Animals
240 male C57BL/6J male wild-type mice, aged 8-12 weeks, weighing 18-25 g, were purchased from Nanjing University-Nanjing Institute of Biomedical Research (Nanjing, China). The mice were housed in an SPF-class animal laboratory with room temperature 20-25 °C, suitable humidity, automatic feeding water, and day and night natural light. Mice were anesthetized by intraperitoneal injection with 1% sodium pentobarbital, and sacrificed by cervical dislocation. The feeding and disposal of experimental animals in this study was in accordance with ARVO's statement on the use of animals in ophthalmology and visual science research and was approved by the Medical Ethics Committee of the Henan Provincial Eye Hospital.
Primary culture and identification of uMSCs
The umbilical cords were taken from a healthy fetus delivered by a maternity cesarean section of the obstetrics department of Henan Provincial People's Hospital. It was treated within 1 hour after aseptic collection. Infectious diseases such as hepatitis B, hepatitis C, syphilis, AIDS, cytomegalovirus and Epstein-Barr virus are excluded by serological testing before maternal surgery. Written informed consent was obtained from the donors. Fresh umibilical cords were washed with 0.01M pH7.2~7.4 phosphate buffer saline (PBS) supplemented with antibiotics (100 U/ml of streptomycin, 100 U/ml of penicillin) twice to remove blood.. After treated with 70%ethanol, umbilical cords were then minced into small pieces and incubated with DMEM/F12 medium (1:1) (Hyclone Laboratories; Thermo Fisher Scientific Life Sciences, USA) supplemented with 10%fetal bovine serum(FBS; Hyclone Laboratories) in dishes at 37℃, 5%CO2 supplement. Cells were trypsinized and collected for subculture when they reached 80% confluence. Only uMSCs in passages 2-5 were used in our study. Cultured cells were fluorescence marked with specific mensenchymal stem cell surface antigen CD29, CD44, CD34 and CD45 (BD biosciences, New Jersey, US) and identified by flow cytometry.
FK model preparation
Mice were anesthetized by intraperitoneal injection with 1% sodium pentobarbital. The right eye of each mouse was selected as the experimental eye. The preparation of the model refers to the article published by our research group [6]. Under the operating microscope (Topcon OMS-90, Japanese), a cross scratch in the center of the cornea was made by using a sterile blade (carbon steel, size 11, Shanghai Medical Suture Needle Factory Co., Ltd., China). The scratch depth was to exceed Bowman’s membrane and stop at the corneal stroma superficial layers. A sterile bamboo stick tip (tip diameter 0.30mm, length 1.10mm) was used to pick up a small amount of hyphae, and then apply evenly to the scratches. 24h after injury, antifungal drug natamycin eye drops were used topically to FK mice eyes 6 times per day for 7 days to inhibit fungi growth. The experimental fungus standard strain Fusarium oxysporum (No. 3.791) was purchased from the General Microbiology Center of the China Microbial Culture Collection Management Committee, Institute of Microbiology, Chinese Academy of Sciences, Beijing. After 24 hours of modeling, observation under the slit-lamp microscope showed that the corneal fungal infection and a small amount of empyema in the anterior chamber formed were successfully modeled. Cases of uninfected were removed, and the number of deletions was substituted by subsequent experiments.
Experimental grouping
The mice were randomly divided into four groups, including control group, FK group, vehicleinj FK group and uMSCsinj FK group. Control group referred to unwounded ones, whereas FK group referred to wounded ones without any injection but antifungal drug therapy, meanwhile vehicleinj FK group referred to wounded ones with PBS subconjunctival injection and antifungal drug therapy, finally uMSCsinj FK group referred to wounded ones with uMSCs subconjunctival injection and antifungal drug therapy.
Topical administration of uMSCs
Mice in the uMSCsinj FK group were anesthetized by intraperitoneal injection of pentobarbital sodium. Under the operating microscope, the Hamilton micro-syringe (Hamilton, Switzerland) with a 30G needle on it was used to carefully insert into the conjunctiva sac and slowly injected 5×104 uMSCs in 5μl PBS. The operation was performed for 3 times at the 1d, 4d and 7d after modeling. Others in vehicleinj FK group received a subconjunctive injection of 5μl PBS at the same time points using the same method. However, control group and FK group received no injection at all.
Observation and examination
The mice were observed under a slit lamp microscope every other day, and the ocular surface photographs were taken and corneal opacity scores were graded at 14d, 21d, and 28d after modeling. The score was performed by another investigator blinded to the group to minimize the bias. The scoring criteria are as follows: grade 1 (mild corneal haze, pupil iris clearly visible), grade 2 (superficial corneal opacity, visible pupil and iris through the lesion), grade 3 (uneven full-thickness corneal opacity), grade 4 (homogeneous and dense opacity).The area of corneal leukoplakia (mm2) was calculated by using the EyeStudio software.
Pathlogical examination and hematoxylin-eosin (HE) staining
For the purpose of histological analysis, mice were sacrificed by cervical dislocation and eyeballs were dissected at 14d, 21d and 28d after modeling. After a fixation in 4% paraformaldehyde for 24 hours, the tissues were dehydrated, dipped in wax, embedded, and sliced in sequence. The slices were under a routine operation of dewaxing and then HE staining was used for pathological examination. Photos were taken by Nikon 80i light microscope (Nikon, Sendai, Japan) and analyzed in terms of corneal thickness.
