Tumor necrosis factor α, agonist and antagonists of cannabinoid receptor type 1 and type 2 alter the immunephenotype of stem cells from human exfoliated deciduous teeth

doi:10.21203/rs.3.rs-1895451/v1

Download PDF

Research Article

Tumor necrosis factor α, agonist and antagonists of cannabinoid receptor type 1 and type 2 alter the immunephenotype of stem cells from human exfoliated deciduous teeth

https://doi.org/10.21203/rs.3.rs-1895451/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

The endocannabinoid system (ECS) is composed of endocannabinoid molecules synthesizing and degrading ligands and cannabinoid receptors such as types CB1 and CB2. The ECS is present in various tissues and cell types, such as in central nervous system, immune system, and mesenchymal stem cells. The presence of these receptors in both immune system cells and stem cells shows a common pathway of communication-related to repair and immunomodulation. The aim of the present study was to verify the participation of ECS in the immunomodulatory profile of stem cells from human exfoliated deciduous teeth (SHED), in the presence or absence of TNF-α. SHED was cultured in the presence or absence of the agonist anandamide and the two antagonists AM251 and SR144528 of CB1 and CB2 receptors, under stimulation or not of TNF-α. For immunomodulation analysis, surface molecules linked to immunomodulation: HLA-DR, PD-L1 and PD-L2 were measured by flow cytometry. The results showed that SHED respond to ECS and TNF-α by altering key molecules of the immune response. It is concluded that the inhibition of endocannabinoid receptors added with the pro-inflammatory effect of TNF-α led SHED to show increased HLA-DR, as well as, to assume an anti-inflammatory profile by increasing PD-L1 and PD-L2.

Endocannabinoid system

Stem cells

Dental pulp stem cells

Human exfoliated deciduous teeth

Immunomodulation

Immunoregulation

Mesenchymal stem cells (MSC) are multipotent adult stem cells, capable of self-renewal, maintaining their undifferentiated state after several replication cycles, and can be obtained from various tissues [1–12].

MSC present, besides their regenerative properties, pronounced immunomodulatory capacity. These cells can exert their immunosuppressive potential by cell-cell contact and by the secretion of immune systems regulatory molecules, such as indoleamine 2, 3-dioxygenase (IDO), transforming growth factor beta (TGF-β) and prostaglandin E2 (PGE2) [3; 5; 8; 11–25].

Thus, molecules such as PD-L1 and PD-L2 and HLA, related to cell communication and signaling of importance for the immunomodulatory profile, deserve to be highlighted [26–29]. PD-L1 and PD-L2 are co-stimulatory factors inhibiting the immune response that down-modulates T helper cell activation, inhibits apoptosis of Treg, and inhibit cytokine secretion [30–32]. MSC is able to express and secrete PD-L1 and PD-L2, being regulated by the stimulation of interferon gamma (IFN-γ) and TNF-α [30; 33]. MSC is already known to exhibit minimal expression of HLA-DR. However, exposed to an inflammatory environment, MSC can express or increase the expression of HLA-DR [34].

The ECS consists of a family of receptors, endogenous ligands, and the molecular machinery for their synthesis, being best described in the central nervous system (CNS) [35]. Its main components are: the two "classical" endocannabinoid ligands, N-arachidonoyl ethanolamine (anandamide; AEA) and 2-arachidonoylglycerol (2-AG); and the also "classical" CB1 and CB2 [35–44]. Outside of the CNS, CB1 and CB2 have been identified in the immune system [45–47] as well as in MSC and theirs regenerative and immunomodulatory processes [48–49].

Few papers relate MSC and the ECS. MSC can express all the components of ECS, related to immunomodulatory properties, survival pathways and migration. Also, these cells are producers of endocannabinoids, such as AEA, 2-AG, and oleoylethanolamide (OEA) [48;50].

Considering that ECS is a shared system by the immune response and the MSC; the few works about ECS and MSC in the immunomodulation, and the need to improve this investigation; the present study aimed to evaluate the immunomodulatory profile of SHED in the presence of TNF-α and agonist/antagonist of CB1 and CB2.

2.1. ISOLATION OF SHED

The acquisition of the teeth followed a declaration of consent signed by the responsible person for the minors. All proceedings were performed in accordance with the ethical standards of the local ethics committee (CEP/UFJF No. 003/2011; CAAE No 33905014.4.0000.5133). The samples are stored in the Biobank Human Genetics and Cell Therapy (CONEP B-030), Federal University of Juiz de Fora.

The SHED were isolated from a healthy volunteer and cultured according to Gronthos et al. (2000) [1] and Liu et al. (2013) [51] modified. The dental pulp was dilacerated with a scalpel and then washed in Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12 (DMEM/F12) (Invitrogen, USA) supplemented with 10% fetal bovine serum (FBS; LGC Biotecnologia, Brasil), 100 U/mL penicillin and 100 µg/mL streptomycin, 2mM L-glutamine and 0.01mM non-essential amino acids (Invitrogen), until the release of the cells. The isolated SHED were kept in 75 cm² culture flasks in supplemented DMEM/F12 at 37 ºC and 5% CO2 and expanded until 70% confluence.

2.2. MOLECULAR CHARACTERIZATION OF SHED

The SC genes of markers related to hematopoietic (CD34 and CD45); mesenchymal (Nestin and CD105); and embryonic (Nanog and OCT4), were analyzed by RT-PCR (Table 1). The RNA yield was verified in 2% agarose gel.

