptone 1.4, potassium dihydrogen phosphate 0.85, magnesium sulfate 1; Medium (5): soybean meal powder 60, glucose 20, KH₂PO₄ 0.5, MgSO₄ 0.5, VB1 0.01, peptone 3; Medium (6): glucose 60, peptone 5, soybean meal 60, KH₂PO₄ 0.5, MgSO₄ 0.5, vitamin B1 0.01; Medium (7): glucose 10, peptone 5, soybean meal 60, KH₂PO₄ 0.5, MgSO₄ 0.5, vitamin B1 0.01; Medium (8): brown sugar or white granulated sugar 30, soybean cake powder 5, KH₂PO₄ 1.5, MgSO₄ 1; Medium (9): glucose 20, peptone 2.5, yeast extract 2.5, manganese chloride 1, KH₂PO₄ 1, MgSO₄ 1.

The medium was prepared and loaded with 80 mL of broth in 250 mL of Erlenmeyer flask. A piece of hyphae with the size of 0.5 × 1.5 cm² from the active PDA was inoculated into the above shake flask. The fermentation was cultured in rotary shaker with 150 r/min and 25 ± 0.5 ºC for 216 h.

2.3. Medium Optimization by Single Factor and Orthogonal Experiment

The variety of carbon source and nitrogen source had an important role in development and growth of edible fungus. Therefore, the kinds and concentration of carbon source and nitrogen source were optimized based on the determined medium. The carbon source was selected from maltose, cornmeal, lactose, fructose, and control. The nitrogen source was chosen from peptone, beef extract, sodium nitrate, urea, and control. The concentration of carbon source and nitrogen source was both set as 10, 20, 30, 40, 50 and 60 g/L for. Then, the orthogonal design was utilized to further optimize the concentration of decided carbon source and nitrogen source. The concentration design was list in the Table. 1 with the 2 factors and 3 levels of orthogonal experiment.

2.4. Optimization of fermentation conditions

The fermentation conditions also had a significant impact on development and growth of hypha. In this work, culture time (120, 144, 168, 192 and 216 h), pH (5, 6, 7, 8 and 9), temperature (21, 23, 25, 27 and 29 ºC), volume (80, 90, 100, 110 and 120 mL), and rotating speed (140, 145, 150, 155 and 160 r/min) were set different levels to affect the biomass, total protein, and polysaccharides of P. eryngii-3.

2.5. Optimization of significant variables using Box-Behnken design (BBD)

The BBD of response surface method (RSM) with Design Expert software 12.0.3 was applied to optimize the fermentation conditions of P. eryngii-3. The temperature, volume and rotate speed were set as the optimized factors, and the response was set as DCW of P. eryngii-3. The RSM contained 17 experiments that included 3 independent replications for each ratio of starter culture to evaluate the effect of the combination of the 3 independent variables as shown in Table 2. The behavior of the system was described by the following quadratic equation:

$$Y={\beta }_{0}+\sum {\beta }_{i}X+\sum {\beta }_{ij}XY+\sum {\beta }_{ii}{X}^{2}$$

In which yield (Y) was the predicted response, β₀ was the intercept term, β_i was the linear effect, β_ii was the quadratic effect, β_ij was the interaction effect, and X and Y were the encoded independent variables.

2.6. Analysis

2.6.1. Detection of total protein

The assay of total protein was used the Coomassie bright blue colorimetry. The preparation of protein standard curve was described as: the seven different concentrations (10, 20, 30, 40, 60 and 80 µg/mL) of bovine serum albumin solution (standard protein solution) were dissolved, mixed, and maintained in room temperature for 3 min. The standard protein solution was detected in 595 nm by UV-visible spectrophotometer (752N, Mettler-Toledo Instruments (Shanghai) Co., Ltd.).

The sample testing process was followed as: the mycelium was selected by 80 mesh screens form 15 mL of broth at 9 days of fermentation process. The crude enzyme solution was achieved by the mycelium grinding with 5 g of quartz sand in the ice-water bath and centrifuging with 4000 r/min for 15 min in 4 ºC. 1 mL of crude enzyme solution was added with 4 mL of Coomassie bright blue G-250, then shaken evenly and placed at room temperature for 3 min, which was analyzed in 595 nm.

2.6.2. Determination of polysaccharides content

The different concentrations (0, 0.01, 0.02, 0.03, 0.04 and 0.05 mg/mL) of glucose were prepared in 6 clean tubes, which was added with 4 mL of anthrone reagent in the ice-water bath. The mixture was boiled 10 min, and cooled with water to room temperature for 10 min, which was detected in 620 nm by UV-visible spectrophotometer. 500 µL of crude enzyme solution in detection of total protein was added with 500 µL of distilled water. Then, the treated process was described above and the results were detected in 620 nm.

2.6.3. Detection of dry cell weight (DCW) for P. eryngii-3

The dry cell weight (DCW) of P. eryngii-3 was detected as the weight of P. eryngii-3. The mycelium was selected and collected by 80 mesh screens at 216 h of fermentation, then which was cleaned by deionized water for 3 times. The wet mycelium was processed by vacuum filtration and dried in the constant temperature drying oven (DHG-9140, Tianjin Test Instrument Co., Ltd.). Until constant weight, the mycelium was weighted by analytical balance (AE240, Mettler-Toledo Instruments (Shanghai) Co., Ltd.).

