Experiments were conducted with two human iPSC lines. iPSC were generated from commercially available human fibroblasts originating from a female and a male patient (referred to from now as iPSC#1 and iPSC#2 respectively; Lonza CC-2511, lot 0000490824 [iPSC#1], and lot 0000545147 [iPSC#2]). Reprogramming was performed according to Okita et al. 70. iPSC characterization was described in Stauske et al. 71. Human iPSC were maintained at 37°C, 5% CO2 in Universal primate pluripotent stem cell medium (UPPS medium), and cell splitting was performed using Versene solution (Thermo Fisher Scientific; #15040066) according to Stauske et al. 71. iPSC were cultured on Geltrex-coated 6 cm or 12- well dishes (Thermo Fisher; A1413202). For all molecular analysis described below, cells (both iPSC and iPSC-derived neurons) were washed twice in Phosphate buffered saline (PBS) before being scraped (Cell scraper, Sarstedt; #833945040) and collected in an 1,5 ml Eppendorf tube. Cell suspensions were centrifuged at 12.000 x g for 2 min. PBS was removed and cell pellets snap-frozen in liquid nitrogen. Samples were stored at -80°C until further analysis.
Establishment and characterization of transgenic lines
The KO lines were generated according to Rodríguez-Polo et al. [56], following a constitutive Cas9-gRNA expression strategy. In brief, cells were nucleofected with a piggyBac-CRISPR-Cas9-GFP vector carrying a guide RNA (gRNA) specifically targeting CRLF3 (see Table 1) and a second vector carrying Transposase-dtTomato, (Pac-PB-Tomato) [57]. In parallel, a different subset of cells was transfected with an empty piggyBac-CRISPR-Cas9 (no gRNA) construct in order to generate isogenic control (Ig-Ctrl) lines. After transfection the GFP positive (Cas9-GFP-gRNA positive) population was sorted by Fluorescence assisted cell sorting (FACS; Sony Flow Cytometry FACS SH800S). The presence of INDEL mutations in the polyclonal population was evaluated using PCR (Primer sequences see Table 1) in combination with T7 endonuclease I assay and Sanger sequencing. For the generation of the CRLF3 KO monoclonal lines, polyclonal populations were single-cell sorted into a 96-well plate, expanded and genotyped. Presence of the transgene was evaluated by GFP expression using a Zeiss Observer Fluorescent microscope (Carl Zeiss, #4001584). Successful introduction of loss-of-function mutations was evaluated in the monoclonal lines amplifying the targeted locus by PCR, subcloning the product in pCRII vector (TA cloning kit; Thermo Fisher Scientific # K207020), transforming the vector into competent E.coli, and sequencing by Sanger (20 bacterial clones per cell line analysed). Subsequent sequence analysis revealed allele-specific variations in each one of the iPSC clones. Additionally, protein depletion from mutated iPSC and iPSC-neurons was confirmed by Western blot (see below).
Genomic DNA extraction and PCR
Genomic DNA (gDNA) was extracted using DNeasy Blood & Tissue Kit (Qiagen; #69504) according to the manufacturer's instructions. The gRNA target site was amplified using specific primers as stated below (Table 1). PCR was run using GoTaq Green Master Mix (Promega; #M7122) and PCR program was set as shown in Table 2. PCR products were loaded on a 1% agarose gel and run for 30 min at 100 V before extracting DNA fragments using Macherey–Nagel NucleoSpin Gel and PCR Clean-up Kit (Macherey–Nagel; #740609.50). The isolated DNA fragments were subsequently either sent for sequencing using specific PCR primers (for Polyclonal approach; Sequencing facility Microsynth AG, Göttingen, Germany) or cloned into a pCRII vector for allele characterization (for clonal expansion).
