Acute kidney injury (AKI) is a global health problem and occurring in a variety of clinical settings. Despite some advances in supportive clinical care, no medicinal intervention has been demonstrated to reliably prevent AKI so far. Thus, it is highly demand to investigate the involved pathophysiology and mechanisms, as well as discover therapeutics on the basis. In this work, an upregulated mRNA level of ferroptosis biomarkers (Ptgs2 and Acsl4), and an elevated renal iron and malondialdehyde (MDA) level were observed in the early stage of murine rhabdomyolysis induced-AKI (RM-AKI), which support a pathogenic role of labile iron-mediated ferroptosis and provide a chance of utilizing iron chelation for RM-AKI preventions. Given that the existing small molecule-based iron chelators did not show promising preventions against RM-AKI, we further designed and synthesized a new hydroxypyridinone-based iron chelators for potently inhibiting labile iron-mediated ferroptosis. And a lead AKI-02 was identified with remarkable protection of renal proximal tubular epithelial cells from ferroptosis and excellent iron chelation ability. Moreover, administration of AKI-02 led to a recovery of renal function, which was substantiated by the decreased BUN and creatinine, as well as reduced labile iron level and improved histopathology. Thus, our studies highlighted the targeting labile iron-mediated ferroptosis as a therapeutic benefit against RM-AKI.
Article
Targeting Labile Iron-Mediated Ferroptosis on Renal Proximal Tubular Epithelial Cells Provides a Potential Therapeutic Strategy for Rhabdomyolysis-Induced Acute Kidney Injury
https://doi.org/10.21203/rs.3.rs-1944512/v1
This work is licensed under a CC BY 4.0 License
Version 1
posted
You are reading this latest preprint version
Acute kidney injury (AKI)
Labile Iron
Ferroptosis
Rhabdomyolysis
Iron chelation
Hydroxypyridinones
Acute kidney injury (AKI) is a critical and common illness with high mortality and morbidity worldwide (1, 2). AKI is characterized by a sharp decline in kidney function and accompanied with a variety of clinical settings (3), such as rhabdomyolysis (RM). RM is generally caused by severe muscular trauma, infections, as well as drug abusion (4, 5). Approximately 15% to over 50% RM patients develops acute kidney injury (6, 7), and RM-AKI is also considered as a risk factor in COVID-19 patients in intensive care (8, 9). Despite recent advances in clinical supportive treatments, high mortality has been observed in hospitalizations, especially in ICU patients (10, 11). Even the renal function was recovered, the tubular epithelial cell death makes the AKI patients have high risk of developing end-stage renal disease and chronic kidney injury (12, 13). This will lead to a huge medicinal and economic burden around the world, however, there still lack effective medicinal interventions in AKI therapy so far. Thus, it is highly demand to investigate the involved mechanisms correlated with pathophysiology of RM-AKI as well as discover promising therapeutics for AKI treatment.
RM is an emergency that skeletal muscle massive breakdown with leakage of intracellular contents, including myoglobin into the circulation (14, 15). The myoglobin is filtered by the glomeruli to enter the proximal renal tubules. It is well-known that myoglobin is the rich source of heme iron (16). The released myoglobin then causes heme degradation, subsequently leading to the free iron release (17). Then the accumulated free iron can trigger Fenton reaction and induce damage to renal proximal tubular epithelial cells (18). Iron chelators, including deferoxamine and deferiprone were investigated and showed partial protection in the murine model of glycerol induced-acute kidney injury (18), though with poor bioavailability, nephrotoxicity and rapid glucuronidation (19). These results suggested that iron chelation may be a promising strategy to protect against RM-AKI but a new orally active iron chelator with a larger therapeutic is demand. On the other hand, despite evidences indicated the free iron accumulated in renal proximal tubular epithelial cell, the fundamental molecular mechanisms of these labile iron and the involved cell death are poorly understood.