2.6.4. Determination of growth rate and diameter of mycelium

Some mycelium was random drew form the broth at every 24 h of fermentation, which was lay flat in the PDA. The growth rate of mycelium was detected by vernier caliper, which was calculated between the initial length and the length after 24 h of cultivation. The value of difference in mycelial length was the average value of sample.

The 5 mL of broth at every 24 h of fermentation was sampled and random picked 20 mycelium balls, which were lined up and measured the length by vernier caliper. The determination of diameter of mycelium was set as 3 parallel.

2.6.5. Analysis of laccase activity

The activity of laccase by P. eryngii-3 was utilized the revised method in the reported literature (Bourbonnais and Paice, 1990). The reaction mixture contained 0.5 mM 2,20-azino-bis (3-ethylbenzthiazoline-6-sulfonate) (ABTS), 50 mM sodium acetate buffer (pH 5.0), and 100 µl crude enzyme solution. The crude enzyme solution was taken from 1 mL broth (contained mycelium pellets) by grinding with liquid nitrogen extraction. The laccase activity was detected as oxidation of ABTS at 420 nm (ε₄₂₀ = 3.6 × 10⁴ M^− 1 · cm^− 1). A unit of laccase activity was defined as the amount of enzyme oxidizing 1 µmol of ABTS per min at 25°C (Cavallazzi et al., 2004). Protein concentration of enzyme solution was determined by standard Bradford method.

2.6.6 qRT-PCR for laccase genes

The RNA extraction kit was utilized to extract total RNA of P. eryngii-3 at sampling point of fermentation. The extracted solution was detected for RNA concentration using a spectrophotometer at A260/280. The method of Passarini et al. (2015) was utilized to detect transcription level of laccase genes after optimization of culture medium and fermentation condition. The extracted RNA and the Premix Script TM Reagent Kit (Takara) were used for reverse transcription. The Premix Ex Taq TM II (Takara) was utilized to determine transcriptional levels of laccase genes according to manufacturer’s procedure. The primer sequences of Lcc genes and GAPDH (housekeeping gene) for PCR amplification and qRT-PCR assay were displayed in Table. 3. qRT-PCR experiment was performed by mixing 5 µL SYBR qRT-PCR, 1 µL primers (forward and reverse), template cDNA (2 µL) and double-distilled water. The CFX96 real-time PCR detection system was used to calculate standard curves, CT values and detect transcriptional level of samples.

2.7. Statistical analysis

All data obtained in shake flask culture process were the mean of triplicate experiments. The statistical significances of differences in DCW, concentration of total protein and soluble sugar, growth rate and diameter of mycelium were evaluated using a one-way analysis of variance (ANOVA) and Duncan’s multiple range tests in SPSS version 16.0. A value of P < 0.05 was considered statistically significant.

3.1. Screening of culture medium

The culture medium was the basis of microbial growth and development, which provided the nutrients and energy for fermentation of microbe. A suitable culture medium was beneficial to mycelium growth and product synthesis by P. eryngii-3 in this work. The nine different culture mediums were detected through DCW, total protein, polysaccharides, tie-back speed, and diameter of mycelium in Table 4. The kinds of medium had different effect on physiological and biochemical parameter of P. eryngii-3. The DCW of medium 3 was the maximum (5.9863 ± 0.3518 g/L) in the tested medium, which was 17 times more than medium 9 (0.3513 ± 0.0424 g/L). The parameter of total protein was affected to varying degrees by medium and also reached maximum (0.0811 ± 0.0642 mg/mL) in medium 3. The type of culture medium caused great difference in polysaccharides, in which the polysaccharides achieved 0.2536 ± 0.0161, 0.2303 ± 0.0651, 0.2123 ± 0.0001 and 0.2034 ± 0.0004 mg/mL in medium 5, 8, 3 and 4 respectively. The higher values of tie-back speed were got 0.6725 ± 0.0106, 0.5150 ± 0.0000 and 0.5075 ± 0.0601 mm/d in medium 1, 2 and 3 respectively. The diameter of mycelium in medium 3 reached maximum 2.07000 ± 0.3137 mm. According to the above data analysis, the medium 3 was suitable for growth and metabolism of P. eryngii-3.

3.2. Optimization of carbon and nitrogen sources

Based on the selected medium, the optimization of carbon and nitrogen sources was necessary for enhancement of biomass and effective composition by P. eryngii-3. The five kinds of carbon sources (glucose, corn flour, maltose, lactose, and fructose) were investigated into DCW, total protein and polysaccharides by P. eryngii-3 in Fig. 1. There was different effect on DCW and polysaccharides by different types of carbon sources, in which corn flour had obvious advantage than others (7.512 g/L and 0.3167 mg/mL). The trend of total protein was not distinct by different carbons. After comprehensive comparison, corn flour was determined as the carbon of medium for the fermentation of P. eryngii-3.

