Materials
Sorghum (Sorghum bicolor L., Miryang 22ho) harvested in 2020 was provided by the National Institute of Crop Science (Rural Development Administration, Miryang, Korea). 3T3-L1 preadipocytes were purchased from the Korean Cell Line Bank (Seoul, Korea). Dulbecco's modified Eagle’s medium (DMEM) and phosphate-buffered saline (PBS) were purchased from Welgene Inc. (Seoul, Korea). Fetal bovine serum (FBS) was purchased from AB Frontier Co. (Seoul, Korea). Penicillin/streptomycin (PS) and bovine calf serum (BCS) were purchased from Gibco (Carlsbad, CA, USA). 3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide (MTT), 2,2-diphenyl-1-picrylhydrazyl (DPPH), 2,4,6-Tirs(2-pyridyl)-s-triazine (TPTZ), 3-isobutyl-1methylxanthine (IBMX), dexamethasone (DEX), insulin, and all other analytical solvents were purchased from Sigma-Aldrich Co. (St. Louis, MO, USA).
Sample preparation
The sorghum grains were extracted using three solvent systems: 50% (SE50), 80% (SE80), and 100% (SE100) ethanol. Sorghum was ground into a fine powder using a blender. Sorghum powder (100 g) and 50, 80, and 100% ethanol (1 L) were mixed and stirred overnight at room temperature (20 to 25°C) and filtered through filter paper (Whatman No. 1, Whatman, Maidstone, England). The filtered solution was concentrated using a rotary evaporator (Eyela, Tokyo, Japan) at 50°C. SE, obtained by lyophilization, was dissolved in DMSO to a concentration of 250 mg/mL. The samples were stored at -20°C until further analysis.
Quantification of phenolic compound
Measurement of total polyphenol content (TPC)
Quantification of TPC within SE was determined using Folin–Ciocalteu’s reagent as previously reported with some modifications [14]. Briefly, 500 µL of 10% 2 N Folin–Ciocalteu reagent was added to 200 µL of SE and allowed to react for 5 min. Then, 500 µL of 7.5% Na2CO3 was added and allowed to react at 50°C for 10 min; the absorbance was measured at 760 nm using a microplate reader (Bio Tek, Winooski, VT, USA). The TPC was expressed as mg gallic acid equivalent per 1 g SE (mg GAE/g) using a standard curve of gallic acid.
Measurement of total flavonoid content (TFC)
The TFC was estimated using an AlCl3 reagent according to a previously reported study [15]. SE (100 µL) was added to 400 µL of distilled water, and 30 µL of 5% NaNO2 and 30 µL of 10% AlCl3 were mixed. After 5 min, 200 µL of 1 M NaOH was added, and the total volume was made up to 1 mL using distilled water. Absorbance was measured at 415 nm using a microplate reader (Bio Tek). The TFC was expressed as mg quercetin equivalent per 1 g SE (mg QE/g) using a standard curve of quercetin.
Measurement of total tannin content (TTC)
The TTC was determined as previously reported with some modifications [16]. The reaction mixture was mixed with 1,000 µL of SE, 1,000 µL of 95% ethanol, and 1,000 µL of distilled water. Then, 1,000 µL of 5% Na2CO3 and 500 µL of 1 N Folin–Ciocalteu reagent were added. After incubation at room temperature for 60 min, the absorbance was measured at 725 nm using a microplate reader (Bio Tek). TTC was expressed as mg tannic acid equivalent per 1 g SE (mg TAE/g) using a standard curve of tannic acid.
Antioxidant capacity
2,2-Diphenyl-1-picrylhydrazyl (DPPH) radical scavenging assay
The radical scavenging activity of SE was assessed using DPPH free radicals, and Trolox was used as a positive control. A 20 µL sample and blank were plated with 180 µL of 0.4 mM DPPH solution in a 96-well plate. After reaction for 45 min at room temperature, the absorbance was measured at 517 nm using a microplate reader (Bio Tek). The scavenging activity of the extract was calculated using the following equation, and the data represent the IC50 value. The IC50 value is defined as the amount of antioxidants required to reduce the initial DPPH concentration by 50%.
Ac, absorbance of the control (without sample) and As, absorbance of the sample.
Ferric reducing antioxidant power (FRAP) assay
The FRAP reagent was freshly prepared for each experiment by dissolving 300 mM acetate buffer (pH 3.6), 10 mM TPTZ in 40 mM HCl, and 20 mM FeCl3 to obtain a 10:1:1 (v/v/v) ratio. FRAP reagent was preheated at 37°C for 15 min before use. Then, 50 µL of SE at various concentrations was mixed with 150 µL of FRAP reagent and allowed to react at room temperature for 4 min. The absorbance of the mixture was measured at 595 nm using a microplate reader (Bio Tek). Reducing power was expressed as µM Trolox using a standard curve.