Ferroptosis is a iron-dependent novel form regulated cell death characterized by the accumulation of lipid peroxides (20). Though ferroptosis is a newly defined programmed cell death, the discovery of its underlining regulatory mechanism and it’s physical or pathological relevance is attracting great interests. Additionally, pharmacological modulation of ferroptosis has been demonstrated to be a promising therapy for the cancer treatment and ischemic organ injuries in preclinical animal models (21, 22). Thus, it’s meaningful to further investigation to determine whether ferroptosis has been implicated in the pathogenesis of other diseases. In this study, we hypothesized that the release of free iron during rhabdomyolysis possibly leads to the ferroptosis, which likely contributes to rhabdomyolysis-induced AKI. Thus, we built a murine model of glycerol-induced AKI, which is widely used for studying the rhabdomyolysis-induced AKI (23). The upregulated mRNA level of ferroptosis biomarkers (Ptgs2 and Acls4) and an elevated renal iron level were observed in murine glycerol-induced AKI, indicating that labile iron-mediated ferroptosis has a crucial role in RM-AKI. Moreover, a new hydroxypyridinone iron chelator AKI-02 was designed and verified to potently block the ferroptosis on renal proximal tubular epithelial cells while keep an excellent iron chelation ability. Furthermore, AKI-02 exhibited promising protection against AKI in vivo with reduced labile iron level and improved histopathology. Our results help provide insight into the mechanism that labile iron-mediated ferroptosis induced RM-AKI.
2.1 Labile iron-mediated ferroptosis is involved in rhabdomyolysis-induced AKI
First, to investigate the relative correlations of labile iron during rhabdomyolysis and ferroptosis, we measured the ferroptosis related genes expression and iron levels in murine model of glycerol-induced AKI. The animal model was established by intramuscular injection of glycerol (10 mL/kg) in mice (Fig. 1A). Compared to the vehicle group, the glycerol group has a 5-fold and 6-fold increase in serum creatinine levels after 6 h and 12 h as well as a 4-fold and 5-fold increase in blood urea nitrogen (BUN). In addition, the glycerol group has the most significantly severe renal dysfunction after 24 h, the BUN and serum creatinine levels significantly increased from 8.2 to 81.6 mmol/L and 23 to 214 µmol/L, respectively (Fig. 1B and 1C). Histologic examination was also performed at 24 h after glycerol injection. As shown in Fig. 1D, glycerol-induced group showed obvious renal tubular necrosis and some hyaline casts in tubules. Also, widespread hemosiderosis deposition on the proximal tubular cells was observed via Perls’ Prussian blue stain (Fig. 1D). And these accumulated labile iron was also evidenced through ICP-MS and chromogen methods (Fig. 1E).
To further investigate the correlation between labile iron accumulated in RM-AKI and ferroptosis, the lipid peroxidation and ferroptosis-associated gene expression were assessed. As shown in Fig. 1F, glycerol-treatment group induced a robust change in the renal level of malondialdehyde (MDA) at 6 h, the most prevalent byproduct of lipid peroxidation (24), and maintained a high level for 24 hours, supporting ferroptosis occurred in kidney cortex. Interestingly, we found that some key anti-ferroptotic transcription regulators were upregulated in the short term but cannot maintained later on, which was not reported before. As shown in Fig. 1G, glycerol treatment induced the increase of Nrf2 and Gpx4 mRNA level in 6 h and 12 h, but no obvious expression differences were found at 24 h compared with vehicle group. The transient change is possibly due to the cells responding to stress temporarily and forming resistance to cell death. The above finding from a side suggests ferroptosis may occur in the early stage of AKI, but these proteins do not consistently eliminate high levels of lipid peroxidation accumulation for a longer time. On the other side, increasing kidney injury-in the form of ferroptosis-was observed by an upregulated level of ferroptosis biomarkers (25, 26). As shown in Fig. 1G, a gene encoding cyclooxygenase-2, prostaglandin-endoperoxide synthase 2 (Ptgs2) as expected increased significantly increased after treating with glycerol for 6 h and remain at this level for 24 hours. Additionally, we observed acyl-CoA synthetase long-chain family member 4 (Acsl4), a key role in lipid peroxide accumulation, has a time-dependent increase upon glycerol stimulation. Collectively, these results indicate that labile iron induced ferroptosis may drive the subsequent RM-AKI.