Table 1: Oligonucleotides
Application
|
Gene
|
Oligonucleotide 5'-3'
|
Tm
|
Accession number
|
gRNA
|
CRLF3- fwd
|
CACCGAAAGGCCTCGCACATTCAGT
|
|
ENSP00000318804.6
|
gRNA
|
CRLF3- rev
|
AAACACTGAATGTGCGAGGCCTTTC
|
|
PCR
|
CRLF3- fwd
|
CCCTGGGCTTTCTGCTTTGC
|
61°C
|
PCR
|
CRLF3- rev
|
ACCACGCATGGTCTGAAAACC
|
|
qPCR
|
CRLF3 fwd
|
CAACGTTGGGGTCTATGTGC
|
61°C
|
qPCR
|
CRLF3 rev
|
CGCCCACCAGTACAGATAGA
|
|
qPCR
|
Bax- fwd
|
CGAGTGGCAGCTGACATGTT
|
61°C
|
ENST00000293288.12
|
qPCR
|
Bax- rev
|
TCCAGCCCATGATGGTTCTG
|
|
qPCR
|
Caspase 3- fwd
|
GGAGGCCGACTTCTTGTATG
|
61°C
|
ENST00000308394.9
|
qPCR
|
Caspase 3- rev
|
TGCCACCTTTCGGTTAACCC
|
|
qPCR
|
BCL-2- fwd
|
CGTTATCCTGGATCCAGGTG
|
61°C
|
ENST00000398117.1
|
qPCR
|
BCL-2- rev
|
GTGTGTGGAGAGCGTCAAC
|
|
qPCR
|
bActin- fwd
|
GCGAGAAGATGACCCAGATC
|
61°C
|
ENST00000674681.1
|
qPCR
|
bActin- rev
|
GGGCATACCCCTCGTAGATG
|
|
Table 2: PCR program for CRLF3 amplification
Step
|
Temperature [°C]
|
Time [sec]
|
Cycle
|
Initial denaturation
|
95
|
180
|
|
Denaturation
|
95
|
30
|
x30
|
Annealing
|
61
|
30
|
Elongation
|
72
|
30
|
Final elongation
|
72
|
300
|
|
Transformation
pCRII vectors carrying PCR products of single-cell clones were transformed into XL1-blue competent cells (Agilent; #200249). 500 ng plasmid were carefully mixed with 100 µl of competent cells and let to rest on ice for 30 min. Subsequently, cells received a heat shock at 42°C for 40 sec before 900 µl super optimal broth (SOB) (Roth; #AE27.1) without antibiotics was added. Cell suspension was transferred into a bacterial incubator for 1 h at 37°C, 225 rpm. Afterwards, cell suspension was centrifuged at 3000 x g for 2 min, supernatant was removed, and cells were resuspended in 100 ml SOB medium before being dispersed on LB agar plates + ampicillin (Sigma-Aldrich; #L2897). Plates were let to rest at room temperature (RT) for 10 min before being transferred to 37°C.
Western blot
Cell pellets were lysed in protein lysis buffer (150mM NaCL; 20mM Tris.HCl pH 7.5; 1mM EDTA; 1% Triton-X-100) + Protease inhibitor (Thermo Fisher Scientific; #78429) by vigorous shaking in a tissue lyser (Qiagen; #85300) for 3 min at 50 Hz. Subsequently, the lysates were transferred onto ice and incubated for 30 min. Cell lysate was centrifuged at 10.000 x g for 10 min at 4°C and the protein containing supernatant was transferred to a fresh Eppendorf tube. Protein concentration was measured by Bradford assay (PanReac AppliChem; #A6932,0500). For all Western blots run in this study 50 µg protein was denatured in 2X Lämmli buffer (Sigma-Aldrich; #S3401) at 95°C for 5 min. 10% SDS-Pages were run for 30 min at 70 V and 1 h at 120 V. For size reference, PageRuler Plus Prestained Protein ladder (Thermo Fisher Scientific; #26619) was loaded together with samples. The separated protein was transferred onto nitrocellulose membranes (Roth; #9200.1) in a wet blot approach for 1,5 h at 180 mA. Membranes were incubated in Ponceau S (Sigma-Aldrich; #P3504) in order to check for sufficient and successful protein transfer before being blocked in 5% Milk/ PBS-0,1% Tween-20 (PBST) for 30 min at room temperature (Milk Roth; #T145; Tween-20 PanReac AppliChem; #A7564). Membranes were probed for CRLF3 (see antibody list for dilutions in table 3) either at RT for 2 h or overnight at 4°C. Subsequently, membranes were washed 3 times in PBST before incubation in α-HRP solution for 30 min at RT. Membranes were imaged by incubation in Pierce ECL Western blotting substrate (Thermo Fisher Scientific; #32209) using iBright CL1500 Imaging System (Thermo Fisher Scientific; #A44114). Subsequently, membranes were stripped in 0,5 M NaOH for 3 min, washed 3 times in PBS before being blocked again. Membranes were incubated in αTubulin (see table 3) for 1 h at RT before incubation with the secondary α-HRP antibody and imaging. Quantification of protein band intensities was performed using ImageJ. Band intensities were normalized to the corresponding αTubulin band intensity of each sample and then towards control samples within treatment groups. Data is shown as bar plots representing the average band intensities measured together with the calculated standard deviation and single data points.
