SLC6A2 /MAOA inhibitors improve the glycolipid metabolism by regulating norepinephrine in sympathetic neuron–associated macrophages

doi:10.21203/rs.3.rs-1942954/v1

Download PDF

Research Article

SLC6A2 /MAOA inhibitors improve the glycolipid metabolism by regulating norepinephrine in sympathetic neuron–associated macrophages

https://doi.org/10.21203/rs.3.rs-1942954/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: The infiltration of macrophages in white adipose tissue (WAT) is associated with the development of obesity. A recent study reported that sympathetic neuron–associated macrophages (SAMs) had a pro-inflammatory effect by regulating the metabolism of norepinephrine (NE) in obesity. SAMs transport and degrade NE via solute carrier family 6 member 2（SLC6A2）and monoamine oxidase A（MAOA）respectively. NE has a well-established role in promoting lipolysis in adipocytes. Furthermore, SAMs are recruited and activated in obesity, but the exact molecular mechanism is still unclear. The aim of this study is to explore whether the restraint of SLC6A2 or MAOA by SLC6A2 inhibitor (SLC6A2i) or MAOA inhibitor (MAOAi) would rescured metabolic disorders by modulating NE level in high fat diet (HFD) induced obesity mice model. We thus unveiled the effect of NE on glycolipid metabolism, focusing on the contribution of SAMs .

Methods: 24 male C57BL/6J mice (5 weeks old) were randomly fed with normal chow diet (NCD, n=6) or HFD (n=18) respectively for 16 weeks. 18 mice fed with HFD were randomly categorized into 3 groups as follows: HFD+NaCl (n=6), HFD+SLC6A2i (n=6) and HFD+MAOAi (n=6). The body weight, length and serum analysis (glucose, lipidprofile, and insulin) were obtained before and after 3 weeks of NE intervention. Then, superior cervical ganglia(SCG), visceral white adipose tissue (vWAT) and subcutaneous white adipose tissue (sWAT) were extracted for further analysis.

Results: After 3 weeks NE intervention, Lee’s index, FBG, P2hBG, TG, TC, LDL-C, and insulin showed lower in HFD+SLC6A2i and HFD+MAOAi group, and HDL-C showed higher than those in HFD+NaCl group (p<0.05)，although the weight and length had no significant change. The adiposytes in the HFD+NaCl group were obivously bigger and more inconsistent in size, while HFD+SLC6A2i group and HFD+MAOAi group showed intact morphology similar with NCD group. Compared with HFD+NaCl group, SAMs proportion, expression of SLC6A2, MAOA, TLR4, MYD88, NF-κB, TNF-α and IL-1α were significantly lower in HFD+SLC6A2i and HFD+MAOAi group (p<0.05), while the concentration of NE and expression of IL-10 were significantly higher in HFD+SLC6A2i and HFD+MAOAi group (p<0.05).

Conclusion: Our results indicated restraint the function of SLC6A2 or MAOA would rescued metabolic disorders and obesity by modulating NE level. Recruited SAMs in obesity might be derived from the chronic low grade inflammation via TLR4/NF-κB signaling pathway. These findings provide new target for therapeutic potential of glycolipid metabolism and obesity.

sympathetic neuron–associated macrophages

norepinephrine

obesity

white adipose tissue

solute carrier family 6 member 2

monoamine oxidase A

TLR4/ NF-κB signal pathway

Obesity is a major global public health issues nowadays, as it promotes a series of metabolic and atherosclerotic cardiovascular disease. There are more than 2 billion people worldwide with obesity or overweight despite great efforts to combat the obesity epidemic ^[1]. Therefore, it has always been a hot topic to reveal the pathogenesis of obesity and explore effective drugs for weight loss.

Macrophages play an important role in obesity-induced inflammation of the adipose tissue (AT) ^{[2, 3]}.In 2017, Pirzgalska R.M. et al ^{[3, 4]}defined a new unique type of macrophages located on sympathetic nerve bundles as SAMs. These macrophages exhibit profuse pseudopodia which differ from circular-shaped macrophages in AT, and express the immune marker CD45 + as hematopoietic stem cells and macrophage marker F4/80 + or CD68+ (CD45 + F4/80 + in mice, CD45 + CD68 + in human). They transport norepinephrine (NE) into cell through the solute carrier family 6 member 2 (SLC6A2) and degrade NE by monoamine oxidase A (MAOA). A recent study showed that SAMs exhibited significantly higher NE level after optogenetic stimulation in vitro^[4]. Nevertheless, inhibition of SLC6A2 by nisoxtetine prevented uptake of NE and significantly increased NE level in culture medium ^[4]. Furthermore, SAMs are recruited and activated in obesity, but the exact molecular mechanism is still unclear.