Homoplastically, the suitable nitrogen source was selected from soybean meal, peptone, beef extract, sodium nitrate, and urea in Fig. 2. The effect of urea was found that inhibited the growth of P. eryngii-3, in which three parameters were all 0. The biomass and metabolites of P. eryngii-3 by beef extract was lower than peptone, sodium nitrate and soybean meal. The effect of soybean meal was better than other nitrogen sources, the DCW, polysaccharides and total protein was respectively 5.486 g/L, 0.213 mg/mL, and 0.067 mg/mL. Therefore, soybean meal was confirmed as the optimized nitrogen source.

Then, the concentration of screened carbon and nitrogen sources was optimized by biostatistical method. The two-factor three-level orthogonal test of corn flour and soybean meal was designed for identifying the content of carbon and nitrogen sources in Table. 1. The tendency of DCW was increased by the increasing content of corn flour, and there was no difference of DCW by 30 and 40 g/L of corn flour (mean value 8.2684 and 8.7815 g/L, respectively). The trend of total protein and polysaccharides were similar with DCW by increasing corn flour. While, there was the same effect by test of soybean meal. When corn flour and soybean meal were 40 g/L, the DCW reached the maximum (9.1782 g/L), and total protein and soluble sugar reached higher level (0.0201 and 0.2456 mg/mL, respectively). Therefore, the concentration of corn flour and soybean meal were both set as 40 g/L.

3.3. Determination of culture time by P. eryngii-3

Based on the optimization of medium composition, the experiment of culture time was demonstrated the fermentation period of P. eryngii-3. As Fig. 3A shown, the trend of DCW by P. eryngii-3 was displayed the increased and then decreased. And the maximum of DCW was obtained at 168 h, which maximum value was 9.35 g/L. Meanwhile, the tendency of total protein and soluble sugar were similar with that of DCW, in which the peak value was appeared at 168 h (total protein 0.081 mg/mL, polysaccharides 0.25 mg/mL). Furthermore, the dynamic change of laccase activity was monitored by the fermentation of P. eryngii-3 in Fig. 3B. the activity of laccase wad increased from 120 h to 168 h, and then remained stable (5.35 U/mL at 168 h), which also indicated the maximum of laccase activity was acquired at 168 h. Therefore, the fermentation period was set as 168 h.

3.4. Optimization of fermentation conditions by P. eryngii-3

To further improve the fermentation effect, the optimization of fermentation conditions was operated by P. eryngii-3. The result of pH optimization was displayed in Fig. 4A, in which the trend of DCW, laccase activity, total protein and polysaccharides were all first rise and then fall. The maximum of DCW, laccase activity and polysaccharides were appeared at pH = 6, in which the maximum value were respectively 9.86 g/L, 5.43 U/mL and 0.29 mg/mL. The maximum value of total protein was 0.18 mg/mL, which was at pH = 7. The effect of temperature on fermentation of P. eryngii-3 was in Fig. 4B. The trend of DCW, total protein and polysaccharides were identical, in which the maximum of DCW, total protein and polysaccharides were 11.87 g/L, 0.13 mg/mL, and 0.31 mg/mL at 27 °C. The laccase activity was shown very steady during the different temperature treatment.

As Fig. 4C shown, the tendency of DCW, laccase activity, total protein and polysaccharides were similar by optimization of volume. The suitable volume was 90 mL, in which the maximum value of DCW, laccase activity, total protein and polysaccharides were 12.23 g/L, 5.96 U/mL, 0.15 mg/mL, and 0.39 mg/mL. The effect of rotate speed was shown in Fig. 4D, in which the maximum value of DCW, total protein and polysaccharides were 14.16 g/L, 0.14 mg/mL and 0.41 mg/mL at 150 r/min. the laccase activity was 5.96, 6.13 and 5.84 U/mL at 145, 150 and 155 r/min respectively. Therefore, the optimized results of pH, temperature, liquid medium volume and rotate speed was respectively pH = 6, 27 °C, 90 mL and 150 r/min, in which the DCW and laccase activity were respectively increased by 51.4% and 14.6%.

3.5. Transcription profiling of P. eryngii-3 four Laccase Gene

The laccase activity was significantly improved after optimization of medium and fermentation condition, which might be affected by the variational transcription level of genes encoding laccase. Thus, the transcription level of genes about laccase (lcc1, lcc5, lcc8, and lcc12) were investigated in this work. The changing tendency of lcc genes were analogical, which was firstly increased then decreased in Fig. 5. The transcription level of lcc1 was up-regulated at 120, 168 and 216 h in Fig. 5A, which were respectively 3.23,10.25 and 4.77 folds than control. The expression levels of lcc5 and lcc8 were similar in Fig. 5B and C, which were respectively 1.29, 3.32, 1.62 and 1.59, 2.33, 1.30 folds at 120, 168 and 216 h. The transcription level of lcc12 was improved in Fig. 5D, which were respectively 4.35, 6.29 and 1.61 folds than control after optimization.