Whole mount corneal immunofluoresence staining
The mice were sacrificed by cervical dislocation at 14d post-injury. The intact eyeballs were removed and then fixed in 4%paraformaldehyde for 90min at 4℃. Trim the eyeball, retain the cornea and limbus, and remove the iris, ciliary body and other tissues. Corneas were washed with 0.01 M PBS for 5 times (3 min each), and then dipped in 0.2%Triton-2%BSA 1:100 diluted anti-alpha smooth muscle actin antibody (ab5694, Abcam, Cambridge, US) overnight at 4℃. After conjugated with 1:500 diluted fluorescence-conjugated secondary antibody Alexa488 (A10042, eBioscience, US) in PBS overnight at 4℃, the corneas were then flatmounted with four radial cut, and sealed with mounting medium. Images were captured by tissue panoramic scanning microscopy (Pannoramic 250/MIDI, 3D HISTECH, Hungary).
Second harmonic generation (SHG)
At 14d, 21d and 28d post-injury, mice were deeply anesthetized and fixed on a designated plate, with the ocular surface faced up. According to a previously described method[7], a modified plastic bowl containing sterile PBS was fixed on the ocular surface sealed by erythromycin eye ointment to ensure the use of water immersion objective. SHG imaging was performed using an inverted two-photon excitation fluorescence microscope (NLO780, Zeiss). The laser was tuned to 780 nm and a 20× water immersion objective (numerical aperture =1.0) was used to focus the excitation beam and to collect backward signals. The cornea was scanned layer by layer using Z-stack (Z=5 μm), and the obtained images were three-dimensionally reconstructed using Imaris software (×64, version 7.4.2, Bitplane, Zurich, Switzerland) to calculate the average signal intensity of the image. The stronger the image signal intensity, the more regular the corneal matrix collagen fibers are arranged, and conversely, the weaker the image signal, the corneal matrix collagen fiber structure is disordered or degraded.
Quantitative real-time PCR
The mice were sacrificed by cervical dislocation at 14d, 21d and 28d post-injury and the corneas were trimmed as described above. Corneas were cut into small pieces and grinded for RNA extraction. RNeasy Mini Kit (Qiagen, US) was used to extract total RNA according to the manual and cDNA was generated by reverse transcription (TIANScript RT Kit, TRANSGEN BIOTECH, Peking, China). Real-time amplification was performed using TransStart Top Green qPCR Supermix (AQ131, TRANSGEN BIOTECH, Peking, China) in ABI 7500 Real Time PCR System (Applied Biosystems/Life Technologies) for the following molecules: α-smooth muscle actin (α-SMA), forward sequencing: TCAGACCTGTGTGTTCCCTA, reverse sequencing: AGACGTGCTTCTTTTCCTTG, transforming growth factorβ1 (TGFβ1), forward sequencing: AAGCCCGAGGACCACATTTT, reverse sequencing: GGGGCCTTTGGCTCAGAAAT, connective tissue growth factor (CTGF), forward sequencing: CATCTCCACCCGAGTTACCA, reverse sequencing: TGCACTTTTTGCCCTTCTTA, collagen type Ⅰ(COLⅠ), forward sequencing: TCAGACCTGTGTGTTCCCTA, reverse sequencing: AGACGTGCTTCTTTTCCTTG, and housekeeping gene β-actin, forward sequencing: GGCACCACACCTTCTAC, reverse sequencing: CTGGGTCATCTTTTCAC. Gene expression was standardized to housekeeping gene expression in respective samples. Each individual experiment was done in triplicate.
Western blot assay
The mice were sacrificed by cervical dislocation at 14d post-injury and the corneas were trimmed as described above. 0.1g tissue was fully grinded in liquid nitrogen, and then transferred to 1ml RIPA protein lysate. Determination of sample protein concentration was by Coomassie Brilliant Blue Kit. Protein separation was performed by electrophoresis in different concentrations of gels. Polyvinylidene fluoride membranes (Bio-Rad Laboratories, Hercules, CA, USA) were used to transfer the samples. The membranes were blocked with a blocking solution (PBST solution containing 5% skim milk powder) for 2 hours at room temperature and then incubated in a 1:1000 dilution of primary rabbit polyclonal anti-Smad2 antibody (bs-0718R, Bioss Antibodies, Peking, China) and primary rabbit polyclonal anti-phospho-Smad2 antibody (bs-5618R, Bioss Antibodies, Peking, China) at 4℃ overnight. The membranes were then washed in TBST (10 mM Tris-HCl [pH 7.5], 150 mM NaCl, and 0.05% Tween-20) for 3 times (5min each), and then incubated in a 1:3000 dilution of goat-anti-rabbit secondary antibody (bs-0295G, Bioss Antibodies, Peking, China) for 1h at room temperature. The membrane was incubated with the chemiluminescent substrate for 2-5 min and photographed. Images were saved and digitized the gray value of each specific strip. The obtained result represented the relative content of the target protein of a sample.
Statistical analysis
Data analysis was performed using SPSS 17.0 statistical software. The data is expressed in the form of mean ± S.D. The data obtained were multiple sets of quantitative data and analyzed by one-way analysis of variance. Firstly, the Levene test is used to test the homogeneity of variance of each group of data at each time point. The LSD-t test or the Bonferroni method was used to compare the multiples of multiple samples. The Kruskal-Wallis rank sum test is used for analysis of corneal turbidity score. P< 0.05 was statistically significant.