2.2 Protective effect of new hydroxypyridinones against RSL-3 induced ferroptosis and glycerol-induced AKI
Given the critical role of iron in ferroptosis, we were encouraged to test whether iron chelators could apply for RM-AKI prevention. As aforementioned, the classical iron chelator deferoxamine suffers from poor bioavailability and nephrotoxicity though shows a potential protection against AKI. Even the development of deferiprone has almost solved the above issues, the rapid glucuronidation on key chelating 3-hydroxyl group and incidence of agranulocytosis limited the iron chelation ability. In our previous work, we proposed a compensatory strategy for glucuronidation. By incorporating an alternative sacrificial hydroxyl group into hydroxypyridinone (HOPO) nucleus, the concerns centered on 3-hydroxyl glucuronidation-mediated metabolism was alleviated, and the iron removal efficacy of HOPOs was retained. (Fig. 2) (27). It seems plausible that these new HOPO-based iron chelators utilize a common mechanism in protecting against AKI.
To test this hypothesis, we first established a proximal tubule epithelial cell line-based ferroptosis as the in vitro screening assay and the previously discovered HOPOs were evaluated. It is not surprising that iron scavenging ability is correlated with the protection against ferroptosis. The HOPOs which possessed better iron scavenging ability than deferiprone, exhibited superior protection effect against RSL-3 induced ferroptosis than deferiprone (Fig. 3A). Considering the potential drug-like properties, one hit CN128 was chosen for further mechanism study. CN128 has a good protective effect against RSL-3 induced ferroptosis with an EC50 value of 16.5 µM (Fig. 3B). Also, CN128 significantly decreased the lipid ROS level in RSL-3 ± CN128 treated cell (Fig. 3C). However, unlike the previous hypothesis, CN128 failed to show protection on the glycerol-induced AKI. The levels of BUN and Scr were almost the same as those with glycerol group (Fig. 3D-E). These results move us to re-evaluate our assumptions. Whether the physicochemical property or distribution would be the notable factors to influence the in vivo effects.
2.3 Medicinal Chemistry Strategy for the Design of AKI-01 and AKI-02
With this in mind, we returned to compare the chemical structures of deferiprone (DFP) and CN128. The two compounds contain the same vital iron-chelating pharmacophore but quite different logD. And DFP was reported effective in vivo against acute kidney injury (18, 28). Thus the logD was thought to be a key factor affecting the in vivo efficacy. But low logD is a risk at cell membranes permeability and high logD tends to be more toxic (29). There existed a balance among hydrophility/lipophilicity, iron clearing efficiency and toxicity. In our previous work, we have found that the space exploration at the N-1 position of the HOPOs core would be ideal for logD modulation. Apart from the logD, the charge is also considered as another important factor. Marcomolecules or particles with positive potential were reported to have higher renal accumulation due to the negatively charged glomerular filtration fenestrae (30). Other studies also reported that incorporating nitrogen heterocyclic ring with tertiary amine makes the pirfenidone (a drug for lung fibrosis) for renal treatment (31). Appending a tertiary amine is proposed to not only trigger the electrostatic interactions with the negatively charged glomerular filtration fenestrae but also modulate the logD (Fig. 4).
Thus, AKI-01 and AKI-02 were designed and synthesized (Fig. 5). Two linkers were selected, including flexible ethyl and rigid phenyl linkers. And the N, N-dimethylamine and N-methyl piperazine ring were appending as the tertiary amine moieties. As for the calculated logD, AKI-01 is more hydrophilic than CN128, while AKI-02 is more lipophilic (Table 1). The UV-vis spectra of CN128, AKI-01, and AKI-02 with Fe2+ are shown in Fig. 6A-C. When FeSO4 was mixed with CN128, the maximum absorption at 285 nm showed a red shift to 296 nm, indicating the formation of a CN128-Fe2+ complex. Addition of FeSO4 to a solution of AKI-01 and AKI-02 produced a similar shift in the absorption maximum wavelength. These data suggest that AKI-01 and AKI-02 retained the same iron chelating ability as CN128. Besides, a series of UV-vis spectra of AKI-02 (60 µM) titrated by FeSO4 (0-150 µM) were shown in Fig. 6D. In the absence of Fe2+, the UV-vis spectrum of AKI-02 showed absorption maximum at 290 nm. When Fe2+ was added, the maximum absorption exhibited a red shift to 299 nm.