Transgenic iPSC characterization
To confirm pluripotency of the newly generated transgenic lines (namely CRLF3 KO and corresponding Ig Ctrl of iPSC#1 and #2) we stained for pluripotency markers NANOG and OCT4A (see antibody list in table 3). iPSC were grown on 2 cm glass coverslips (Menzel-Gläser, #CB00200RA1) and fixed when confluent in 4% Paraformaldehyde (PFA) for 30 min. Coverslips were subsequently washed 3x in PBS before being blocked in 0,5 % bovine serum albumin (BSA; Thermo Fisher Scientific, #15260037) either for 30 min at RT or longer at 4°C. Cells were washed again 3 times in PBS and subsequently incubated with primary antibody according to table 3 at 4°C overnight. Coverslips were washed 3 times in PBS before incubation with the corresponding secondary antibody (table 3) at 37°C for 1 h. Cells were washed three times in PBS and once in water before mounting in Fluoromount-G (Thermo Fisher Scientific, #00-4958-02). Images were taken with a Zeiss Observer Fluorescent microscope.
To show that differentiation capacities of transgenic lines remain intact after transgenesis we performed spontaneous differentiation assays, by embryoid body formation (EB), according to Rodriguez-Polo et al., [52]. In brief, iPSC colonies were detached with 200 U/ml Collagenase Type IV for 10 min at 37°C, scraped off and transferred to uncoated bacterial dishes. EBs were maintained in Iscoves medium (Thermo Fisher Scientific, # 12440053) at 37°C and the medium changed every second day.
After 8 days EB were transferred onto Geltrex-coated 6-well plates equipped with 2 cm coverslips for spontaneous differentiation and further maintained in Iscove’s Medium. Cells were fixed between day 18 and 20. Stainings were performed as described above. Spontaneously differentiated cells were stained for Smooth muscle actin (SMA) and α-Fetoprotein according to table 3.
Table 3: Antibodies used
Antibody
|
Company
|
Host
|
Dilution
|
Application
|
CRLF3
|
Santa Cruz; #sc-398388
|
mouse
|
1:500
|
IF / Western blot
|
αTubulin
|
Sigma-Aldrich; T9026
|
mouse
|
1:5000
|
Western blot
|
Nanog
|
Cell Signaling, #D73G4
|
rabbit
|
1:400
|
IF
|
OCT4A
|
Cell Signaling, #C53G3
|
rabbit
|
1:1600
|
IF
|
SMA
|
Sigma-Aldrich, #A2547
|
mouse
|
1:100
|
IF
|
αFetoprotein
|
Dako, #A0008
|
rabbit
|
1:100
|
IF
|
Neurofilament 200
|
Sigma-Aldrich; #N4142
|
rabbit
|
1:400
|
IF
|
ß-III-tubulin/AF 594
|
Santa Cruz; #sc-80005 AF594
|
mouse
|
1:50
|
IF / FACS
|
Phantom dye red 780
|
Proteintech; #PD00002
|
/
|
1:1000
|
FACS
|
Alexa Fluor 555
|
Thermo Fisher; #A32727
|
mouse
|
1:1000
|
IF
|
Alexa Fluor 594
|
Thermo Fisher; #A32732
|
rabbit
|
1:1000
|
IF
|
Alexa Fluor 633
|
Thermo Fisher; #A21070
|
rabbit
|
1:1000
|
IF
|
HRP
|
Sigma-Aldrich; #A4416
|
mouse
|
1:10000
|
Western blot
|
Neuronal differentiation and survival-assay establishment
iPSC were differentiated as described previously [58] with slight modifications of the original protocol. iPSC were split on 12-well plates and maintained in UPPS until reaching confluency of 60-80%. Medium was changed every 2nd to 3rd day. For the first 7 days of differentiation, cells were maintained in induction medium consisting of DMEM/F12 (Thermo Fisher Scientific; #11320033), 10% Knock out serum (KOS; Thermo Fisher Scientific; # 10828028), 1% Non-essential amino acids (NEAA, Thermo Fisher Scientific;# 11140050), 200 µM L-Ascorbic Acid (L-AA, Sigma-Aldrich; # A92902-100G), 2 µM SB431542 (Peprotech; # 3014193), 3 µM Chir99021 (Sigma-Aldrich, # SML1046) and 1,5 µM dorsomorphin (Peprotech, # 8666430). Cells were split onto fresh Geltrex-coated plates on day 6. Neuron splitting was performed following incubation in 0,25% Trypsin/EDTA (Thermo Fisher Scientific; # 25200056) for 3 min at 37°C. Cells were scraped and carefully resuspended before collection in a 5 ml falcon containing 5 ml DMEM/FBS. Cell suspension was centrifuged for 5 min at 200 x g. The supernatant was discarded, cells were resuspended in Induction medium + 0,001 % ß-mercaptoethanol (Thermo Fisher Scientific; #21985023) and seeded onto 6-well plates. Medium was changed the next day