This study was approved by the Institutional Human Ethics Committee of Fourth Hospital of Hebei Medical University, and prior informed consent was obtained from all the patients. The Ethics number is 2021KY047.
The procedures for care and use of animals were approved by the Ethics Committee of the Fourth Hospital of Hebei Medical University and all applicable institutional and governmental regulations concerning the ethical use of animals were followed.
I confirm that all human/animal experiment methods were performed in accordance with the relevant guidelines and regulations by including a statement in the methods section to this effect. And it follows the recommendations in the ARRIVE guidelines.
And the original source of method descriptions already be clearly acknowledged and cited.
Human ESCC tissue specimens
This analysis was performed using data obtained from 66 patients from Hebei, China. All patients were surgically treated at The Fourth Hospital of Hebei Medical University from January 1, 2014 to December 31, 2015. All specimens were obtained and pathologically confirmed to be ESCC. Surgical samples were obtained within 30 minutes post-operative and immediately stored in liquid nitrogen. The patients (52 males and 14 females) ranged in age from 50 to 87 years. The patient data (gender, age, occupation and family history) and tumor data (pathological type, TNM stage and surgical situation) were extracted from medical records. Follow-up was performed according to the standard follow-up system of the hospital every 6 months after patients were discharged from the hospital. The deadline for the follow-up was December 31, 2019. The survival period was measured from the date of admission to the date of death or to the date of the follow-up deadline.(24)
Immunohistochemical (IHC) assay
Paraffin sections (4 mm thick) were deparaffinized and rehydrated, followed by treatment with 0.02 M EDTA buffer (pH 9.0, Gene Tech, USA). Then, the sections were immersed in 3% H2O2 and blocked with 5% normal goat serum in proper sequence, followed by incubation with monoclonal anti-ZEB1 antibody (1:500; SIGMA, USA) overnight at 4°C. The antibody was diluted in PBS buffer containing 5% normal goat serum. The negative control for each slide was incubated with 5% normal goat serum without the anti-ZEB1 antibody. The sections were then incubated with HRP-conjugated anti-rabbit IgG (ZSGB-BIO, China) for 45 min at 37°C and revealed with diaminobenzidine tetrahydrochloride. The stained slides were scored by three pathologists who were unaware of the clinical diagnosis. The indexes of ZEB1 labeling were implemented so that samples were scored according to the percentage and intensity scores of positively stained tumor cells.(24)
Cell culture and transfection
The ESCC cell lines were obtained from China Infrastructure of Cell Line Resources. Cells were routinely cultured in RPMI 1640 supplemented with 10% FBS (Gibco, USA), 100 U/ml penicillin and 100 μg/ml streptomycin in the 37 °C incubator with 5% CO2.The KYSE150 cells were planted in plates about 16 hours before transfection. The plasmid of sh-XIST was synthesized by Genehem (Shanghai, China), and the sequence was listed following, 5’-TCTCTGTCATTGCTTCTGTAGTCACAGTC -3’. It was transfected into KYSE150 cells with lipofectamine 2000 (Invitrogen, CA, USA). The transfected cells were incubated for 4 to 6 hours, and normal medium was added.Lentivirus for knocking down of miR-34a was ordered from Genehem (Shanghai, China), and sequences cloned into the vectors were: 5’-TGCTGTTAGC TAATACTCAC AACAACGTTT TGGCCACTGA CTGACGTTGT TGTGTATTAG CTAA-3’.(25)
Quantitative real-time RT-PCR
Total RNA was extracted from tissue samples according to the instructions in the manual form iRNAVanaTM PARISTM (Ambion, TX, USA).MiRNA levels were analyzed using qRT-PCR with TaqMan, miRNA reverse transcription assays, and the appropriate primers according to the manufacturer's instructions. Briefly, 10 ng of total RNA was used as the template for 15 µl reverse transcription reactions. Probes were specially designed for specific mature miRNAs. For each miRNA, reactions were performed in triplicate using the 7500 RT-PCR system (Applied Biosystems), and RNU66 (Applied Biosystems, cat. no. 4373382) was used as the normalization control. (25)
The sequence of gene:
XIST, F: TGGCTCTTCTTTCACGCTTT, R: TGGTGTCGTGGAGTCG;
miR-34a, F: ACACTCCAGCTGTGACTGGTTGACCAGA3, R: TCAACTGGTGTCGTGGA, RT: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCCCCTCTG3;
U6, F: CTCGCTTCGGCAGCACA, R: AACGCTTCACGAATTTGCGT;
ZEB1, F: TTCGAGCCATCATTAAAATCAC, R: CTGGGTGGTTCAGACTCACA;
E-cadherin, F: TGCCCAGAAAATGAAAAAGG, R: GTGTATGTGGCAATGCGTTC;
GAPDH, F: CGCTGAGTACGTCGTGGAGTC, R: GCTGATGATCTTGAGGCTGTTGTC.
Western blotting analysis
Cells were lysed with ice-cold lysis buffer (Keygen Biotech, China) for 30 min on ice. Cell lysates were then collected after centrifugation at 12,000 rpm for 5 min at 4°C. Sixty micrograms of lysate protein was loaded, and the total cellular protein was separated by 12% SDS-PAGE and then transblotted overnight at 4°C onto PVDF membranes. The membranes were incubated with antibody (anti-ZEB1, 1:1,000, CST, USA; anti-E-cadherin, 1:2,000, CST, USA) at 4°C overnight, washed three times with TBST with 0.1% tween, and incubated with a horseradish peroxidase–linked secondary antibody (1:2,000) for 1 h at room temperature. The membranes were washed three times with TBST with 0.1% tween, and the immunoreactive bands were detected using an enhanced chemiluminescent plus reagent kit.(24)
Luciferase reporter assay
The predicted 3’UTR sequence of XIST and ZEB1, binding to miR-34a respectively, were cloned from the genomic DNA of esophageal cancer cells. Then, the sequence was inserted into the pmir-GLO control luciferase reporter vector. Luciferase reporter assays were carried out using the Dual-Glo luciferase assay system (Shanghai Genechem, China).(25)
Tumor cell inoculation
To study the effect of XIST in vivo, an esophageal cancer xenograft nude mouse model was successfully established. All animals were kept in a pathogen-free environment and fed ad lib. The procedures for care and use of animals were approved by the Ethics Committee of the Fourth Hospital of Hebei Medical University and all applicable institutional and governmental regulations concerning the ethical use of animals were followed. All mice were sacrificed by neck amputation.Twelve nude mice aged 6 weeks were divided into two groups for siXIST and control cells inoculation (6 mice in each group). A total of 5×106 siXIST and control cells in 0.2 ml of phosphate buffered saline (PBS) (Corning, Manassas, V.A., USA) were subcutaneously injected into the right flank of nude mice. The xenograft size in each group was measured at 5, 10, 15, 20, 25 and 30 days after inoculation using a microcaliper, and the tumor volume was calculated according to the following formula: volume =1/2 length×width2.(25)
Statistical analysis
Comparisons of the results with OS of patients were carried out using Kaplan–Meier log-rank testing.Data are displayed as mean ± standard deviation (SD) and analyzed by using SPSS 21.0 (SPSS Inc., Chicago, IL). P< 0.05 was considered to be statistically significant.
statement
Competing interests:The author(s) declare no competing interests. Non-financial competing interests.
All data generated or analysed during this study are included in this published article and it is supplementary information files.