2.4 The anti-ferroptotic effects of the AKI-01 and AKI-02 on proximal tubule epithelial cells.
Similarly, the AKI-01 and AKI-02 were subsequently tested against RSL-3 induced ferroptosis on proximal tubule epithelial cells (Figure S1). Notably, RSL-3-induced cell death could be better suppressed by the AKI-02 rather than AKI-01, with the EC50 value of 13.3 µM (Fig. 7A and 7B). Since the strong background fluorescent signal was observed by the reaction of C11-BODIPY probe and AKI-02, we used fluorogenic probeLiperfluo to gain a better insight into the effects of AKI-02 on lipid hydroperoxides. It was found that AKI-02 rescued the HK-2 cell via reducing the accumulation of hydroperoxy-lipids (Fig. 7C). To further investigate the protective effect of AKI-02 on labile iron mediated-ferroptosis, HK-2 cells were co-treated with ferric ammonium citrate (FAC) and RSL-3 for 48 h. Incubation with exogenous sources of iron potentiated RSL-3-induced death. And cell death were suppressed by co-treatment with the iron chelator AKI-02 while DFP has hardly capable of reversing iron-overload ferroptosis (Fig. 7D). Additionally, as analyzed by flow cytometry, the increase in lipid ROS preceded began at 10 hours, and the overwhelming iron dependent accumulation of lipid ROS accumulation was remarkably suppressed by AKI-02 (Fig. 7E).
2.5 AKI-02 exhibited protective effect against glycerol-induced AKI via inhibiting labile iron-mediated ferroptosis
Next, we evaluated the preventive effect of AKI-02 in vivo. Although DFP has been identified as a reversed siderophore, limited by its bioavailability, DFP is less effective and has less documentation on the safety of higher doses. As shown in Fig. 8A, compared to DFP, AKI-02 had a superior protecting effect against glycerol-induced acute kidney injury, as primarily evidenced by renal function. The serum creatinine and BUN levels of DFP-treated group (50 mg/kg) were decreased by 39.7% and 32.1%, respectively, while the mice were treated with AKI-02 had improved renal function. The high-dose group (25 mg/kg) and the low-dose group (12.5 mg/kg) of AKI-02 caused a significant decrease of BUN and serum creatinine levels by 43.0% and 65.1%, respectively. Moreover, the histopathological changes including the desquamation of tubular epithelial cells, vacuolation and tubular dilation were significantly ameliorated at both two dosage of AKI-02 (12.5 and 25 mg/kg, Fig. 8B). These results indicated the in vivo efficacy of AKI-02 against the glycerol-induced AKI. In addition, we investigated the iron chelating ability of AKI-02 in murine model of glycerol-induced AKI. AKI-02 at the dose of 12.5 mg/kg and 25 mg/kg alleviated the labile iron deposition via Prussian Blue (Fig. 8C). And these changes were accompanied by a decrease in Ptgs2 and Acls4 mRNA levels, two classic biomarkers of ferroptosis (Fig. 8D). Together, AKI-02 could remove excess iron and inhibit ferroptosis in kidney at lower concentrations. And these data supported the hypothesis that preventing ferroptosis of renal proximal tubular epithelial cells is an effective renal-protective strategy.
Rhabdomyolysis-induced acute kidney injury is a fatal disorder condition, and there are few effective medicinal interventions in clinic so far. Accumulated labile iron has long been accepted during rhabdomyolysis injury, but the correlation between labile iron and cell death as well as its contribution to AKI are poorly understood. Here, we studied the role of ferroptosis in acute kidney injury induced by glycerol. We found the ferroptosis biomarkers Ptgs2 and Acls4 upregulation and the renal iron accumulation in the RM induced kidney damage. On the basis, we hypothesized that blocking the ferroptosis would be a potential therapeutic approach for treating and/or preventing RM-AKI. We then undertook a logD and glucuronidation-guide exploration of new HOPOs based iron chelator. Luckily, a lead AKI-02 was identified with retained iron chelation ability and more potent inhibition against ferroptosis than DFP. Oral administration of AKI-02 at a dose of 12.5 mg/kg led to a greater decrease in BUN and serum creatinine levels, as well as histological changes and iron chelation ability, than those with DFP. Our results suggest AKI-02 has the clinical potential for AKI therapy.