3.6. Optimization of significant variables by BBD

The results of RSM were shown as three different gradients for temperature (A), volume (B), and rotate speed (C) in Fig. 6. The following polynomial models were derived from the cubic models:

DCW=17.66+0.1812*A-0.2075*B-0.3762*C-0.0055*AB+1.32*AC+0.44*BC- 1.78*A²-1.98*B²-2.17*C²

The experimental data on ethanol production were analyzed and fit a cubic model with high R² values (0.9758). Setting significance at the 5% level (P < 0.05), the model P value was < 0.0001, which implied that the model was significant in Table. 5. And, the significance of lack of fit was 0.0043 < 0.01, which mean the difference between the fitted model function and the real function was very small, and the fitting effect was very good.

4.1. Screening of culture medium by P. eryngii-3

The culture medium was an important factor for industrial production by P. eryngii-3, which would affect growth of microbe and economic benefit of company. Therefore, the screening of culture medium was imperative for improvement of economic benefit by P. eryngii-3. In this research, the nine media was selected in Table. 1, in which the DCW, total protein, polysaccharides, regrowth rate and diameter of mycelium were investigated. The physiological parameter of regrowth rate and diameter of mycelium were the manifestation of external morphology of P. eryngii-3. The preponderant media in diameter of mycelium was medium 1, 3 and 7 (respectively 1.57500 ± 0.3536, 2.07000 ± 0.3137, 1.13000 ± 0.2054 mm). The medium with the faster regrowth rate was medium 1, 2 and 3 (respectively 0.6725 ± 0.0106, 0.5150 ± 0.0000, 0.5075 ± 0.0601 mm/d). Visibly, the medium 3 could promote the formation of microsphere structure and growth of mycelium.

The biochemical indexes of P. eryngii-3 were researched in DCW, total protein and polysaccharides. The DCW was shown the accumulated biomass by P. eryngii-3, which indicated microorganisms could efficiently absorb and use nutrients from the culture medium. Medium 3, 5 and 6 could be obtained the higher DCW (respectively 5.9863 ± 0.3518, 4.5600 ± 0.1379, 4.8450 ± 0.0124 g/L). The total protein was mean the protein formed by absorption and transformation in P. eryngii-3, in which medium 3, 6 and 7 could achieve a better result (respectively 0.0811 ± 0.0642, 0.0674 ± 0.0088, 0.0697 ± 0.0015 mg/mL). Medium 3, 5 and 8 had a strong advantage in polysaccharides by P. eryngii-3 (respectively 0.2123 ± 0.0001, 0.2536 ± 0.0161, 0.2303 ± 0.0651 mg/mL), which had a variety of biological activities, such as hpyerglycemic, antiviral, antineoplastic (Chen et al., 2013). Therefore, medium 3 was identified as the optimum medium for fermentation of P. eryngii-3 by comparison.

4.2. Optimization of carbon and nitrogen source

The effect of carbon source and nitrogen source were important content of culture medium, which would affect the growth and metabolism of microorganism (Tong et al, 2022; Stajic et al., 2006). The culture medium was confirmed as medium 3 for production by P. eryngii-3, in which the components need to be optimized. In this work, the glucose, corn flour, maltose, lactose, and fructose were investigated as the carbon source in Fig. 1, in which corn flour was determined as the suitable carbon in DCW and polysaccharides. The similar results were found the corn flour was set as the optimized carbon in Lactobacillus plantarum LOCK 0860 for production of probiotics (Archacka et al., 2020). And, the nitrogen source was selected from soybean meal, peptone, beef extract, sodium nitrate and urea in Fig. 2, in which DCW, total protein and polysaccharides were all promoted by soybean meal. The microorganisms, functional properties and structural characteristics of soybean meal was investigated by Bacillus subtilis 21927 (Lu et al., 2022). Meanwhile, the effect of urea was poorer than others, in which P. eryngii-3 had no urease and couldn’t transfer urea as nitrate. In addition, the concentration of corn flour and soybean meal was optimized by orthogonal experiment in Table. 2, in which concentration of corn flour and soybean meal were both determined as 40 g/L through comparation of DCW, total protein and polysaccharides.

4.3. Optimization of fermentation conditions by P. eryngii-3

After the components of culture medium were optimized, the fermentation period was investigated and determined as 168 h (Fig. 3A and Fig. 3B). The fermentation cycle was depended on the biomass, nutrient content (protein, polysaccharides) and laccase activity by P. eryngii-3. The analogical phenomenon was found in the research of Pleurotus ostreatus and Pleurotus eryngii mushroom strains on agro-industrial residues, in which the growth, laccase and biomass production were investigated for screening the optimized fermentation substance (Melanouri et al., 2022).