Catecholamine-induced lipolysis is the first step in the generation of energy substrates by the hydrolysis of triglycerides, which declines with age, but can be regulated by adipose tissue macrophages (ATMs) through lowering the bioavailability of NE ^[5]. Activation of white adipose tissue (WAT) innervated by sympathetic nervous system (SNS) is necessary for lipolysis and fat mass reduction via NE signaling^[6]. Therefore, neuro-immunometabolic signalling between the SNS and macrophages may offer a new target to mitigate chronic inflammation-induced metabolic impairment and functional decline. Therefore, it is possible that SAMs play an important roly in NE induced lipolysis and obeisty through its regulation on NE. We assumed that regulating the metabolism of NE in SAMs may affect lipolysis and body weight.

Based on previous researches, we proposed a new hypothesis that inhibition of SLC6A2 or MAOA in SAMs would up-regulate NE level, improve metabolic disorders and obesity in vivo. Meanwhile, we were also interested in further exploration about the mechanism underlying the metabolic effect of NE in SAMs. To verify this assumption, we modulated NE metabolism in SAMs by SLC6A2i nisoxetine or MAOAi clorgyline in high fat diet(HFD) induced obesity mice, observed changes in body weight, glucose and lipid metabolism, NE level, SAMs proportion, expression of SLC6A2/ MAOA, and the activation of the Toll-like receptor 4 (TLR4)/Nuclear factor-kappa B (NF-κB) signaling pathway. Our findings offer insights into the NE metabolic mechanism in SAMs and new targets for therapeutic potential of metabolic disorders and obesity.

Animals

24 male C57BL/6J mice (4 weeks old, body weight=12.1±0.54g) were purchased from the laboratory animal center of the Tongji Medical College of Huazhong University of Science and Technology (HUST), Wuhan, China. All mice handling methods and experimental protocols were conducted following guidelines and regulations approved by the Animal Ethics Committee of HUST. Animals were housed in cages in a room at 24℃±2℃ under a 12h light-dark cycle with free access to food and water for one week of adaptive period in lab conditions.

5 weeks old mice (n=24) were randomly assigned to a normal chow diet (NCD) group (group a: n=6) and a HFD group (n=18). They were fed with NCD (D12350B,10Kcal% fat) and HFD (D12492,60Kcal% fat) respectively for following 16 weeks. The food intake, body weight and length and were recorded weekly. Lee’s index was calculated using the following formula: Lee’s index =. Obesity degree(%)=(actual weight of experimental group - average weight of control group)/ average weight of control group ×100%. The establishment of obesity mouse model was confirmed as obesity degree≥40%.

NE metabolism interventions

At 21 weeks of age, eighteen mice fed with HFD were randomly categorized into 3 groups as follows: HFD+NaCl (group b, n=6), HFD+SLC6A2i (group c, n=6) and HFD+MAOAi (group d, n=6). The 3 groups were treated with nisoxetin (SLC6A2i, 1mg/kg), clorgyline (MAOAi, 2mg/kg)，and physiological saline solution(0.9%NaCl) respectively. The reagents were intraperitoneally injected every other day and HFD was administered continually in the following 3 weeks (Figure 1).

Serum analysis

At 21 and 24 weeks of age, mice were placed to clean cages without access to food and fasted overnight for 12h. Fasting blood samplings were achieved from the tip of the tails at the end of 21 week and 24 week. Glucose tolerance test (GTT) was performed in mice as follows: glucose solution (0.25g/ml) was injected intraperitoneally in a dose of 2g/kg body weight and the blood glucose levels were measured 2h after the injection. Fasting blood glucose (FBG) and postprandial 2 hour blood glucose (P2hBG) were measured by glucose oxidase method. Triglyceride (TG), total cholesterol (TC), low density lipoprotein cholesterol (LDL-C) and density lipoprotein cholesterol (HDL-C) were assessed by the automatic biochemical analysis. Serum insulin was determined by competitive radioimmunoassay.

Tissue collection

All mice were sacrificed to collect tissues for analysis at 24 weeks of age, including superior cervical ganglia(SCG), visceral white adipose tissue (vWAT) and subcutaneous white adipose tissue (sWAT). vWAT were collected from epididymides, while sWAT were collected from pubic bone of mice. Tissues were minced into small pieces for analysis or stored at −80°C until analysis.

Histological examination

Specimens from vWAT and sWAT were fixed in 4% paraformaldehyde overnight, incubated in an ethanol gradient and then embedded in paraffin. The samples were cut at a thickness of 4 μm and stained with hematoxylin and eosin (H&E) prior to an analysis of morphological changes. These adipose tissue samples were visualized using an optical microscope (OLYMPUS CK31) equipped with a charge coupled device camera, in order to assess inflammatory changes and macrophages infiltration induced by HFD and NE metabolism interventions.

Flow Cytometry

Specimens from SCG, vWAT and sWAT were washed with 1×PBS buffer, removed blood and hair, and cut into pieces. Then they were added to collagenase I (1mg/ml) in water bath at 37℃ for 1h. After centrifugation, the upper adipose cells were discarded and the lower cell masses were collected. Cells were incubated with the CD45 and F4/80 antibodies (BD bioscience,USA) at 4℃ in the dark for 30 min. The cells were analyzed by flow cytometry (Influx, Becton Dickinson Biosciences,USA). SAMs were identified as CD45+ and F4/80+.