Table 1

Primer sequences.
Markers	Primer F	Primer R	Amplicon (pb)	Tm (°C)
Embryonics
OCT4	ACTTCACTGCACTGTACTCCTCAG	AGGTTCTCTTTCCCTAGCTCCTC	158	60
NANOG	CTACCCCAGCCTTTACTCTTCCTAC	CTCTCCACAGTTATAGAAGGGACTG	217	60
Hematopoietics
CD34	AACACCTAGTACCCTTGGAAGTACC	AACACTGTGCTGATTACAGAGGTC	177	60
CD45	GGACACAGAAGTATTTGTGACAGG	GAGAAGTTGTGGTCTCTGAGAAGTC	176	60
Mesenchymals
Nestin	GGACCCTCCTAGAGGCTGAG	GTGAGGAGAGGGGAGTAGGG	168	60
CD105	TGCCACTGGACACAGGATAA	CCTTCGAGACCTGGCTAGTG	205	60
Controls
Beta-actin	ATTAAGGAGAAGCTGTGCTACGTC	GATGGAGTTGAAGGTAGTTTCGTG	213	60
GAPDH	GAAGGTGAAGGTCGGAGTC	GAAGATGGTGATGGGATTTC	226	58

2.3. SHED OSTEOGENIC DIFFERENTIATION

Analysis of in vitro differentiation was performed to evaluate the differentiation capacity of SHED. The established lines were submitted to osteogenic differentiation. A density of 1x10⁴ cells were plated in 6-well plates, and, after 24 h of culture in regular medium, SHED populations were washed, and then the medium was substituted by osteogenic differentiation medium (DMEM-LG, 10% FBS, 1x10^-8 M dexamethasone, 0.2 M L-Ascorbic acid 2-phosphate and 10 mM β-Glycerol phosphate) and the SHED were kept in culture for 14 days. All experiments were done in triplicates. In the end, calcium deposition was evaluated by Alizarin Red S (Sigma-Aldrich, USA) staining according to the manufacturer.

2.4. CELL CULTURE AND ECS STIMULATION

SHED were cultivated (1x10⁵ cells/well in 6-well plates) during 48 hours (Table 2) in the presence of 5 µM of anandamide (Ago; Cayman Chemical, USA), in the presence or absence of 2 µM of AM251 (Ant1; Cayman Chemical) and 2 µM of SR144528 (Ant2; Cayman Chemical), and stimulated or not with 10 ng/mL of TNF-α (Sigma-Aldrich), in supplemented DMEM/F12 at 37 ºC and 5% CO2 [52–54].

Table 2

Description of the groups used for immunomodulation of SHED.
	TNF-α (-)	TNF-α (+)
Groups	Medium	Medium
	Anandamida (Ago)	Anandamida (Ago)
	AM251 (Ant1)	AM251 (Ant1)
	SR144528 (Ant2)	SR144528 (Ant2)
	Ant1 + Ant2 (Ant1 + 2)	Ant1 + Ant2 (Ant1 + 2)
	Ago + Ant1	Ago + Ant1
	Ago + Ant2	Ago + Ant2
	Ago + Ant1 + Ant2 (Ago + Ant1 + 2)	Ago + Ant1 + Ant2 (Ago + Ant1 + 2)

2.5. CELL VIABILITY

The cellular viability was evaluated in 500 cells/well, plated in 96-well plate, and cultivated in the presence of 5 µM of anandamide, in the presence or absence of 2 µM of AM251 and 2 µM of SR144528, and stimulated or not with 10 ng/mL of TNF-α (Table 2), in supplemented DMEM/F12 at 37 ºC and 5% CO2. After 48h, was added to the wells 10% of the solution of 0.15 mg/mL of Resazurin sodium salt (Alamar Blue®, Thermo Fisher Scientific, USA). SHED was incubated for 4 hours and the absorbance read at 570 nm and 600 nm.

2.6. FLOWCYTOMETRY ANALYSIS OF CELL MARKERS

For flow cytometry analysis, cultured SHED (Table 2) were washed three times in 1X PBS, enzymatically disaggregated using 0.25% Trypsin (TrypLE Express, Invitrogen, USA) for five minutes at 37°C, and inactivated with the culture medium. The cells were centrifuged at 300xG for five minutes, counted using a hemocytometer, and destined for labeling of the surface markers (HLA-DR, PDL-1, and PDL-2). 50,000 events were acquired for each group and unlabeled SHED with antibodies was used as a negative control. The experiment was done in triplicate.

2.7. STATISTICAL ANALYSIS

The data collected in vitro were analyzed by appropriate statistical tools taking into account the sample number and its normal distribution, using the Shapiro-Wilk normality test. Comparisons between the means of the analyzed groups were made using the Kruskal-Wallis test, and as post-test Dunn's multiple comparison test. The differences were considered significant when p < 0.05 for the two-tailed analysis. Graphs and statistical analyses were generated using GraphPad Prism software (version 7; GraphPad Software, Inc., USA).

3.1. ISOLATION,CHARACTERIZATION,ANDDIFFERENTIATIONOFSHED

SHED, isolated and cultivated in basal medium, showed a typical fibroblast-like appearance (Fig. 1A). To test the osteogenic differentiation, isolated cells were cultured in osteogenic induction medium. SHED showed osteoblast-like morphology and, after staining with alizarin red, the deposition of calcium was evidenced (Fig. 1B).

The isolated SHED was analyzed to show the expression of typical marker genes by RT-PCR. The molecular characterization (Fig. 1C) showed that SHED expressed not only the marker genes for MSC (Nestin and CD105) but also the marker genes in embryonic cells (Nanog ad OCT-4). The marker genes for hematopoietic lineages (CD34 and CD45) were not expressed, as expected [12; 55].

Regarding viability, SHED cultured in a combination of the presence or absence of agonist, antagonists and TNF-α showed no significant difference between the groups as well as compared to cells cultured with medium alone (data not shown).