Then, the fermentation conditions were optimized from pH, temperature, volume and rotate speed. The effect of pH would change the content of H⁺ and OH⁻ in the culture medium, which could affect the important enzymes in growth and metabolism of microbe. In this work, pH = 6 was a suitable pH for the accumulation of biomass and synthesis of active substances by P. eryngii-3. The research of pH was also investigated in lignocellulolytic enzymes by Pleurotus genus and laccase production by common macrofungal (Bellettini et al., 2019; Mathur et al., 2021). The temperature was also another important factor for affecting activity of enzymes and stability of metabolites, and effect of temperature was obvious in DCW and polysaccharides in this paper. The similar phenomenon was found the expression of a versatile peroxidase by Pleurotus eryngii was depended on cultivation temperature (Eibes et al., 2009). The volume of medium had an influence on the concentration of oxygen in the erlenmeyer flask, in which would affect the oxygen uptake of microorganisms. The tendency of DCW, laccase activity, total protein and polysaccharides was coincident by effect of different volume by P. eryngii-3. The volume as a necessary factor in the fermentation of microbe was investigated in production of exopolysaccharide by Oudemansiella radicata in shaken flasks and 5-L bioreactors (Wu et al., 2010). In addition, the rotate speed was a common regulatory parameter in the submerged fermentation, in which rotate speed was frequently optimized. The DCW and polysaccharides were improved very evidently by different rotate speeds. The research of microbial composting by different fruit wastes in submerged fermentations was optimized in rotate speed, which was determined as 80–100 rev. min^− 1 (Petre et al., 2014).

The activity of laccase was obviously improved by optimization of medium and fermentation condition in Fig. 3 and Fig. 4. The laccase could catalyze the oxidation of a wide range of substrates (mainly phenolics, methoxy-substituted monophenols and aromatic amines), which was developed in decomposition lignocellulose, bleaching in paper industries, clarification of juice and wine, synthesis of biofuel (Vats and Mishra, 2020; Ahlawat and Mishra, 2022). Sato et al. (2019) utilized Lentinula edodes to produce the laccase for industrial manufacture, which was verified the lcc1 gene was expressed and then promoted biosynthesis of laccase. Yan et al. (2019) explored the function of lcc genes by Lentinula edodes W1-26 under the conditions of different carbon sources, temperatures, and photoperiods. The transcription level of lcc1, lcc5, lcc8, and lcc12 genes were investigated by optimization of medium and fermentation condition, in which the expression of lcc1 and lcc12were reached respectively 10.25 and 6.29 folds than control at 168 h. It was speculated that P. eryngii-3 might be developed to produce the laccase in industry.

4.4. Optimization of fermentation by BBD

Response surface methodology was the analysis of a response that was influenced by several factors to obtain the optimal conditions of the response (Isham et al., 2019). In the study of Atly et al., the box-behnken experimental design was utilised to obtain the optimum levels of barley, yeast extract, and particle size of the solid substrate for the fermentation of lovastatin by Pleurotus ostreatus (Atly et al., 2019). In this work, the effect of temperature, volume, and rotate speed were better than pH on the metabolic parameters by P. eryngii-3 in Fig. 6. As the results of RSM shown, the model predicted the highest DCW of 17.85 g/L would be obtained with the condition of temperature, volume, and rotate speed was 25.9°C, 96.6 mL, and 152.5 r/min, respectively. Experiments in the shake flask (n = 3) were taken to verify the theoretical optimum. The result of verified experiment was 17.23 g/L DCW with the predicted condition, which was only 3.47% lower than the predicted value of the polynomial equation. That indicated proficiency of the model used for fermentation process optimization.

In this work, the authors hoped to develop a rapid breeding process for Pleurotus eryngii seeds for saving economic cost and time cost in the industrial production. The medium for fermentation of P. eryngii-3 was selected from nine medium and determined the medium 3 as the suitable medium for considering DCW, total protein, polysaccharides, tie-back speed, and diameter of mycelium. Meanwhile, the type and concentration of carton and nitrogen sources were investigated, in which the carton and nitrogen sources were confirmed as corn flour and soybean meal (the concentration both 40 g/L). Then, the fermentation condition of pH, temperature, volume, and rotate speed was optimized for metabolic parameters (DCW, laccase activity, total protein, and polysaccharides) by single factor experiment. The transcription levels of lcc1, lcc5, lcc8, and lcc12 were up-regulated by 10.25-, 3.32-, 2.33- and 6.29-fold respectively after optimization. In addition, the statistical method of BBD was utilized for further improvement of DCW by P. eryngii-3, in which the optimized DCW reached 17.23 g/L. This work would provide the valuable experience and theoretical basis for production of Pleurotus eryngii seeds in industrial production.

Acknowledgements

Special thanks to Jiangsu Jiuhe Biotechnology Development Co., Ltd. for providing Pleurotus eryngii-3.

Author contributions

Changqing Liu: Methodology, Formal analysis, Writing – review & editing. Jiajie Feng: Investigation, Formal analysis. Simin Wang: Investigation, Formal analysis. Yi Cao: Investigation, Formal analysis. Yuxiang Shen: Resources, Conceptualization, Supervision, Funding acquisition.

Funding

This work was supported by Funding for North Jiangsu Science and Technology Special Project of Science and Technology Department in Jiangsu Province (SZ-YC2019044).

Availability of data and materials

All data and materials are included in the article.

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

All authors consent to publication.