to neuralization medium containing DMEM/F12, 200 µM L-AA, 1% NEAA, 1X N2 supplement (Thermo Fisher Scientific; # 17502048), 1X B27 supplement (Thermo Fisher Scientific; #17504044), 10 ng/ml bFGF (Peprotech; #100-18B) and 10 ng/ml EGF (Peprotech; #AF-100-15). Cells were fed with neuralization medium for one week before switching to neuronal differentiation medium I, consisting of DMEM/F12, 200 µM L-AA, 1% NEAA, 1X N2 supplement, 1X B27 supplement, 300 ng/ml cAMP (Peprotech; #6099240). For the final 7 days of neural differentiation, cells were maintained in neural differentiation medium II containing DMEM/F12, 200 µM L-AA, 1% NEAA, 1X N2 supplement, 1X B27 supplement, 300 ng/ml cAMP, 10 ng/ml BDNF (Peprotech; #450-02) and 10 ng/ml NT-3 (Peprotech; #AF450-03). During the differentiation process, cells were split once on Poly-L-Lysin/ Laminin-coated plates when reaching 100% confluency. For each experiment 4 6-well plates were first coated in 1 µg/ml Poly-L-Lysin (Sigma-Aldrich; #P5899) for 30 min at 37°C. Subsequently, plates were washed 3x with PBS before being coated with 2 µg/ml Laminin (Sigma-Aldrich; #11243217001) for at least 8 h at RT in the dark. Before cells were seeded, plates were washed twice in PBS. Cell splitting was performed as described above. Differentiations were regularly monitored for differentiation progress using an inverted light microscope (Carl Zeiss; #4001648). A graphical overview of the differentiation process is presented in Extended data figure 1. Characterization of the emerging iPSC-derived neurons was performed by immunofluorescent stainings for ß-III-tubulin, Neurofilament and CRLF3 as described above (table 3).
Establishment of survival assay
Different concentrations of rotenone as a pro-apoptotic stressor and EV-3 as an anti-apoptotic protectant were tested. For final experiments rotenone (Sigma-Aldrich; #R8875; dissolved in DMSO at stock concentration of 1,3 M) concentrations of 800 nM (for iPSC#1) and 1 µM (for iPSC#2) were applied for 18 h after treating cells with either 41,5 ng/ml (iPSC#1) or 33,3 ng/ml (iPSC#2) EV-3 (IBA GmbH, Göttingen, Germany) for 12 h. For each experiment one well of differentiations were treated with 0,006% DMSO as rotenone solvent control. After treatment periods, iPSC-derived neurons were prepared for FACS analysis as stated below.
FACS sample preparation and analysis
To collect samples for FACS analysis cell cultures were incubated in 0,25% Trypsin/EDTA for 3 min at 37°C before stopping the reaction with DMEM/FBS. Cells were scraped and resuspended by gentle pipetting before being transferred to falcon tubes. 2 ml DMEM/FBS were added and samples were centrifuged at 800 x g for 5 min. Samples were subsequently washed twice in PBS, with centrifugation steps between washing steps. In order to have samples for all treatment groups and to set FACS gates, only a subset of the cells were stained for further analysis. Table 4 shows the different treatment conditions and staining procedures employed for this protocol. Samples designated for live/dead analysis were stained in Phantom dye Red 780 (Proteintech; #PD00002) for 30 min at 4°C according to the antibody list in table 3. Samples were subsequently diluted with 2 ml PBS + 0,1 % FBS and centrifuged at 800 x g for 5 min. Samples were washed one more time in PBS/FBS before being blocked alongside with unstained samples for at least 1 h at 4°C in PBS/0,5% BSA. 2 ml PBS were added and samples were centrifuged before a second PBS washing step. Subsequently, samples stained for ß-III-tubulin as neuronal marker were incubated with antibody according to table 3 overnight at 4°C. Samples that did not receive staining solution remained in blocking buffer. The next day 2 ml PBS were added to all falcons and the samples were centrifuged. After a second PBS washing step, cells were resuspended in FACS buffer (Containing PBS + 0,5% BSA + 2 mM EDTA) and strained through a 40 µm cell strainer (Sarstedt; #833945040) into FACS tubes (Fisher Scientific; #10579511). Samples were kept on ice until analysis with Sony cell sorter SH800S.