ELISA

NE concentrations in SCG, vWAT and sWAT were measured by NE ELISA according to the manufacturer’s instructions.

Western blot

Western blot was used to determine the protein levels for SLC6A2 and MAOA in SCG, vWAT and sWAT. Cut the tissue into pieces with scissors on an ice box and add 1mL of freshly configured lysate every 20-50mg. The lysate was prepared by adding 1% SDS lysate to protease inhibitor EDTA (5mM) and PMSF (2mM, dissolved in isopropyl alcohol, added before use). Under the condition of ice bath, the sample was ground in a homogenizer, and then separated on ice for 30 min. The total protein was obtained by centrifugation at 4 ℃ for 15 min. Protein concentration was determined by BCA method. Protein quantification was obtained by UV spectrophotometer. Protein was separated by 10% SDS-PAGE and transferred by semi-dry membrane. The concentration of primary antibody was 1:500, and secondary antibody was 1:1000. Chemiluminescence detection system (Pierce, USA) was used for development. GADPH was used as internal reference.

Quantitative Real-Time Polymerase Chain Reaction (qTR-PCR)

To analyze mRNA expression for SLC6A2, MAOA, TNF-α, IL-1α, IL-10, TLR4, MYD88 and NF-κB from vWAT and sWAT, total RNA samples extracted from the tissue suspensions were reverse-transcribed into cDNA. The reaction system was formulated according to the PCR kit instruction. Subsequently, the cDNA was amplified and assessed by qRT-PCR. The PCR primers used are listed in Table1.

Table1.Gene names and primer sequences used in this study.
Gene Name	Forward Primer	Reverse Primer
Mu-MAOA	GCCCAGTATCACAGGCCAC	CGGGCTTCCAGAACCAAGA
Mu-SLC6A2	CCTGCAAAACCGCCGATCTA	GAGGAACAGCGTGTATGGAATC
Mu-MYD88	TCATGTTCTCCATACCCTTGGT	AAACTGCGAGTGGGGTCAG
mTLR4	ATGGCATGGCTTACACCACC	GAGGCCAATTTTGTCTCCACA
Mu-IL1a	CGAAGACTACAGTTCTGCCATT	GACGTTTCAGAGGTTCTCAGAG
Mu-IL10	GCTCTTACTGACTGGCATGAG	CGCAGCTCTAGGAGCATGTG
Mu-TNFα	CCCTCACACTCAGATCATCTTCT	GCTACGACGTGGGCTACAG
Mu-NF-κBp65	ATGGCAGACGATGATCCCTAC	TGTTGACAGTGGTATTTCTGGTG
mGAPDH	AGGTCGGTGTGAACGGATTTG	GGGGTCGTTGATGGCAACA

Data and statistical analysis

Data are expressed as means±standard deviation (SD). Values among groups were analyzed by ANOVA and comparisons between two groups were performed using Student’s t-test. All analyses were carried out using SPSS 20.0 software with a two-sided significance level of 5%. p<0.05 was considered statically significant.

Establishment of HFD induced obesity mice model and effects on obesity by inhibition of SLC6A2 or MAOA

Experimental paradigm was presented as figure 2. Compared with NCD group, body weight, body length, Lee’s index, and biochemical indices including FBG, P2hBG, TG, TC, LDL-C, and insulin were significantly higher in HFD-fed groups at 21 weeks of age, while HDL-C was lower (Table 2, p<0.05). After 3 weeks NE intervention by application of nisoxetine or clorgyline at 24 weeks of age, Lee’s index, FBG, P2hBG, TG, TC, LDL-C, and insulin showed lower in HFD+SLC6A2i and HFD+MAOAi group, and HDL-C showed higher than those in HFD+NaCl group (p<0.05)，although the weight and length had no significant change (Table 2).