Competing interests

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Ahlawat A, Mishra S (2022) Structural, phylogenetic and expression analysis of genes producing lignin degrading enzymes in the basidiomycete Cyathus bulleri and their effect on the release of reducing sugars from agro-residues. Fuel 314: 122716
Alsaheb RA, Zjeh KZ, Malek RA, Abdullah JK, Baz AE, Deeb NE, Dailin D, Hanapi SZ, Sukmawati D, Enshasy HE (2020) Bioprocess optimization for exopolysaccharides production by Ganoderma lucidum in semi-industrial scale. Recent Patents on Food, Nutrition and Agriculture 11(3): 211-218
Archacka M, Celinska E, Białas W (2020) Techno-economic analysis for probiotics preparation production using optimized corn flour medium and spray-drying protective blends. Food Bioprod Process 123: 354-366
Atly B, Yamac M, Yyldyz Z, Solener M (2019) Solid state fermentation optimization of Pleurotus ostreatus for lovastatin production. Pharm Chem J 53(9): 858-864
Bellettini MB, Fiorda FA, Maieves HA, Teixeira GL, Avila S, Hornung PS, Junior AM, Ribani RH (2019) Factors affecting mushroom Pleurotus spp. Saudi J of Biol Sci 26: 633-646
Bourbonnais R, Paice MG (1990) Oxidation of non-phenolic substrates: An expanded role for laccase in lignin biodegradation. FEBS 267(1): 99-102
Cavallazzi JRP, Oliveira MGde A, Kasuya MCM (2004) Laccase production by Lepista sordida. Braz J Microbiol 35: 261-263
Chen J, Yong Y, Xing M, Gu Y, Zhang Z, Zhang S, Lu L (2013) Characterization of polysaccharides with marked inhibitory effect on lipid accumulation in Pleurotus eryngii. Carbohyd Polym 97: 604-613
Deora A, Sharma SS, Kumari P, Dahima V, Kumar S, Rohith M (2021) Cultivation of Kabul Dhingri (Pleurotus eryngii) mushroom by standardizing protocols in subtropical zones of world. Sci Rep-UK 11: 14692-14702
Eibes GM, Lu-Chau TA, Ruiz-Duenas FJ, Feijoo G, Martinez MJ, Martinez AT, Lema JM (2009) Effect of culture temperature on the heterologous expression of Pleurotus eryngii versatile peroxidase in Aspergillus hosts. Bioproc Biosyst Eng 32: 129-134
Ge X, Huang W, Xu X, Lei P, Sun D, Xu H, Li S (2020) Production, structure, and bioactivity of polysaccharide isolated from Tremella fuciformis XY. Int J Biol Macromol 148: 173-181
Isham NKM, Mokhtar N, Fazry S, Lim SJ (2019) The development of an alternative fermentation model system for vinegar production. LWT-Food Sci Technol 100: 322-327
Lu F, Alenyorege EA, Ouyang N, Zhou A, Ma H (2022) Simulated natural and high temperature solid-state fermentation of soybean meal: A comparative study regarding microorganisms, functional properties and structural characteristics. LWT-Food Sci Technol 159: 113125
Ma L, Lin YQ, Yang C, Ying ZH, Jiang XL (2016) Production of liquid spawn of an edible mushroom, Sparassis latifoliaby submerged fermentation and mycelial growth on pine wood sawdust. Sci Hortic-Amsterdam 209: 22-30
Mathur P, Sanyal D, Dey P (2021) Optimization of growth conditions for enhancing the production of microbial laccase and its application in treating antibiotic contamination in wastewater. 3 Biotechnology 11: 81-95
Melanouri EM, Dedousi M, Diamantopoulou P (2022) Cultivating Pleurotus ostreatus and Pleurotus eryngii mushroom strains on agro-industrial residues in solid-state fermentation. Part I: Screening for growth, endoglucanase, laccase and biomass production in the colonization phase. Carbon Resources Conversion 5: 61-70
Niazi AR, Ghafoor A (2021) Different ways to exploit mushrooms: A review. All life 14(1): 450-460
Passarini MR, Ottoni CA, Santos C, Lima N, Sette LD (2015) Induction, expression and characterisation of laccase genes from the marine-derived fungal strains Nigrospora sp. CBMAI 1328 and Arthopyrenia sp. CBMAI 1330. AMB Express 5: 19
Petre A, Ene M, Vamanu E (2021) Submerged cultivation of Inonotus obliquus mycelium using statistical design of experiments and mathematical modeling to increase biomass yield. Applied Sciences 11: 4104-4114
Petre M, Petre V, Rusea I (2014) Microbial composting of fruit tree wastes through controlled submerged fermentation. Ital J Agron 9: 610-614
Sato T, Suzuki Y, Naito M, Minami A, Suzuki N, Yaegashi K, Hirano T (2019) Overexpression of the laccase gene, lcc1, in Lentinula edodes using the pChG vector. Mycoscience 60(4): 246-249
Shenbhagaraman R, Jagadish LK, Premalatha K, Kaviyarasan V (2012) Optimization of extracellular glucan production from Pleurotus eryngii and its impact on angiogenesis. Int J Biol Macromol 50: 957-964
Stajic M, Persky L, Friesem D, Hadar Y, Wasser SP, Nevo E, Vukojevic J (2006) Effect of different carbon and nitrogen sources on laccase and peroxidases production by selected Pleurotus species. Enzyme Microb Tech 38: 65-73
Stajic M, Vukojevic J, Duletic-Lausevic S (2009) Biology of Pleurotus eryngii and role in biotechnological processes: a review. Crit Rev Biotechnol 29(1): 55-66
Tong A, Lu J, Huang Z, Huang Q, Zhang Y, Farag MA, Liu B, Zhao C (2022) Comparative transcriptomics discloses the regulatory impact of carbon/nitrogen fermentation on the biosynthesis of Monascus kaoliang pigments. Food Chem X 13: 100250-100259
Vats A, Mishra S (2020) Laccase isoform diversity on basal medium in Cyathus bulleri and role in decolorization/detoxification of textile dyes and effluent. World J Microb Biot 36(11): 164
Wang B, Zhao N, Li J, Xu R, Wang T, Guo L, Ma M, Fan M, Wei X (2021) Selenium-enriched Lactobacillus plantarum improves the antioxidant activity and flavor properties of fermented Pleurotus eryngii. Food Chem 345: 128770-128778
Wang CY (2020) A review on the potential reuse of functional polysaccharides extracted from the by-products of mushroom processing. Food Bioprocess Tech 13: 217-228
Wang Y, Wang R, Mao WJ, Gong M, Gao YN, Tang LH, Yang RF, Li Y, Zhou CL, Bao DP (2016) A simple and efficient transformation system for the edible mushroom Pleurotus eryngii. Mycoscience, 57(5): 356-360
Wei H, Yue S, Zhang S, Lu L (2018) Lipid-lowering effect of the Pleurotus eryngii (King Oyster Mushroom) polysaccharide from solid-state fermentation on both macrophage-derived foam cells and zebrafish models. Polymers 10: 492-502
Wu CY, Lin YP, Wang JC, Liang ZC (2010) Effect of cultivation conditions on the production of mycelial biomass and exopolysaccharide by submerged culture of a rooting shank medicinal mushroom, Oudemansiella radicata (Relhan) singer (Agaricomycetideae). Int J Med Mushrooms 12(1): 99-110
Wyman V, Henríquez J, Palma C, Carvajal A (2018) Lignocellulosic waste valorisation strategy through enzyme and biogas production. Bioresource Technol 247: 402-411
Yan L, Xu R, Bian Y, Li H, Zhou Y (2019) Expression Profile of Laccase Gene Family in White-Rot Basidiomycete Lentinula edodes under Different Environmental Stresses. Genes 10(12): 1045
Zeng X, Suwandi J, Fuller J, Doronila A, Ng K (2012) Antioxidant capacity and mineral contents of edible wild Australian mushrooms. Food Sci Technol Int 18(4): 367-379
Zhang Q, Zhao L, Li Y, Wang F, Li S, Shi G, Ding Z (2020) Comparative transcriptomics and transcriptional regulation analysis of enhanced laccase production induced by co-culture of Pleurotus eryngii var. ferulae with Rhodotorula mucilaginosa. Applied Microbiol Biot 104: 241-255
Zhang Y, Jiao R, Lu Y, Yao L (2016) Improvement of chaetominine production by tryptophan feeding and medium optimization in submerged fermentation of Aspergillus fumigatus CY018. Bioresour Bioprocess 3: 45-53