3.2. HLA-DR EXPRESSION

Initially, all groups were compared with the group cultured only with medium (Medium; without the presence of TNF-α, agonist and antagonists) to verify in which situation the SHED could have the amount of HLA-DR altered on their surfaces. Only the groups that received TNF-α, agonist, and mainly antagonist 2 (Ago + Ant2 + TNF and Ago + Ant1 + 2 + TNF) showed a statistically significant difference compared to Medium (Fig. 2A). After this, it was analyzed whether TNF-α or the agonist or both could alter the level of HLA-DR. Despite a slight increase in the level of this marker in SHED in the presence of TNF-α or TNF-α and agonist, there was no statistical difference between the groups (Fig. 2B).

Subsequently, the effect of the antagonists was analyzed within the groups that received either TNF-α, agonist, or the combination of both (Fig. 2C-F). The presence of the antagonists alone did not lead to a change in HLA-DR levels (Fig. 2C). However, the groups that received both antagonists (Ant1 + 2) and also received agonist (Fig. 2D), TNF-α (Fig. 2E) or Agonist + TNF-α (Fig. 2F), showed a difference from their respective reference groups (Ago, TNF-α and Ago + TNF-α).

3.3. PD-L1EXPRESSION

Regarding the comparison of all groups with Medium it was found that the groups that received antagonist 2 or both antagonists in the presence of TNF-α, but independent of the agonist, showed a significant difference (Fig. 3A). When comparing the means between the Medium, Ago, TNF-α, and Ago + TNF-α groups, the groups that received TNF-α showed an increase compared to the Medium and Ago groups, but only between the Medium and Ago + TNF-α groups had a significant difference (Fig. 3B). When the role of the antagonists was analyzed, the groups that received both antagonists showed a significant difference from their references: without agonist and without TNF-α (Fig. 3C), with agonists (Fig. 3D), with TNF-α (Fig. 3E), or with agonists and TNF-α (Fig. 3F).

3.4. PD-L2 EXPRESSION

Following the same pattern for the other markers, PD-L2 levels were also significantly increased relative to the Medium group in the groups that received antagonists 1, or 2, or both, in the presence of TNF-α; except for the Ant1 + TNF-α and Ago + Ant1 + TNF-α groups whose increase in PD-L2 levels was not significant (Fig. 4A).

SHED showed increased PD-L2 levels in the presence of TNF-α, but the increase in this marker was significant when SHED was cultured in the presence of TNF-α along with the agonist (Fig. 4B). As for the analyses for the antagonists in cells that did or did not receive agonists, and that did or did not receive TNF-α, there were no significant changes between groups for the PD-L2 marker (Fig. 4C-F).

Most studies treat MSC as potent inhibitors of the immune system. It is currently understood that such property of MSC is not fixed or constitutive, but influenced by the inflammatory environment. The immune system should act as a mediator, regulating not only the immunomodulatory properties of MSC but also their proliferation and differentiation, actively influencing the damage recovery process. Some inflammatory molecules, such as TNF-α and IFN-γ, seem to be involved [3;8;10;15;23;25].

MSC apparently has an immunoregulatory role and an antigen-presenting cell (APC) role, depending on the type, intensity and timing. At the beginning of the establishment of the inflammatory process MSC increases their antigen-presenting potential in order to fight a possible infection. However, as inflammation progresses, the environment modulates MSC to acquire their immunosuppressive potential, bringing the cellular and tissue environment to homeostasis. [5; 9; 10; 56–62].

Different types of MSC share immunomodulatory effects with great therapeutic potential, and in this sense the immunomodulatory capacity of dental pulp stem cells (DPSC) and SHED is no exception, showing sometimes superior capacity to traditional bone marrow mesenchymal stem cells (BMSC) [1; 51; 56].

About ECS, outside of the CNS, CB1 has also been identified in the liver, bone marrow, pancreas, lungs, vascular system, muscles, gastrointestinal tract, reproductive organs, and the immune system [45–47]. CB2 has also been detected in the immune system, mainly in B cells, natural killer cells, and monocytes, which have an active role in the modulation of cell migration and cytokine release [45–47]. Molecules involved in ECS appear to be produced from membrane phospholipid precursors, exerting as immunomodulatory actions, such as decreased production of pro-inflammatory cytokines, modulation of T-helper (Th) 1 and Th2 (TH1/TH2) cell responsiveness and [39;42;63–64].

MSC can express all the components of ECS. AEA, CB1, and CB2 are expressed and are involved in the physiological protection of intense inflammatory responses, with CB1 participating in the healing of inflamed tissues. Furthermore, CB1 is activated during osteogenic differentiation of BMSC and periodontal ligament stem cells, even in an inflammatory environment. Moreover, CB1 was observed to be an essential component in the survival of differentiated cells during acute stress [48–49].

The present study sought to evaluate the results within two situations: the presence of TNF-α and the role of ECS in the possible cellular phenotypic alterations. In general, TNF-α and CB1 and CB2 receptor antagonists, but especially the CB2 antagonist, were able to alter the immunological phenotype of ECS relative to the three markers analyzed. Since there was no significant difference in the cell viability test, any change occurring between the groups is from alteration in the immunological phenotype of SHED.

On HLA-DR expression, not only the presence of TNF-α together with the antagonists (mainly CB2-related) but the presence of the agonist led to increased HLA-DR expression in SHED. In this sense, anandamide may be activating other ECS receptors, such as G protein-coupled receptor 55 (GPR55) and Transient receptor potential (TRP) channels and their respective subfamilies [43]. These results suggest that SHED become able to respond immunologically under these conditions. Cabeza et al. (2019) showed that these cells, under inflammatory conditions, are able to interact with T lymphocytes via HLA-DR, since HLA-DR is especially responsible for initiating adaptive immunity by presenting antigens to these lymphocytes (Perales and Brink, 2012). The results of the present study corroborate the possibility of SHED are functioning as APC or the possibility of inhibiting inflammatory processes via the presentation of specific antigens to T cells, depending on the degree of inflammation of the microenvironment. It is known that the presence of SHED in the inflammatory environment is able to lead to decreased proliferation of Th and increased Treg [9; 56–58], explaining the targeting/maintenance of an immunoregulatory profile.