Table 2. Metabolic characteristics comparison before and after NE intervention

Variable	NCD	HFD+NaCl	HFD+SLC6A2i	HFD+MAOAi
Variable	(n=6)	(n=6)	(n=6)	(n=6)
Weight(g)
21W	25.27±0.98	34.54±1.10^*	34.55±1.46^*	34.58±1.49^*
22W	25.45±1.04	34.55±1.21^*	34.52±1.08^*	34.56±0.79^*
23W	25.62±0.88	34.56±1.08^*	34.54±0.64^*	34.55±0.83^*
24W	25.67±0.75	34.57±0.77^*	34.55±0.60^*	34.56±0.71^*
Body length(cm)
21W	8.42±0.12	8.65±0.35^*	8.52±0.12^*	8.90±0.20^*
22W	8.45±0.10	8.80±0.30^*	8.68±0.15^*	9.03±0.22^*
23W	8.55±0.10	8.82±0.30^*	8.69±0.22^*	9.10±0.22^*
24W	8.58±0.13	8.98±0.27^*	8.67±0.19^*	9.11±0.16^*
Lee’s index
21W	3.49±0.09	3.78±0.17^*	3.78±0.09^*	3.77±0.05^*
22W	3.48±0.08	3.79±0.14^*	3.74±0.07^*	3.60±0.08
23W	3.49±0.06	3.81±0.15^*	3.72±0.09^*	3.59±0.08^&
24W	3.44±0.08	3.83±0.12^*	3.68±0.06^*#a	3.58±0.05^&a
FBG (mmol/L）
21W	6.65±0.86	9.67±1.00^*	9.72±1.23^*	9.57±0.77^*
24W	6.65±0.63	10.10±0.72^*	8.43±0.58^*#a	8.52±1.04^*&a
P2hBG（mmol/L）
21W	8.17±0.86	11.17±1.49^*	11.18±1.48^*	11.02±0.98^*
24W	7.50±0.95	11.98±0.96^*	9.10±1.14^*#a	9.15±1.16^*&a
Serum lipid
TG（mmol/L）
21W	0.77±0.18	1.68±0.89^*	1.73±0.75^*	1.67±0.00^*
24W	0.78±0.21	1.72±0.37^*a	1.29±0.75^*#a	1.06±0.00^*&a
TC（mmol/L）
21W	1.56±0.24	1.79±0.72*	1.72±0.75^*	1.87±0.50^*
24W	1.55±0.05	1.82±0.37^*a	1.29±0.75^*#a	1.06±0.00^*&a
HDL-C（mmol/L）
21W	0.85±0.11	0.53±0.15^*	0.53±0.15^*	0.58±0.55^*
24W	0.86±0.06	0.68±0.01^*a	0.78±0.08^#a	0.82±0.01^&a
LDL-C（mmol/L）
21W	0.51±0.13	0.83±0.54^*	0.89±0.89^*	0.82±0.27^*
24W	0.52±0.08	0.85±0.05^*	0.58±0.10^#a	0.60±0.03^&a
Insulin（pg/mL）
21W	306.98±68.92	763.10±257.2^*	758.10±69.2^*	782.10±136.8^*
24W	311.43±5.35	844.10±194.9^*	455.42±36.97^*#a	402.75±41.80^*&a

Data are represented as the means±SD. Values among groups were analyzed by ANOVA and comparisons between two groups were made using Student’s t-test.^*p<0.05, HFD+NaCl/HFD+SLC6A2i/HFD+MAOAi group vs NCD group, ^#p<0.05, HFD+SLC6A2i group vs HFD+NaCl group, ^&p<0.05, HFD+MAOAi group vs HFD+NaCl group. ^ap<0.05, data at 24W vs 21W.

Inhibition of SLC6A2 or MAOA reduced inflammatory response of WAT in HFD induced obesity

We observed histopathological changes in inflammatory response of WAT with application of SLC6A2i or MAOAi in HFD-induced obesity at the end of 24 weeks. H&E staining showed that adipose cells in NCD group were uniform in size (Fig.2A.a, 2B.a). The adiposytes in the HFD+NaCl group (Figure. 2A.b, 2B.b) were obivously bigger and more inconsistent in size. Meanwhile, the adipose tissue was infiltrated with inflammatory cells. Macrophages were gathering around adipocytes and forming coronal structures. The HFD+SLC6A2i(Fig.2A.c, 2B.c) group and HFD+MAOAi(Fig.2A.d, 2B.d) group showed intact morphology similar with NCD group. This phenomenon illustrated that inhibition SLC6A2 or MAOA resulted in a less pro-inflammatory micro-environment in WAT in obesity.

SAMs were recruited in obesity and restrained after inhibition of SLC6A2 or MAOA

The concentration of SAMs in SCG, vWAT and sWAT exhibited significantly higher in HFD+NaCl group than NCD group (p<0.05) (Figure 3, A from SCG, B form vWAT, C from sWAT). After 3 weeks of NE metabolism intervention by SLC6A2i or MAOAi, the SAMs proportion decreased.

NE decreased in obesity and increased after inhibition of SLC6A2 or MAOA

Compared to NCD group, the concentration of NE in HFD+NaCl group was significantly lower，p<0.05 (Figure 4, A from SCG, B form vWAT, C from sWAT). Furthermore, NE level in HFD+SLC6A2i and HFD+MAOAi group increased, which was significantly higher than HFD+NaCl group (p<0.05). It suggested that NE decreased in obesity and its metabolism was associated with the function of SLC6A2 and MAOA, as inhibition of SLC6A2 or MAOA increase the level of NE.

High expression of SLC6A2 and MAOA in obesity

We next examined the protein and mRNA levels of SLC6A2 and MAOA by western blot and qRT-PCR in WAT, respectively (Figure 5. A and C from vWAT, B and D from sWAT). In HFD+NaCl group, the level of SLC6A2 and MAOA were higher than those in NCD group(p<0.05). However, compared with HFD+NaCl group, the expression of SLC6A2 or MAOA were obviously suppressed in HFD+SLC6A2i and MAOAi group respectively(p<0.05).