Table 1

Two-factor three-level test of corn flour and soybean meal

No.	Corn flour (g/L)	Soybean meal (g/L)	DCW (g/L)	Total protein （mg/mL）	Polysaccharides (mg/mL)
1	20	20	7.8357 ± 0.0540	0.0114 ± 0.0091	0.1801 ± 0.0075
2	20	30	8.7400 ± 0.0477	0.0108 ± 0.0084	0.2025 ± 0.0159
3	20	40	7.6326 ± 0.0442	0.0045 ± 0.0121	0.1713 ± 0.0094
4	30	20	8.0269 ± 1.1181	0.0105 ± 0.0052	0.2457 ± 0.0254
5	30	30	7.8382 ± 1.0456	0.0163 ± 0.0078	0.1667 ± 0.0401
6	30	40	8.9400 ± 0.0212	0.0094 ± 0.0025	0.2014 ± 0.0325
7	40	20	8.2488 ± 0.2156	0.0216 ± 0.0097	0.2154 ± 0.0214
8	40	30	8.9175 ± 0.0035	0.0135 ± 0.0065	0.2354 ± 0.0476
9	40	40	9.1782 ± 0.1105	0.0201 ± 0.0084	0.2456 ± 0.0327

Table 2

Experimental design and results of response surface analysis

Number	Temperature (°C)	Volume (mL)	Rotate speed (r/min)	DCW (g/L)
1	25	90	155	12.00
2	29	80	150	14.36
3	25	80	150	14.25
4	29	100	150	13.45
5	25	100	150	13.56
6	27	100	145	13.78
7	29	90	155	15.36
8	27	90	150	17.56
9	25	90	145	14.69
10	27	90	150	17.87
11	27	90	150	17.51
12	27	80	155	12.36
13	27	90	150	17.67
14	27	100	155	13.21
15	27	90	150	17.69
16	29	90	145	12.78
17	27	80	145	14.69