According to Figs. 3A and 4A, it can be seen that TNF-α together with the antagonists were able to drive SHED towards an immunomodulatory profile both via PD-L1 and PD-L2. This result was most evident for PD-L1, in which blockade of CB1 and CB2 increased the levels of this marker, especially in the presence of TNF-α. Thus, the increase in PD-L1 and PD-L2 under these conditions corroborates the results of studies in which the presence of SHED in an environment of inflammation was able to lead to immunoregulation [9; 56–58] Specifically, the CB1 receptor antagonist showed only a slight increase in HLA-DR and PD-L1 levels when SHED were cultured in the presence of TNF-α; however, not significantly. The contribution of the CB2 antagonist, in the presence of TNF-α, on all three markers was evident, most notably for HLA-DR and PD-L1. However, the changes were only significant when both antagonists were used. In this sense, regarding CB1 and CB2 receptors, the literature is contradictory, with the consensus being only the participation of ECS in immunomodulation, but not the role of activation and blockade of each one of the receptors in specific [39; 42; 63–64]. Galve-Roperh et al. (2013) describe that CB2 activation is associated with chronic inflammation of the nervous system as well as different immune disorders. Montanari et al. (2019), in turn, describe a series of novel benzofuran-based compounds with neuroprotective and immunomodulatory properties for the treatment of Alzheimer's disease, from the change of pro-inflammatory M1 phenotype to neuroprotective M2 phenotype of microglia. Rossi (2013) reports that CB1 is known to promote inflammation while CB2 regulates its magnitude. Moreno et al. (2019) observed that CB2 ligands are responsible for the observed immunomodulatory effects.

As already known, ECS are present in both immune system cells and MSC, expressing both CB1 and CB2 receptors, suggesting a possible common route of immunomodulation, mainly via CB2 [48;50;64]. In a study with endothelial progenitor cells, the release of the endocannabinoids AEA and 2-AG by these cells was verified. In the presence of TNF-α, there was an increase in 2-AG. Moreover, after treatment of this mature cell line with endocannabinoids, a reduction in the induction (by TNF-α) of the pro-inflammatory adhesion molecule CD106 (VCAM) was observed [65]. In addition, cannabidiol was also found to protect oligodendrocyte progenitor cells from apoptosis induced by lipopolysaccharides LPS- or INF-γ-stimulated inflammation. Cannabidiol treatment reversed caspase 3 induction, decreased reactive oxygen species production and endoplasmic reticulum stress-induced apoptosis, followed by decreased molecular effectors Bax and caspase 12 [39].

The CB1 receptor has been shown to have its expression increased during osteogenic MSC differentiation and to be essential for the survival of these differentiated cells [48]. Tetrahydrocannabinol (THC) was able to activate the CB2 receptor, increasing BMSC immunoregulation on the release of inflammation-associated cytokines [TNF-α, interleukin (IL) -1β, IL-6, and IL-8]. Furthermore, hyperalgesia and allodynia were significantly reduced when MSC pretreated with THC was administered; consequently, pro-inflammatory cytokines were also observed to be significantly reduced, while IL-10 showed increased [66]. Also, it was shown that CB2 activation in MSC led to increased IL-10 release and reduced LPS-induced pro-inflammatory cytokines IL-1β, IL-8, and IL-17 [50].

A study analyzing the molecular phenotype of Gingival Mesenchymal Stem Cells (GMSC), verified that treatment with cannabidiol prevented the expression of genes of the NALP3-inflammasome pathway, suppressing the levels of NALP3, CASP1, and IL-18, demonstrating in parallel the inhibition of apoptosis, accompanied by the suppression of Bax. Cannabidiol treatment was also able to reduce the expression of genes involved in the activation of the immune system (CD109, CD151, CD40, CD46, CD59, CD68, CD81, CD82, CD99), while stimulating the expression of genes involved in the inhibition of immune responses (CD47, CD55, CD276) (Libro et al., 2017). In another study, it was shown that pretreatment of GMSC with cannabidiol led to attenuation of the expression of genes implicated in the etiopathogenesis of Alzheimer's disease, showing that preconditioned GMSC have potential in the treatment of early-stage Alzheimer's disease [67].

The findings of the present work give strength to the hypothesis that SHED have an immunomodulatory role in an environment with the presence of inflammatory molecules, and may act directly in contact with cells of the immune system in coordinating the inflammatory process by inhibiting the adaptive response via PD-L1 and PD-L2; possibly occurring together with the HLA-DR and TCR interaction, leading -to lymphocyte tolerance [27–29; 34; 68].

We conclude that the inhibition of endocannabinoid receptors together with the pro-inflammatory effect of TNF-α led SHED to show an increase of HLA-DR on their surface, but at the same time led these cells to assume an anti-inflammatory profile by increasing PD-L1 and PD-L2. The agonist also influenced the alteration of these surface proteins, but the present work could not show exactly the modulation of the immune profile of the SHED since ECS is complex and presents other receptors not analyzed here. However, this study contributed to broadening the investigation of the interaction of SHED and ECS in relation to immunomodulation. This work showed, by the interaction between the MSC, immune system, and ECS, the importance of investigating the cellular and physiological effects of active principles that act on ECS for the elucidation and demystification of their actions and consequences in the treatment of diseases.

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

FUNDING

This work was supported by the Minas Gerais State Agency for Research and Development (Fapemig) [APQ-00496-14]; and the Brazilian National Council for Scientific and Technological Development (CNPq) [442142/2014-5].