As AKI is an enormous worldwide problem with high mortality rate for many decades, effective intervention at the early stage is a key issue. In clinc, the common diagnosis of AKI is according to the change of conventional biomarkers like BUN and creatinine (33). Although they had a certain upregulation in animal models, but the rise may be delayed for up to 48 h after the onset of AKI in clinic (34). The short-term spike of cellular lipid peroxyl radicals appears to suggest that ferroptosis occurs at the early stage of AKI in our study. This implied that MDA as a potential biomarker at the early detection of AKI may be worthy evaluated. On the other hand, the current strategies fail to relieve the extent of acute renal injury may be caused by the little knowledge on cellular and molecular mechanisms of AKI. We propose that the risk of ferroptosis increased when iron accumulated simultaneously in kidney. An abnormal increase in Fe2+ triggers a Fenton’s reaction which led to oxidization of membrane lipids to lipid peroxides and plays an essential role in ferroptosis (20). Labile iron induced a robust increase in molecular markers of ferroptosis Ptgs2 and Acls4. It should be important to further confirmation whether labile iron-induced ferroptosis is a major contributor to striated RM-induced AKI, but it seems no doubt that the iron chelator is very promising treatment.
Iron-chelation process has been shown to reduce organic injury, however, a large quantities iron chelators will produce the opposite effect even leading to multiple-organ failure (35, 36). Some studies attempt to improve the bioavailability and efficacy of DFP via its formulation in a nanoform or liquid formulation, in order to get an equipotent effect using lower DFP dose in therapy (18, 37). We also emphasize iron chelation significance in alleviating tissue damage, but we also reasoned a more effective and less toxic iron chelation should be developed. We designed a new effective iron chelator AKI-02 in this study, next, AKI-02 as a lead compound will be devised for kidney-targeted drug delivery. With understanding of development of molecular pharmacology and kidney structure (38), renal targeting strategies have been developed to improve the kidney diseases clinical treatment (39, 40). For example, iron chelation conjugated drug can be designed targeting kidney-specific receptors or some endogenous enzymes such as amino acid l-decarboxylation and γ-glutamyltranspeptidase, then drugs released in proximal tubular cells through action of the relevant enzyme (41). Sugar-modified prodrugs has also be realized, such as a potential vector for renal drug targeting may be 2-glucosamine (42). We further look forward to the better targeted treatment of renal injury with AKI-02 conjugated drugs.
The kidney is uniquely susceptible to toxic injury. Although we focus on RM-induced AKI, a number of AKI patient suffered from therapeutic agents-induced nephrotoxic, classic examples including toxic effects of therapeutic agents, antiviral agents, cis-platinum, angiotensin-converting enzyme (43). It is necessary to further verify the effect of AKI-02 on these types of kidney injury. In summary, the iron is a key molecule in the pathogenesis of ferroptosis and to target iron deposition should contribute to the development of therapeutics to control iron overload ferroptosis-related kidney diseases.
4.1 Animals and experimental protocol
The C57BL/6 mice were purchased from Shanghai model organisms (Shanghai, China). These mice were fed under SPF-condition in Zhejiang University Center of Drug Safety Evaluation and Research. The mouse studies experimental procedures were approved by IACUC (IACUC-s21-013) of Zhejiang University.
To induce RM-AKI by glycerol, the mice were divided into two groups: glycerol (10 mL/kg, 50%, im) group (n = 9) and vehicle group (n = 3). Deprived of water for 16 h, the mice were injected glycerol to manufacture the incidence of AKI model. Glycerol was injected into both hind limbs of each mouse. Each three mice were sacrificed at three time points 6 h, 12 h and 24 h after glycerol injection, and three mice in the vehicle group were sacrificed at 24 h. We collected the kidney tissues and serum of the mice. To investigate CN128 protective effect in AKI, mice were divided into three groups randomly i) vehicle group; ii) glycerol group; and iii) glycerol + CN128 (50 mg/kg) group. CN128 were intraperitoneally (i.p.) every 12 h for 5 times of the experiment, glycerol administration one hour after the sixth time injection. Same drug evaluation method in AKI-02: mice were respectively divided into four groups (vehicle group, glycerol group, glycerol + 50 mg/kg DFP group, glycerol + 12.5 mg/kg or 25 mg/kg AKI-02 group) with five mice in each group. Mice were sacrificed 24 h as described above.