Effects of NE metabolism intervention on the TLR4/NF-κB signaling pathway in obesity

The mRNA expression analysis of the TLR4/NF-κB signaling pathway in WAT(Figure 6. A from vWAT, B from sWAT) was determined by qRT-PCR. In comparison with the NCD group, TLR4, MYD88, NF-κB, TNF-α and IL-1α were significantly increased in HFD+NaCl group, while IL-10 was significantly decreased. After NE metabolism intervention, levels of TLR4, MYD88, NF-κB, TNF-α and IL-1α in the HFD+SLC6A2i and HFD+MAOAi groups were both significantly decreased and level of IL-10 was significantly increased(P<0.01) . It suggested that NE metabolism intervention reduced inflammation mediated by TLR4/NF-κB signaling pathway.

In this study, mice fed with HFD developed obesity, glycolipid metabolic disorders and hyperinsulinemia. After the application of SLC6A2i or MAOAi, glycolipid metabolic disorders and insulin resistance were improved. These results suggested that NE metabolism intervention by SLC6A2i and MAOAi might be used as potential agents for glycolipid metabolism and insulin resistance (IR) ameliotation, although this study didn’t show significant weight loss in short period (3 weeks) of intervention. However, it’s necessary to explore the underlying mechanism.

We found the concentration of NE in WAT of obese mice induced by HFD was lower than that of mice fed with NCD. However, this phenomenon seems to be in contradiction with sympathetic excitation characteristic of obesity. It’s known that the SNS is involved in the regulation of substance metabolism and energy balance, and its chronic activation is closely related to metabolic disorders such as obesity, IR, and type 2 diabetes^[7]. Human obesity is characterized by chronic SNS overactivity^[8]. The mechanisms responsible for sympathetic nervous activation in obesity may involve hyperinsulinemia, increased circulating adipokines, leptin, stress and beta adrenergic receptor polymorphisms^[9]. IR and sympathetic activity are related by a positive feedback system: IR is the core factor of sympathetic excitation caused by abnormal adipokines^[10]. A long term follow-up study showed that NE responses to cold pressor test were a positive predictor of future homeostasis model assessment of insulin resistance (HOMA-IR). Sympathetic reactivity may predict IR 18 years later ^[11]. Some studies showed that reducing SNS activation could effectively improve metabolic disorders, especially hypertension, fatal cardiovascular outcomes ^[11–13]. On the other hand, NE has a well-established role in promoting lipolysis in adipocytes. In mature adipocytes, NE released from sympathetic endings binds to β 3-adrenergic receptors to reactivate the thermogenic program of dormant cells^[14]. β3-AR in human brown/beige adipocytes are required to participate lipolysis and thermogenesis^[15]. This process promotes brown fat activation, beige fat formation, leading to an increase in heat production and energy expenditure. It has been proved that the activity of brown fat was decreased in obese mice, and the ability of inducing beige fat to mediate heat production was impaired. Protein and genes related to catecholamine synthesis were significantly decreased in the sWAT of HFD mice ^[16]. In this sense, the reduction of NE in obesity may reduce the lipolysis caused by NE, leading to the further aggravation of obesity. Since SNS of obesity is activated, where is the NE that can promote lipolysis? This may relate to the mechanism of NE metabolism.

Traditionally, peripheral NE is secreted only by the sympathetic posterior ganglia fibers and the adrenal medulla. Using intravital two photon microscopy, researchers observed that sympathetic nerve fibers establish neuro-adipose junctions, directly “enveloping”adiposytes^[6]. Previous study suggested that pro-inflammatory ATMs could produce NE after short period of cold stimulation^[14].However, other groups came up with opposite idea. Recent studies indicated that ATMs and SAMs cannot synthesis NE because they did not express the necessary enzymes (tyrosine hydroxylase,Th) for NE biosynthesis, which was highly expressed in adjacent SNS neurons ^{[4, 17]}. Researchers found that perivascular AT contained an independent adrenergic system that could take up, metabolize, release, and potentially synthesize the vasoactive catecholamine norepinephrine^[18].