Gronthos S, Mankani M, Brahim J, Robey PG, Shi S. Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo. Proc Natl Acad Sci U S A. 2000 Dec 5;97(25):13625–30. doi: 10.1073/pnas.240309797.
Zuk PA, Zhu M, Mizuno H, Huang J, Futrell JW, Katz AJ, Benhaim P, Lorenz HP, Hedrick MH. Multilineage cells from human adipose tissue: implications for cell-based therapies. Tissue Eng. 2001 Apr;7(2):211–28. doi: 10.1089/107632701300062859.
De Miguel MP, Fuentes-Julián S, Blázquez-Martínez A, Pascual CY, Aller MA, Arias J, Arnalich-Montiel F. Immunosuppressive properties of mesenchymal stem cells: advances and applications. Curr Mol Med. 2012 Jun;12(5):574–91. doi: 10.2174/156652412800619950.
Le Blanc K, Mougiakakos D. Multipotent mesenchymal stromal cells and the innate immune system. Nat Rev Immunol. 2012 Apr 25;12(5):383 – 96. doi: 10.1038/nri3209.
Silva FS, Almeida PN, Rettore JV, Maranduba CP, de Souza CM, de Souza GT, Zanette Rde S, Miyagi SP, Santos Mde O, Marques MM, Maranduba CM. Toward personalized cell therapies by using stem cells: seven relevant topics for safety and success in stem cell therapy. J Biomed Biotechnol. 2012;2012:758102. doi: 10.1155/2012/758102.
Galve-Roperh I, Chiurchiù V, Díaz-Alonso J, Bari M, Guzmán M, Maccarrone M. Cannabinoid receptor signaling in progenitor/stem cell proliferation and differentiation. Prog Lipid Res. 2013 Oct;52(4):633–50. doi: 10.1016/j.plipres.2013.05.004.
Sartipy P. Advancing pluripotent stem cell culture: it is a matter of setting the standard. Stem Cells Dev. 2013 Apr 15;22(8):1159-61. doi: 10.1089/scd.2012.0668.
Ma S, Xie N, Li W, Yuan B, Shi Y, Wang Y. Immunobiology of mesenchymal stem cells. Cell Death Differ. 2014 Feb;21(2):216–25. doi: 10.1038/cdd.2013.158.
Silva FS, Ramos RN, de Almeida DC, Bassi EJ, Gonzales RP, Miyagi SP, Maranduba CP, Sant'Anna OA, Marques MM, Barbuto JA, Câmara NO, da Costa Maranduba CM. Mesenchymal stem cells derived from human exfoliated deciduous teeth (SHEDs) induce immune modulatory profile in monocyte-derived dendritic cells. PLoS One. 2014 May 20;9(5):e98050. doi: 10.1371/journal.pone.0098050.
Wang Y, Chen X, Cao W, Shi Y. Plasticity of mesenchymal stem cells in immunomodulation: pathological and therapeutic implications. Nat Immunol. 2014 Nov;15(11):1009–16. doi: 10.1038/ni.3002.
Bianco J, De Berdt P, Deumens R, des Rieux A. Taking a bite out of spinal cord injury: do dental stem cells have the teeth for it? Cell Mol Life Sci. 2016 Apr;73(7):1413–37. doi: 10.1007/s00018-015-2126-5.
Luo L, He Y, Wang X, Key B, Lee BH, Li H, Ye Q. Potential Roles of Dental Pulp Stem Cells in Neural Regeneration and Repair. Stem Cells Int. 2018 May 7;2018:1731289. doi: 10.1155/2018/1731289.
Bartholomew A, Sturgeon C, Siatskas M, Ferrer K, McIntosh K, Patil S, Hardy W, Devine S, Ucker D, Deans R, Moseley A, Hoffman R. Mesenchymal stem cells suppress lymphocyte proliferation in vitro and prolong skin graft survival in vivo. Exp Hematol. 2002 Jan;30(1):42–8. doi: 10.1016/s0301-472x(01)00769-x.
Krampera M, Glennie S, Dyson J, Scott D, Laylor R, Simpson E, Dazzi F. Bone marrow mesenchymal stem cells inhibit the response of naive and memory antigen-specific T cells to their cognate peptide. Blood. 2003 May 1;101(9):3722-9. doi: 10.1182/blood-2002-07-2104. Epub 2002 Dec 27.
Le Blanc K, Tammik C, Rosendahl K, Zetterberg E, Ringdén O. HLA expression and immunologic properties of differentiated and undifferentiated mesenchymal stem cells. Exp Hematol. 2003 Oct;31(10):890–6. doi: 10.1016/s0301-472x(03)00110-3.
Zhang W, Ge W, Li C, You S, Liao L, Han Q, Deng W, Zhao RC. Effects of mesenchymal stem cells on differentiation, maturation, and function of human monocyte-derived dendritic cells. Stem Cells Dev. 2004 Jun;13(3):263–71. doi: 10.1089/154732804323099190.
Aggarwal S, Pittenger MF. Human mesenchymal stem cells modulate allogeneic immune cell responses. Blood. 2005 Feb 15;105(4):1815-22. doi: 10.1182/blood-2004-04-1559.
Rasmusson I, Ringdén O, Sundberg B, Le Blanc K. Mesenchymal stem cells inhibit lymphocyte proliferation by mitogens and alloantigens by different mechanisms. Exp Cell Res. 2005 Apr 15;305(1):33–41. doi: 10.1016/j.yexcr.2004.12.013.
Yagi H, Soto-Gutierrez A, Parekkadan B, Kitagawa Y, Tompkins RG, Kobayashi N, Yarmush ML. Mesenchymal stem cells: Mechanisms of immunomodulation and homing. Cell Transplant. 2010;19(6):667–79. doi: 10.3727/096368910X508762.