4.2 Cell culture
The HK-2 cell line were purchased from the Shanghai Institute of Biochemistry and Cell Biology (Shanghai, China). Cell culture was used RPMI-1640 medium (SH30809, HyClone) with 10% fetal bovine serum (SV30160, HyClone). And the cell maintained at 37°C, 5% CO2 humidified atmospher. Cell line HK-2 was authenticated by STR profiling.
4.3 Growth inhibition assay
Using the sulforhodamine B (SRB, #S1402, Sigma-Aldrich, St. Louis, MO, USA) measured cell growth inhibition. The monolayers of cell were fixed with 10% (wt/vol) trichloroacetic acid (TCA) for 30 min, then washed repeatedly with 1% (vol/vol) acetic acid. The protein binding dye was dissolved in 10 mM Tris base solution and determined for the OD value at 510 nm using Multiskan Spectrum (Thermo).
4.4 Assessment of kidney function
Kidney function was assessed by BUN and serum creatinine. The serum samples were collected at 24 h after administration, and the BUN and serum creatinine were quantified via Roche automatic biochemical analyzer (COBASC 311).
4.5 Renal tissue H&E staining
Renal tissues were collected and fixed with 4% PFA, followed cut into 5 µm thickness sections. 1) Hematoxylin-eosin (H&E) staining (C0105S, Beyotime, China). 2) Prussian blue staining was dyed with freshly prepared 10% potassium ferrocyanide and 20% hydrochloric acid. The histopathological changes of the renal tissue were observed and photographed using light microscope.
4.6 Determination of renal malondialdehyde
The renal tissue supernatant MDA was measured by Malondialdehyde assay kit (A003-1-2, Nanjing Jiancheng Bioengineering Institute, Hangzhou, China). MDA reacted with thiobarbituric acid to form a red-pink color compound. The compond absorbance was measured at 532 nm with the microplate reader and the result was presented as µmol MDA/mg protein.
4.7 RT-PCR analysis
Total RNA in renal tissue samples was extracted using TRIzol Reagent. The mRNA expression level of Gpx4, Nrf2, Ptgs2 and Acls4 was measured by RT-PCR.
Actin forward, ACTGCCGCATCCTCTTCCT and reverse, TCAACGTCACACTTCATGATGGA;
Gpx4 forward, CTTATCCAGGCAGACCATGTGC and reverse, CCTCTGCTGCAAGAGCCTCCC;
Nrf2 forward, AAAATCATTAACCTCCCTGTTGAT and reverse, CGGCGACTTTATTCTTACCTCTC;
Ptgs2 forward, TGCCTGGTCTGATGATGTATG and reverse, GGGGTGCCAGTGATAGAGTG;
Acls4 forward, CCACACTTATGGCCGCTGTT and reverse, GGGCGTCATAGCCTTTCTTG;
Actinb forward, ACTGCCGCATCCTCTTCCT and reverse, TCAACGTCACACTTCATGATGGA.
4.8 Measure of tissue non-heme iron
We used chromogen method determine kidney non-heme iron levels (44). The tissue from each groups were collected and digested in 10% trichloroacetic acid in 3M HCl for 70 h at 60 oC. The results were expressed in iron per gram micrograms of wet tissue weight.
4.9 ICP-MS detection
The kidney total element iron was measured using inductively coupled plasma mass spectrometry (ICP-MS) (45). Kidneys from each groups were collected, weighted and lyophilized. Then kidneys were digested in nitric acid (65%, w/w, AR grade) for 2 h at 110 oC. The results are expressed in iron per milligram micrograms of dry tissue weight.