The neropinephrine transporter (NET) encoded by SLC6A2 are located in the presynaptic membrane of adrenergic nerves. They can reuptake 80–90% of the NE released by sympathetic neurons back into the presynaptic membrane. Some of them will be decomposed and inactivated by the corresponding metabolic enzymes (monoamine oxidase A MAOA, catecholamine methyltransferase COMT) in the synaptic cleft. NET and SLC6A2 also involve in modulating mood, arousal, memory, and pain perception ^{[19, 20]}. Recent studies focused on the association between SLC6A2 and psychiatric disorder, including attention deficit hyperactivity disorder^[21], major depression^[22],bipolar I disorder^[23],and so on. MAOA mainly distributed in catecholamine neurons, is one of two neighboring gene family members that encode mitochondrial enzymes. These enzymes catalyze the oxidative deamination of amines, such as dopamine, NE, and serotonin ^[24]. The process plays an important role in the regulation of NE concentration in the synaptic cleft, the suspension of nerve impulse signals, and the maintenance of receptor sensitivity to neurotransmitters via SLC6A and MAOA ^[4]. Previous studies have reported that SAMs express SLC6A2 and MAOA ^{[4, 25]}. Therefore, they can regulate NE levels as a NE sink to limit NE levels. In obesity, recruited SAMs import and degrade more NE by SLC6A2 and MAOA respectively, resulting in decrease of NE concentration. Furthermore, SLC6A2 deletion in SAM in ob/ob mice and mice fed with HFD can increase the content of brown adipose tissue, thermogenesis, and eventually lead to substantial and sustained weight loss ^[4]. Inhibition of MAOA reversed the age-related reduction in noradrenaline concentration in adipose tissue, and restored lipolysis with increased levels of the key lipolytic enzymes adipose triglyceride lipase and hormone sensitive lipase^[5]. These results indicate that regulating the metabolism of NE in SAMs may affect body weight and metabolism.

SLC6A2i and MAOAi have been constantly developed and updated in clinical medicine and basic research for a long time. Nisoxetine is an important antagonist of monoamine transporter NET, and its reuptake function can be inhibited by binding to the transporter. As tricyclic antidepressants in clinical medicine, it is also used as specific ligand to research NET function. Chlorgyline can selectively inhibit the activity of MAOA. Clinically, MAOAis have been proved to be effective in the treatment of a variety of mental disorders. In this study, we found the protein and mRNA levels of SLC6A2 and MAOA were higher in obesity induced by HFD. After treatment with nisoxetine and chlorgyline for 3 weeks, the protein and mRNA levels of SLC6A2 and MAOA were respectively suppressed. Therefore, SLC6A2i and MAOAi might improve glycolipid metabolism and RI through increase NE level and lipolysis mediated by NE. Meanwhile, changes in SLC6A2 and MAOA levels were consistent with the degree of SAM infiltration.

Consistent with previous studies ^{[3, 4]}, we found SAMs (CD45 + F4/80 + cells) in SCG, vWAT and subcutaneous sWAT by flow cytometric analysis, and SAMs were recruited in HFD induced obesity. The infiltration of SAMs were also accompanied by inflammation of WAT in obesity, as TLR4, MYD88, NF-κB, TNF-α and IL-1α were significantly increased, and anti-inflammatory cytokine (IL-10) was significantly decreased. The activated SAMs increase expression of pro-inflammatory factor genes (CXCL2, TNF-α, SOCS3, IL-1α) and decrease expression of anti-inflammatory factor genes (ARG1, IL-10)^[4]. However, it is still unclear whether the increase of SAMs in AT is causal or secondary to obesity and/or inflammation. The mechanism of SAMs proliferation induced by obesity may be similar to that of ATMs. HFD and excess nutrition lead to hyperplasia and excessive expansion of adipocytes, resulting hypoxia and endoplasmic reticulum stress, stimulating adipocytes to secrete chemokines and recruit monocytes to adipocytes. Macrophages originated from the pool of circulating monosytes, which derive from the bone marrow and aggregate in AT as ATMs. SAMs are also seemingly of hematopoietic origin, because they express high CD45 as hematopoietic cells ^[4]. Our previous study identified that infiltration and abnormal polarization of ATMs lead to low-grade inflammation, promote insulin resistance and the development of adipocyte hypertrophy and hyperplasia^[26]. Aggregated ATMs can also express chemokines and S100A8/A9, the latter can induce ATM TLR-4/MyD88 and NLRP3 inflammasome-dependent IL-1β^[27]. Free fatty acids also promote inflammation by binding to TLRs, such as TLR4 and TLR2 ^[28]. TLR4 acts via MYD88, leading to NF-κB activation, cytokine secretion and inflammatory response^{[29, 30]}. This protein functions as an essential signal transducer in the IL-1 and TLR signaling pathways, which regulate the activation of numerous pro-inflammatory genes. IL-1β secreted into the peripheral circulation stimulates myelodysplasia and the production of monocytes and neutrophils, creating a vicious cycle. Therefore, recruited SAMs in obesity might be derived from chronic low grade inflammation via TLR4/NF-κB signaling pathway.

SAMs are recruited in obesity induced by HFD. Infiltration of SAMs in WAT enhance NE metabolism by SLC6A2 and MAOA, leading to a decrease of NE level and suppression of NE-induced lipolysis. Interventions on NE metabolism by SLC6A2i and MAOAi up-regulate NE level, reduce inflammatory response via TLR4/ NF-κB signal pathway, decrease infiltration of SAMs, and improve IR and glycolipid metabolism. This study was the first to demonstrate that application of SLC6A2i or MAOAi in obese mice improves glycolipid metabolic disorder through increasing NE level in SAMs. SAMs have also been demonstrated to exist in human sympathetic ganglia and use a similar NE clearance mechanism ^[4]. Therefore, SLC6A2i and MAOAi may be potential therapeutic agents for glycolipid metabolic disorder and obesity in human.