Bassi ÊJ, Moraes-Vieira PM, Moreira-Sá CS, Almeida DC, Vieira LM, Cunha CS, Hiyane MI, Basso AS, Pacheco-Silva A, Câmara NO. Immune regulatory properties of allogeneic adipose-derived mesenchymal stem cells in the treatment of experimental autoimmune diabetes. Diabetes. 2012 Oct;61(10):2534–45. doi: 10.2337/db11-0844.
Felix RG, Bovolato ALC, Cotrim OS, Leão PDS, Batah SS, Golim MA, Velosa AP, Teodoro W, Martins V, Cruz FF, Deffune E, Fabro AT, Capelozzi VL. Adipose-derived stem cells and adipose-derived stem cell-conditioned medium modulate in situ imbalance between collagen I- and collagen V-mediated IL-17 immune response recovering bleomycin pulmonary fibrosis. Histol Histopathol. 2020 Mar;35(3):289–301. doi: 10.14670/HH-18-152.
Mao AS, Özkale B, Shah NJ, Vining KH, Descombes T, Zhang L, Tringides CM, Wong SW, Shin JW, Scadden DT, Weitz DA, Mooney DJ. Programmable microencapsulation for enhanced mesenchymal stem cell persistence and immunomodulation. Proc Natl Acad Sci U S A. 2019 Jul 30;116(31):15392–15397. doi: 10.1073/pnas.1819415116.
Hoogduijn MJ, Lombardo E. Mesenchymal Stromal Cells Anno 2019: Dawn of the Therapeutic Era? Concise Review. Stem Cells Transl Med. 2019 Nov;8(11):1126–1134. doi: 10.1002/sctm.19-0073.
Paladino FV, Rodrigues JM, da Silva A, Goldberg AC. The Immunomodulatory Potential of Wharton's Jelly Mesenchymal Stem/Stromal Cells. Stem Cells Int. 2019 Jun 11;2019:3548917. doi: 10.1155/2019/3548917.
Tan K, Zhu H, Zhang J, Ouyang W, Tang J, Zhang Y, Qiu L, Liu X, Ding Z, Deng X. CD73 Expression on Mesenchymal Stem Cells Dictates the Reparative Properties via Its Anti-Inflammatory Activity. Stem Cells Int. 2019 May 2;2019:8717694. doi: 10.1155/2019/8717694.
Cabrera, T.; Ruiz-Cabello, F.; Garrido, F. Biological implications of HLA-DR expression in tumours. Scand J Immunol. 1995 Apr;41(4):398–406. doi: 10.1111/j.1365-3083.1995.tb03584.x.
Andersson G. Evolution of the human HLA-DR region. Front Biosci. 1998 Jul 27;3:d739-45. doi: 10.2741/a317.
Erokhina, SA, Streltsova, MA, Kanevskiy, LM, Grechikhina, MV, Sapozhnikov, AM, Kovalenko, EI. HLA-DR-expressing NK cells: Effective killers suspected for antigen presentation. J Leukoc Biol. 2021;109:327–337. Doi: 10.1002/JLB.3RU0420-668RR.
Szeto C, Bloom JI, Sloane H, Lobos CA, Fodor J, Jayasinghe D, Chatzileontiadou DSM, Grant EJ, Buckle AM, Gras S. Impact of HLA-DR Antigen Binding Cleft Rigidity on T Cell Recognition. Int J Mol Sci. 2020 Sep 25;21(19):7081. doi: 10.3390/ijms21197081.
Keir ME, Butte MJ, Freeman GJ, Sharpe AH. PD-1 and its ligands in tolerance and immunity. Annu Rev Immunol. 2008;26:677–704. doi: 10.1146/annurev.immunol.26.021607.090331.
Zak KM, Grudnik P, Magiera K, Dömling A, Dubin G, Holak TA. Structural Biology of the Immune Checkpoint Receptor PD-1 and Its Ligands PD-L1/PD-L2. Structure. 2017 Aug 1;25(8):1163–1174. doi: 10.1016/j.str.2017.06.011.
Han Y, Liu D, Li L. PD-1/PD-L1 pathway: current researches in cancer. Am J Cancer Res. 2020 Mar 1;10(3):727–742.
Davies LC, Heldring N, Kadri N, Le Blanc K. Mesenchymal Stromal Cell Secretion of Programmed Death-1 Ligands Regulates T Cell Mediated Immunosuppression. Stem Cells. 2017 Mar;35(3):766–776. doi: 10.1002/stem.2509.
Cabeza, V. P.; Hoogduijn, M. J.; Kraaijeveld, R.; Franquesa, M.; Witte-Bouma, J.; Wolvius, E. B.; Farrell, E.; Brama, P. A. J. Pediatric Mesenchymal Stem Cells Exhibit Immunomodulatory Properties Toward Allogeneic T and B Cells Under Inflammatory Conditions. Front Bioeng Biotechnol. 2019 Jun 12;7:142. doi: 10.3389/fbioe.2019.00142.
Grill M, Högenauer C, Blesl A, Haybaeck J, Golob-Schwarzl N, Ferreirós N, Thomas D, Gurke R, Trötzmüller M, Köfeler HC, Gallé B, Schicho R. Members of the endocannabinoid system are distinctly regulated in inflammatory bowel disease and colorectal cancer. Sci Rep. 2019 Feb 20;9(1):2358. doi: 10.1038/s41598-019-38865-4.
Mecha M, Torrao AS, Mestre L, Carrillo-Salinas FJ, Mechoulam R, Guaza C. Cannabidiol protects oligodendrocyte progenitor cells from inflammation-induced apoptosis by attenuating endoplasmic reticulum stress. Cell Death Dis. 2012 Jun 28;3(6):e331. doi: 10.1038/cddis.2012.71.