Cell culture
3T3-L1 preadipocytes were seeded at 3.0 × 104 cells/well in a 12-well plate and cultured in DMEM containing 10% BCS and 1% PS at 37°C and 5% CO2. When the cells were confluent (0 days), the medium was changed to differentiation medium containing DMEM, 10% FBS, IBMX (0.5 mM), DEX (1 µM), and insulin (10 µg/mL). After 2 days, the medium was replaced with fresh FBS/DMEM containing 10 µg/mL insulin for 6 days. The medium was replaced every 2 days. The cells were treated with SE (0-100 µg/mL) for 10 days to confirm the inhibitory effect on lipid accumulation. The cells were harvested after 10 days of differentiation to determine lipid accumulation.
Cytotoxicity
Cell viability was evaluated using the MTT assay. 3T3-L1 preadipocytes were cultured in a 96-well plate at 1.0 × 105 cells/well for 24 h and then treated for 24 h with 0, 25, 50, 100, and 200 µg/mL SE. Then, 20 µL of MTT solution freshly prepared at 5 mg/mL in PBS was added to each well and incubated at 37°C for a further 4 h. After incubation, the supernatant was discarded, and DMSO was added to completely solubilize the purple formazan crystals. Absorbance was measured using a 540 nm microplate reader (Bio Tek). The cell viability data were presented as percentages of the control.
Oil Red O staining
Lipid accumulation in 3T3-L1 preadipocytes was determined using Oil Red O staining. The Oil Red O stock solution was dissolved in 100% isopropanol at a concentration of 3 mg/mL and diluted with distilled water in a 3:2 volume ratio to prepare a working solution. Cells were washed twice with PBS and fixed with 10% formalin for 1 h. The cells were washed with 60% isopropanol for 5 min and stained with Oil Red O working solution for 10 min. After the cells were rinsed twice with distilled water, the stained lipid droplets were eluted with 100% isopropanol and the suspensions were centrifuged at 14,881 × g for 2 min. The absorbance of the supernatant was measured at 480 nm using a microplate reader (Bio Tek).
Real-time PCR
3T3-L1 cells were lysed to obtain total mRNA, followed by the NucleoSpin® RNA Plus isolation kit (Macherey-Nagel, Dueren, Germany). The integrity, purity, and quantity of the isolated mRNAs were measured using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA), and the concentrations were normalized. Subsequently, total mRNA was reverse transcribed to cDNA according to the instructions of the PrimeScript™ RT reagent kit (Takara, Shiga, Japan). Following the manufacturer’s instructions, a reaction mixture (10 µL) including 3.5 µL of mix reagent and 6 µL of total RNA were prepared. Next, mRNA expression reaction was prepared as follows: 2 µL of synthesized cDNA was mixed with 10 µL of SYBR Green Supermix, 3.2 µL of primer pair set, and 6 µL of RNase-free H2O. mRNA expression analysis was performed using a CFX96TM RT-PCR detection system (Bio-Rad, Hercules, CA, USA). The primer sequences used for real-time PCR are listed in Table 1. The relative expression levels were calculated with 36b4 as the reference gene using the delta-delta threshold cycle (ΔΔCt) method.
Table 1
Sequences of real-time PCR primer used in gene expression analysis.
Target
|
Forward primer (5ʹ-3ʹ)
|
Reverse primer (5ʹ-3ʹ)
|
36b4
|
TCTAGGACCCGAGAAGACCTC
|
GTTGTCAAACACCTGCTGGAT
|
Cebpα
|
TTACAACAGGCCAGGTTTCC
|
GGCTGGCGACATACAGTACA
|
Pparɣ
|
CGCTGATGCACTGCCTATGA
|
AGAGGTCCACAGAGCTGATTCC
|
Fabp4
|
AAGAAGTGGGAGTGGGCTTTG
|
CTGTCGTCTGCGGTGATTTC
|
Srebp1c
|
GAACAGACACTGGCCGAGAT
|
GAGGCCAGAGAAGCAGAAGAG
|
Fas
|
AGCACTGCCTTCGGTTCAGTC
|
AAGAGCTGTGGAGGCCACTTG
|
Scd1
|
CATCGCCTGCTCTACCCTTT
|
GAACTGCGCTTGGAAACCTG
|
Statistical analysis
Data were expressed as the mean ± standard error of the mean (SEM). All statistical analyses were performed using GraphPad Prism version 7 (GraphPad Software, La Jolla, CA, USA) using one-way analysis of variance (ANOVA) followed by the least significant difference (LSD) test. Differences were considered statistically significant at p < 0.05.