Table 4: FACS samples prepared for survival assays
Treatment
|
FACS sample
|
Control
|
Neg. control
|
Phantom dye
|
ß-III-tubulin
|
ß-III/Phantom dye
|
Rotenone
|
Phantom dye
|
ß-III/Phantom dye
|
EV-3 + rotenone
|
ß-III/Phantom dye
|
FACS gates were set according to the forward and sideward scatter measured in the main gate for single-cell analysis. Gates for the selection of ß-III-tubulin-positive cells were set according to the unstained control samples. Phantom dye gates for live and dead cells were set according to the unstressed population. For all samples 100.000 cells were measured. Only ß-III-tubulin positive cells (i.e., neuron-like cells) were analysed for their survival according to Phantom dye staining.
FACS data is presented as boxplots showing the median cell survival, upper and lower quartile and whiskers representing 1,5 x interquartile ranges. Single data points are shown as circles within the boxplot. Cell survival data was normalized to the corresponding untreated control, which was set to 1.
Gene expression studies
RNA isolation and cDNA synthesis
For each treatment group in the survival assays cells from two wells of a 6-well plate were pelleted for further molecular analysis. RNA was isolated by means of Trizole/Chloroform protocol as described previously (Knorr et al., 2020). In brief, 1 ml Trizole (Thermo Fisher Scientific; #15596026) was added to each cell pellet and cells were disrupted in a tissue lyser. 200 µl Chloroform (Labsolute; #2475) was added and the samples were shaken vigorously for 20 sec in tissue lyser. Samples were incubated on ice for 15 min before centrifugation at 12.000 x g for 15 min at 4°C. The top translucent phase of each sample was transferred to a fresh Eppendorf cup and mixed with 1 ml ice-cold 75% EtOH. Samples were incubated at -20°C for at least 1 h before centrifugation at 10.000 x g for 15 min at 4°C. The resulting RNA pellet was washed three times in ice-cold EtOH before pellets were dried and resuspended in 30 µl ddH2O. RNA concentrations were measured by Nanodrop (Thermo Fisher Scientific).
cDNA was synthesised using the LunaScript RT SuperMixKit (New England BioLabs; #E3010) according to the manufactures instructions. For all samples 1 µg RNA was reverse transcribed.
qPCR
qPCR analyses of transcripts from BAX, Caspase 3, BCL-2 and CRLF3 were run using specific primers (see oligonucleotide list Table 1). The housekeeping gene (HKG) b-Actin was used as reference. All primers were analysed for their efficiencies previously. All samples were loaded in triplicates and (-) RT controls and water were run as negative controls on each plate. qPCRs reactions were prepared with final concentrations of 5 µl Luna® Universal qRT-PCR Master Mix (New England Bio- Lab; #M3003), 0,1 mM forward and reverse primers and 10 ng cDNA. qPCRs were pipetted in a 96-well clear well plates (StarLab; #E1403-5200) and run using a Bio-Rad CFX Connect Real-Time system (Bio-Rad; #1855201). The following qPCR program was employed for specific gene amplification (see table 5).
Table 5: qPCR program used for this study
|
Step
|
Temperature [°C]
|
Time [s]
|
|
|
Initial denaturation
|
95
|
180
|
|
PCR reaction
|
Denaturation
|
95
|
10
|
x40
|
Annealing
|
61
|
30
|
Elongation
|
72
|
30
|
Melting curve
|
Denaturation
|
95
|
60
|
|
Annealing
|
55
|
60
|
|
Melting curve
|
55
|
10
|
0.5 °C per cycle up to 95 °C
|
Ct values were analysed using the Pfaffl method [59] and data was normalized to the corresponding HKG value of each sample and further to the corresponding gene of interest (GOI) control value. Relative gene expression data is represented as Bar plots showing the geometric mean and standard deviations.
CRLF3 immunostaining of iPSC-derived neurons
iPSC-derived neurons were grown on glass coverslips and fixed on day 30 of differentiation. Cell staining was performed as described above using primary antibodies for Neurofilament 200 and CRLF3 (See antibody list table 3) and Dapi (1:1000 in H2O; Sigma Aldrich; #D9564) as nuclear marker. Images were taken using Leica SP8 confocal microscope (Leica Microsystems). Images were further processed using ImageJ.
Quantification and statistical analysis
Statistical analyses of all experiments conducted in this study was performed using R Studio [60, 61] and pairwise permutation test (two-tailed) within the packages coin and rcompanion [62, 63]. In order to avoid false-positive results due to multiple comparisons, Benjamini Hochberg correction was included in all statistical calculations. Significant differences are shown by differing letters (e.g. a is significantly different to b but not to ab). All data presented was collected from independent experiments. Only experiments with a minimum of 5 % survival loss in rotenone treated cultures were included into final analysis. Exact n values (defined as number of individually measured experiments) for each experiment can be found in the figure legends.