Iannotti FA, Di Marzo V, Petrosino S. Endocannabinoids and endocannabinoid-related mediators: Targets, metabolism and role in neurological disorders. Prog Lipid Res. 2016 Apr;62:107–28. doi: 10.1016/j.plipres.2016.02.002.
Marino S, Idris AI. Emerging therapeutic targets in cancer induced bone disease: A focus on the peripheral type 2 cannabinoid receptor. Pharmacol Res. 2017 May;119:391–403. doi: 10.1016/j.phrs.2017.02.023.
Bazwinsky-Wutschke I, Zipprich A, Dehghani F. Endocannabinoid System in Hepatic Glucose Metabolism, Fatty Liver Disease, and Cirrhosis. Int J Mol Sci. 2019 May 22;20(10):2516. doi: 10.3390/ijms20102516.
Hodges EL, Ashpole NM. Aging circadian rhythms and cannabinoids. Neurobiol Aging. 2019 Jul;79:110–118. doi: 10.1016/j.neurobiolaging.2019.03.008.
Mallick-Searle T, St Marie B. Cannabinoids in Pain Treatment: An Overview. Pain Manag Nurs. 2019 Apr;20(2):107–112. doi: 10.1016/j.pmn.2018.12.006.
Moreno E, Cavic M, Krivokuca A, Casadó V, Canela E. The Endocannabinoid System as a Target in Cancer Diseases: Are We There Yet? Front Pharmacol. 2019 Apr 5;10:339. doi: 10.3389/fphar.2019.00339.
Muller C, Morales P, Reggio PH. Cannabinoid Ligands Targeting TRP Channels. Front Mol Neurosci. 2019 Jan 15;11:487. doi: 10.3389/fnmol.2018.00487.
Ramer R, Schwarz R, Hinz B. Modulation of the Endocannabinoid System as a Potential Anticancer Strategy. Front Pharmacol. 2019 May 9;10:430. doi: 10.3389/fphar.2019.00430.
Loprinzi PD, Zou L, Li H. The Endocannabinoid System as a Potential Mechanism through which Exercise Influences Episodic Memory Function. Brain Sci. 2019 May 16;9(5):112. doi: 10.3390/brainsci9050112.
Montanari S, Mahmoud AM, Pruccoli L, Rabbito A, Naldi M, Petralla S, Moraleda I, Bartolini M, Monti B, Iriepa I, Belluti F, Gobbi S, Di Marzo V, Bisi A, Tarozzi A, Ligresti A, Rampa A. Discovery of novel benzofuran-based compounds with neuroprotective and immunomodulatory properties for Alzheimer's disease treatment. Eur J Med Chem. 2019 Sep 15;178:243–258. doi: 10.1016/j.ejmech.2019.05.080.
Wu J. Cannabis, cannabinoid receptors, and endocannabinoid system: yesterday, today, and tomorrow. Acta Pharmacol Sin. 2019 Mar;40(3):297–299. doi: 10.1038/s41401-019-0210-3.
Gowran A, McKayed K, Campbell VA. The cannabinoid receptor type 1 is essential for mesenchymal stem cell survival and differentiation: implications for bone health. Stem Cells Int. 2013;2013:796715. doi: 10.1155/2013/796715.
Yan W, Cao Y, Yang H, Han N, Zhu X, Fan Z, Du J, Zhang F. CB1 enhanced the osteo/dentinogenic differentiation ability of periodontal ligament stem cells via p38 MAPK and JNK in an inflammatory environment. Cell Prolif. 2019 Nov;52(6):e12691. doi: 10.1111/cpr.12691.
Rossi F, Bernardo ME, Bellini G, Luongo L, Conforti A, Manzo I, Guida F, Cristino L, Imperatore R, Petrosino S, Nobili B, Di Marzo V, Locatelli F, Maione S. The cannabinoid receptor type 2 as mediator of mesenchymal stromal cell immunosuppressive properties. PLoS One. 2013 Nov 27;8(11):e80022. doi: 10.1371/journal.pone.0080022.
Liu P, Liang H, Xia Q, Li P, Kong H, Lei P, Wang S, Tu Z. Resveratrol induces apoptosis of pancreatic cancers cells by inhibiting miR-21 regulation of BCL-2 expression. Clin Transl Oncol. 2013 Sep;15(9):741–6. doi: 10.1007/s12094-012-0999-4.
Cabral, G. A.; Marciano-Cabral, F. Cannabinoid receptors in microglia of the central nervous system: immune functional relevance. J Leukoc Biol. 2005 Dec;78(6):1192–7. doi: 10.1189/jlb.0405216.
Jiang S, Fu Y, Williams J, Wood J, Pandarinathan L, Avraham S, Makriyannis A, Avraham S, Avraham HK. Expression and function of cannabinoid receptors CB1 and CB2 and their cognate cannabinoid ligands in murine embryonic stem cells. PLoS One. 2007 Jul 25;2(7):e641. doi: 10.1371/journal.pone.0000641.
Chiurchiù V, Cencioni MT, Bisicchia E, De Bardi M, Gasperini C, Borsellino G, Centonze D, Battistini L, Maccarrone M. Distinct modulation of human myeloid and plasmacytoid dendritic cells by anandamide in multiple sclerosis. Ann Neurol. 2013 May;73(5):626–36. doi: 10.1002/ana.23875.
Kerkis I, Kerkis A, Dozortsev D, Stukart-Parsons GC, Gomes Massironi SM, Pereira LV, Caplan AI, Cerruti HF. Isolation and characterization of a population of immature dental pulp stem cells expressing OCT-4 and other embryonic stem cell markers. Cells Tissues Organs. 2006;184(3–4):105–16. doi: 10.1159/000099617.