Table 3

List of primers used for the qRT-PCR of Lcc genes and GAPDH in this study

Genes	Primer Sequence		Amplicon Length (bp)
Genes	Forward Primer (5’-3’)	Reverse Primer (5’-3’)	Amplicon Length (bp)
Lcc1	ATGGTTGAGACCGATTTGCAC	AAGAAGGACGGGAACATTAGGG	159
Lcc5	GGCAGGAGGTGCTGACTACAA	ACGACCTTATTGCGGGCTAAC	195
Lcc8	TCAAATTCCACTTCCCCTACCA	GGACCAAAATAAGAGAGCCAGG	199
Lcc12	GAAGTCCACGCCTATGATGAA	CAGGGTTGGCAATACTAACGA	103
GAPDH	GTTCAAGTACGATTCCGTCCA	TTCTCAGCGAAGACGGTGAC	102

Table 4

Comparison of physiological and biochemical indexes of P. eryngii-3 by nine mediums

Parameters Types		DCW (g/L)	Total protein (mg/mL)	Polysaccharides (mg/mL)		Regrowth rate (mm/d)	diameter of mycelium (mm)
1	3.8250 ± 1.1061		0.0283 ± 0.0011	0.0727 ± 0.0634	0.6725 ± 0.0106		1.57500 ± 0.3536
2	0.5918 ± 0.0400		0.0119 ± 0.0021	0.0768 ± 0.0908	0.5150 ± 0.0000		0.24500 ± 0.0102
3	5.9863 ± 0.3518		0.0811 ± 0.0642	0.2123 ± 0.0001	0.5075 ± 0.0601		2.07000 ± 0.3137
4	2.6950 ± 0.0088		0.0565 ± 0.0267	0.2034 ± 0.0004	0.0750 ± 0.0354		0.95500 ± 0.5861
5	4.5600 ± 0.1379		0.0320 ± 0.0332	0.2536 ± 0.0161	0.2375 ± 0.0177		0.54000 ± 0.2828
6	4.8450 ± 0.0124		0.0674 ± 0.0088	0.1376 ± 0.0016	0.2250 ± 0.0354		1.09000 ± 0.3267
7	3.3950 ± 0.0141		0.0697 ± 0.0015	0.1988 ± 0.0115	0.2000 ± 0.0000		1.13000 ± 0.2054
8	1.5513 ± 0.01414		0.0389 ± 0.0147	0.2303 ± 0.0651	0.2000 ± 0.0707		0.49000 ± 0.1414
9	0.3513 ± 0.0424		0.0151 ± 0.0008	0.0124 ± 0.0018	0.2000 ± 0.0000		0.03500 ± 0.0707

Table 5

Analysis of variance of response surface quadratic model

Source	Sun of Squares	df	Mean Square	F-value	P-value	Significance
Model	64.92	9	7.21	31.36	<0.0001	**
A-Temperature	0.2628	1	0.2628	1.14	0.3205
B-Volume	0.3444	1	0.344	1.50	0.2606
C-Rotate speed	1.13	1	1.13	4.92	0.0620
AB	0.0121	1	0.0121	0.0526	0.8251
AC	6.94	1	6.94	30.19	0.0009	**
BC	0.7744	1	0.7744	3.37	0.1091
A²	13.32	1	13.32	57.93	0.0001	**
B²	16.44	1	16.44	71.50	<0.0001	**
C²	19.90	1	19.90	86.51	<0.0001	**
Residual	1.61	7	0.2300
Lack of Fit	1.53	3	0.5108	26.33	0.0043	**
Pure Error	0.0776	4	0.0194
Cor. Total	66.53	16

P<0.05, *; P<0.01, **

GraphicalAbstract.tif

Download PDF

Version 1

posted

You are reading this latest preprint version

Enhancement of hyphae growth and medium optimization by Pleurotus eryngii-3 under submerged fermentation

Status:

Version 1

Abstract

Figures

1. Introduction

2. Material And Methods

2.1. Microorganism

2.2. Medium Screening for mycelium of P. eryngii-3

2.3. Medium Optimization by Single Factor and Orthogonal Experiment

2.4. Optimization of fermentation conditions

2.5. Optimization of significant variables using Box-Behnken design (BBD)

2.6. Analysis

2.6.1. Detection of total protein

2.6.2. Determination of polysaccharides content

2.6.3. Detection of dry cell weight (DCW) for P. eryngii-3

2.6.4. Determination of growth rate and diameter of mycelium

2.6.5. Analysis of laccase activity

2.6.6 qRT-PCR for laccase genes

2.7. Statistical analysis

3. Results

4. Discussion

4.1. Screening of culture medium by P. eryngii-3

4.2. Optimization of carbon and nitrogen source

4.3. Optimization of fermentation conditions by P. eryngii-3

4.4. Optimization of fermentation by BBD

5. Conclusions

Declarations

References

Tables

Supplementary Files

Status:

Version 1