WAT:White adipose tissue; SAMs:Sympathetic neuron–associated macrophages; AT:Adipose tissue; NE: Norepinephrine;SLC6A2:Solute carrier family 6 member 2; MAOA:Monoamine oxidase A; SLC6A2i:SLC6A2 inhibitor; MAOAi: MAOA inhibitor; HFD:High fat diet; NCD:Normal chow diet; SCG:Superior cervical ganglia; vWAT:Visceral white adipose tissue; sWAT:Subcutaneous white adipose tissue; SNS:Sympathetic nervous system; GTT: Glucose tolerance test; FBG:Fasting blood glucose; P2hBG:Postprandial 2 hour blood glucose; TG:Triglyceride; TC:Total cholesterol; LDL-C:Low density lipoprotein cholesterol; HDL-C:Density lipoprotein cholesterol; TLR4:Toll-like receptor 4; NF-κB: Nuclear factor-kappa B; TNF:Tumor necrosis factor; IL:Interleukin; MYD88:Myeloid differentiation factor 88; IR:Insulin resistance; HOMA-IR:Homeostasis model assessment of insulin resistance; NET:Neropinephrine transporter;

Ethical approval and consent to participation

All animal experiments were approved by the ethical committee of Laboratory Animal Ethics Committee of Huazhong University of Science and Technology. All experiments were performed in accordance with relevant guidelines and regulations. All experiments on live vertebrates were performed in accordance with the Guide for the Care and Use of Laboratory Animals (NIH Publication NO.85–23, revised 1996). All methods are reported in accordance with ARRIVE guidelines (https://arriveguidelines.org) for the reporting of animal experiments.

Consent for publication

Not applicable.

Availability of data and material

The datasets used and/or analysed during the current study available from the corresponding author on reasonable request.

Competing Interests

The authors declare no competing interests.

Funding

This research was financially supported by the Health and Family Planning Commission of Wuhan City (WX18C25).

Acknowledgment

We are grateful to HUST and The Central Hospital of Wuhan for the equipment and administrative support for this study.

Authors’ Contributions

Prof HM Zhang had full access to all of the data in the study and took responsibility for the integrity of the data and the accuracy of the data analysis. HM Zhang conceived and designed the experiments. SS Zheng, MX Sun, P Wang, JJ Wang and L Yi performed the experiments. MX Sun and SS Zheng analyzed the data, drafted and revised the manuscript. HM Zhang reviewed and edited the final version of manuscript. MX Sun and SS Zheng are authors contributed equally. All authors reviewed and agreed to the published version of manuscript.

Author Details

¹Department of Endocrinology, The Central Hospital of Wuhan, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, 430021, Hubei, China.