Pierdomenico L, Bonsi L, Calvitti M, Rondelli D, Arpinati M, Chirumbolo G, Becchetti E, Marchionni C, Alviano F, Fossati V, Staffolani N, Franchina M, Grossi A, Bagnara GP. Multipotent mesenchymal stem cells with immunosuppressive activity can be easily isolated from dental pulp. Transplantation. 2005 Sep 27;80(6):836–42. doi: 10.1097/01.tp.0000173794.72151.88.
Yamaza T, Kentaro A, Chen C, Liu Y, Shi Y, Gronthos S, Wang S, Shi S. Immunomodulatory properties of stem cells from human exfoliated deciduous teeth. Stem Cell Res Ther. 2010 Mar 15;1(1):5. doi: 10.1186/scrt5.
Alipour R, Adib M, Masoumi Karimi M, Hashemi-Beni B, Sereshki N. Comparing the immunoregulatory effects of stem cells from human exfoliated deciduous teeth and bone marrow-derived mesenchymal stem cells. Iran J Allergy Asthma Immunol. 2013 Aug 28;12(4):331 – 44.
Omi M, Hata M, Nakamura N, Miyabe M, Kobayashi Y, Kamiya H, Nakamura J, Ozawa S, Tanaka Y, Takebe J, Matsubara T, Naruse K. Transplantation of dental pulp stem cells suppressed inflammation in sciatic nerves by promoting macrophage polarization towards anti-inflammation phenotypes and ameliorated diabetic polyneuropathy. J Diabetes Investig. 2016 Jul;7(4):485–96. doi: 10.1111/jdi.12452.
Chalisserry EP, Nam SY, Park SH, Anil S. Therapeutic potential of dental stem cells. J Tissue Eng. 2017 May 23;8:2041731417702531. doi: 10.1177/2041731417702531.
Hasweh N, Awidi A, Rajab L, Hiyasat A, Jafar H, Islam N, Hasan M, Abuarqoub D. Characterization of the biological effect of Biodentine™ on primary dental pulp stem cells. Indian J Dent Res. 2018 Nov-Dec;29(6):787–793. doi: 10.4103/ijdr.IJDR_28_18.
Hossein-Khannazer N, Hashemi SM, Namaki S, Ghanbarian H, Sattari M, Khojasteh A. Study of the immunomodulatory effects of osteogenic differentiated human dental pulp stem cells. Life Sci. 2019 Jan 1;216:111–118. doi: 10.1016/j.lfs.2018.11.040.
Kemter AM, Scheu S, Hüser N, Ruland C, Schumak B, Findeiß M, Cheng Z, Assfalg V, Arolt V, Zimmer A, Alferink J. The cannabinoid receptor 2 is involved in acute rejection of cardiac allografts. Life Sci. 2015 Oct 1;138:29–34. doi: 10.1016/j.lfs.2015.02.012.
Dotsey E, Ushach I, Pone E, Nakajima R, Jasinskas A, Argueta DA, Dillon A, DiPatrizio N, Davies H, Zlotnik A, Crompton PD, Felgner PL. Transient Cannabinoid Receptor 2 Blockade during Immunization Heightens Intensity and Breadth of Antigen-specific Antibody Responses in Young and Aged mice. Sci Rep. 2017 Feb 17;7:42584. doi: 10.1038/srep42584.
Opitz CA, Rimmerman N, Zhang Y, Mead LE, Yoder MC, Ingram DA, Walker JM, Rehman J. Production of the endocannabinoids anandamide and 2-arachidonoylglycerol by endothelial progenitor cells. FEBS Lett. 2007 Oct 16;581(25):4927–31. doi: 10.1016/j.febslet.2007.09.032.
Xie J, Xiao D, Xu Y, Zhao J, Jiang L, Hu X, Zhang Y, Yu L. Up-regulation of immunomodulatory effects of mouse bone-marrow derived mesenchymal stem cells by tetrahydrocannabinol pre-treatment involving cannabinoid receptor CB2. Oncotarget. 2016 Feb 9;7(6):6436–47. doi: 10.18632/oncotarget.7042.
Libro R, Diomede F, Scionti D, Piattelli A, Grassi G, Pollastro F, Bramanti P, Mazzon E, Trubiani O. Cannabidiol Modulates the Expression of Alzheimer's Disease-Related Genes in Mesenchymal Stem Cells. Int J Mol Sci. 2016 Dec 23;18(1):26. doi: 10.3390/ijms18010026.
Dominici M, Le Blanc K, Mueller I, Slaper-Cortenbach I, Marini F, Krause D, Deans R, Keating A, Prockop Dj, Horwitz E. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy. 2006;8(4):315–7. doi: 10.1080/14653240600855905.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Tumor necrosis factor α, agonist and antagonists of cannabinoid receptor type 1 and type 2 alter the immunephenotype of stem cells from human exfoliated deciduous teeth

Status:

Version 1

Abstract

Figures

1. Introduction

2. Material And Methods

2.1. ISOLATION OF SHED

2.2. MOLECULAR CHARACTERIZATION OF SHED

2.3. SHED OSTEOGENIC DIFFERENTIATION

2.4. CELL CULTURE AND ECS STIMULATION

2.5. CELL VIABILITY

2.6. FLOWCYTOMETRY ANALYSIS OF CELL MARKERS

2.7. STATISTICAL ANALYSIS

3. Results

3.1. ISOLATION,CHARACTERIZATION,ANDDIFFERENTIATIONOFSHED

3.2. HLA-DR EXPRESSION

3.3. PD-L1EXPRESSION

3.4. PD-L2 EXPRESSION

4. Discussion

5. Conclusion

Declarations

References

Additional Declarations

Status:

Version 1