Gonzalez-Muniesa P, Martinez-Gonzalez M A, Hu F B, et al. Obesity[J]. Nat Rev Dis Primers, 2017,3:17034.
Ying W, Fu W, Lee Y S, et al. The role of macrophages in obesity-associated islet inflammation and beta-cell abnormalities[J]. Nat Rev Endocrinol, 2020,16(2):81–90.
Pirzgalska R M, Domingos A I. Macrophages in obesity[J]. Cell Immunol, 2018,330:183–187.
Pirzgalska R M, Seixas E, Seidman J S, et al. Sympathetic neuron-associated macrophages contribute to obesity by importing and metabolizing norepinephrine[J]. Nat Med, 2017,23(11):1309–1318.
Camell C D, Sander J, Spadaro O, et al. Inflammasome-driven catecholamine catabolism in macrophages blunts lipolysis during ageing[J]. Nature, 2017,550(7674):119–123.
Zeng W, Pirzgalska R M, Pereira M M, et al. Sympathetic neuro-adipose connections mediate leptin-driven lipolysis[J]. Cell, 2015,163(1):84–94.
Thorp A A, Schlaich M P. Relevance of Sympathetic Nervous System Activation in Obesity and Metabolic Syndrome[J]. J Diabetes Res, 2015,2015:341583.
Balasubramanian P, Hall D, Subramanian M. Sympathetic nervous system as a target for aging and obesity-related cardiovascular diseases[J]. Geroscience, 2019,41(1):13–24.
Lambert G W, Straznicky N E, Lambert E A, et al. Sympathetic nervous activation in obesity and the metabolic syndrome–causes, consequences and therapeutic implications[J]. Pharmacol Ther, 2010,126(2):159–172.
Landsberg L. Insulin-mediated sympathetic stimulation: role in the pathogenesis of obesity-related hypertension (or, how insulin affects blood pressure, and why)[J]. J Hypertens, 2001,19(3 Pt 2):523–528.
Licht C M, Vreeburg S A, van Reedt D A, et al. Increased sympathetic and decreased parasympathetic activity rather than changes in hypothalamic-pituitary-adrenal axis activity is associated with metabolic abnormalities[J]. J Clin Endocrinol Metab, 2010,95(5):2458–2466.
Ye F, Shi G, Wang X, et al. [Renal sympathetic denervation can significantly reduce blood pressure and improve arterial stiffness in hypertensive beagles][J]. Nan Fang Yi Ke Da Xue Xue Bao, 2021,41(11):1609–1615.
Hering D, Lachowska K, Schlaich M. Role of the Sympathetic Nervous System in Stress-Mediated Cardiovascular Disease[J]. Curr Hypertens Rep, 2015,17(10):80.
Nguyen K D, Qiu Y, Cui X, et al. Alternatively activated macrophages produce catecholamines to sustain adaptive thermogenesis[J]. Nature, 2011,480(7375):104–108.
Cero C, Lea H J, Zhu K Y, et al. beta3-Adrenergic receptors regulate human brown/beige adipocyte lipolysis and thermogenesis[J]. JCI Insight, 2021,6(11).
Qiu Y, Nguyen K D, Odegaard J I, et al. Eosinophils and type 2 cytokine signaling in macrophages orchestrate development of functional beige fat[J]. Cell, 2014,157(6):1292–1308.
Fischer K, Ruiz H H, Jhun K, et al. Alternatively activated macrophages do not synthesize catecholamines or contribute to adipose tissue adaptive thermogenesis[J]. Nat Med, 2017,23(5):623–630.
Ahmad M F, Ferland D, Ayala-Lopez N, et al. Perivascular Adipocytes Store Norepinephrine by Vesicular Transport[J]. Arterioscler Thromb Vasc Biol, 2019,39(2):188–199.
Fichna J P, Huminska-Lisowska K, Safranow K, et al. Rare Variant in the SLC6A2 Encoding a Norepinephrine Transporter Is Associated with Elite Athletic Performance in the Polish Population[J]. Genes (Basel), 2021,12(6).
Hommers L G, Richter J, Yang Y, et al. A functional genetic variation of SLC6A2 repressor hsa-miR-579-3p upregulates sympathetic noradrenergic processes of fear and anxiety[J]. Transl Psychiatry, 2018,8(1):226.
Angyal N, Horvath E Z, Tarnok Z, et al. Association analysis of norepinephrine transporter polymorphisms and methylphenidate response in ADHD patients[J]. Prog Neuropsychopharmacol Biol Psychiatry, 2018,84(Pt A):122–128.
Marshe V S, Maciukiewicz M, Rej S, et al. Norepinephrine Transporter Gene Variants and Remission From Depression With Venlafaxine Treatment in Older Adults[J]. Am J Psychiatry, 2017,174(5):468–475.
Kim S Y, Kim H N, Jeon S W, et al. Association between genetic variants of the norepinephrine transporter gene (SLC6A2) and bipolar I disorder[J]. Prog Neuropsychopharmacol Biol Psychiatry, 2021,107:110227.
Liu Z, Huang L, Luo X J, et al. MAOA Variants and Genetic Susceptibility to Major Psychiatric Disorders[J]. Mol Neurobiol, 2016,53(7):4319–4327.
Bradley C A. Obesity: Specialized macrophages contribute to obesity[J]. Nat Rev Endocrinol, 2017,13(12):690.
Zhang H M, Chen L L, Wang L, et al. Macrophage infiltrates with high levels of Toll-like receptor 4 expression in white adipose tissues of male Chinese[J]. Nutr Metab Cardiovasc Dis, 2009,19(10):736–743.
Nagareddy P R, Kraakman M, Masters S L, et al. Adipose tissue macrophages promote myelopoiesis and monocytosis in obesity[J]. Cell Metab, 2014,19(5):821–835.
Nguyen M T, Favelyukis S, Nguyen A K, et al. A subpopulation of macrophages infiltrates hypertrophic adipose tissue and is activated by free fatty acids via Toll-like receptors 2 and 4 and JNK-dependent pathways[J]. J Biol Chem, 2007,282(48):35279–35292.
Baker R G, Hayden M S, Ghosh S. NF-kappaB, inflammation, and metabolic disease[J]. Cell Metab, 2011,13(1):11–22.
Griffin C, Eter L, Lanzetta N, et al. TLR4, TRIF, and MyD88 are essential for myelopoiesis and CD11c(+) adipose tissue macrophage production in obese mice[J]. J Biol Chem, 2018,293(23):8775–8786.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

SLC6A2 /MAOA inhibitors improve the glycolipid metabolism by regulating norepinephrine in sympathetic neuron–associated macrophages

Status:

Version 1

Abstract

Figures

Introduction

Methods

Results

Discussion

Conclusion

Abbreviations

Declarations

References

Additional Declarations

Status:

Version 1