4.10 Lipid peroxidation assay
i) In the six-well plates, 1 × 105 cells per well were seeded prior to the experiment. Cells were treated with the ferroptosis inducers for 14h the next day and incubated with Liperfluo (DojinDo, L248, Kumamoto, Japanese) 2 μM for 1 h at 37°C. Subsequently, cells were resuspended in PBS strained and analyzed by CytoFLEX LX flow cytometer (Beckman Coulter) and FACSCanto™ flow cytometer with FACSDiva 6.1.3 software (BD Biosciences). Cell Data was performed using the Flowjo program (Verify Software House, Topsham, ME).
ii) 1 × 105 cells in 6-well dishes were treated with the ferroptosis inducers for 12h, then harvested by trypsinization, re-suspended in PBS containing 2 μM C11 BODIPY (#D3861, Invitrogen, Carlsbad, CA, USA), and cells incubated at 37 °C for 30 min. The cells were re-suspended in PBS and analyzed using a flow cytometer as mentioned above.
4.11 Statistical analysis
Statistical analyses were performed by Prism 6 (GraphPad Software). Statistical comparisons among groups were calculated by one-way ANOVA, and t-test. P < 0.05 was considered significant.
Acknowledgements
This work was supported by grants from Zhejiang Provincial Fundamental Public Welfare Research Program (No. LGF22H310006 to Yuanmei Wen), Zhejiang Provincial Natural Science Foundation (No. LR22H310002 to Ji Cao and No. LY20H300001 to Yongping Yu).
Author Contributions
Wenteng Chen, Ji Cao, Haiying Zhu and Jie Cen designed the research. Wenteng Chen, Ji Cao, Haiying Zhu and Jie Cen wrote the manuscript, Jie Cen and Haiyang Wang performed the chemical synthesis studies, Haiying Zhu, Chenggang Hong, and Yuanmei Wen performed the biochemical, cellular and animal studies, Haiying Zhu, Jie Cen, Chenggang Hong, Haiyang Wang and Yuanmei Wen analyzed the results, Wenteng Chen, Ji Cao, Qiaojun He and Yongping Yu supervised the study.
Competing Interests
The authors declare no competing interests.
- Yang L. Acute Kidney Injury in Asia. Kidney Dis (Basel) 2, 95–102 (2016)
- Susantitaphong P, Cruz DN, Cerda J, Abulfaraj M, Alqahtani F, Koulouridis I, et al. World incidence of AKI: a meta-analysis. Clin J Am Soc Nephrol 8,1482–93 (2013)
- Basile DP, Anderson MD, Sutton TA. Pathophysiology of acute kidney injury. Compr Physiol 2,1303–53 (2012)
- Stahl K, Rastelli E, Schoser B. A systematic review on the definition of rhabdomyolysis. J Neurol 267, 877–82 (2020)
- Sever MS. Rhabdomyolysis. Acta Clin Belg. 2007;62 Suppl 2, 375-9 (2007)
- Bosch X, Poch E, Grau JM. Rhabdomyolysis and acute kidney injury. N Engl J Med 361, 62–72 (2009)
- Gupta A, Thorson P, Penmatsa KR, Gupta P. Rhabdomyolysis: Revisited. Rhabdomyolysis: Revisited 90, 61–9 (2021)
- Scherer JS, Qian Y, Rau ME, Soomro QH, Sullivan R, Linton J, et al. Utilization of Palliative Care for Patients with COVID-19 and Acute Kidney Injury during a COVID-19 Surge. Clin J Am Soc Nephrol 17, 342–9 (2022)
- Zijlstra JG, van Meurs M, Moser J. Post-Mortem Diagnostics in COVID-19 AKI, More Often but Timely. J Am Soc Nephrol 32, 255 (2021)
- Singbartl K, Kellum JA. AKI in the ICU: definition, epidemiology, risk stratification, and outcomes. Kidney Int 81, 819–25 (2012)
- Santos WJQ, Zanetta DMT, Pires AC, Lobo SMA, Lima EQ, Burdmann EA. Patients with ischaemic, mixed and nephrotoxic acute tubular necrosis in the intensive care unit – a homogeneous population? Crit Care 10, R68 (2006)
- Li L, Pei H, Liu Z, Zhang J. Analysis of risk factors and construction of prediction model of drop out from peritoneal dialysis. Medicine 100, e24195 (2021)
- Dąbrowska-Bender M, Dykowska G, Żuk W, Milewska M, Staniszewska A. The impact on quality of life of dialysis patients with renal insufficiency. Patient Prefer Adherence 12, 577–83 (2018)
- Zager RA. Rhabdomyolysis and myohemoglobinuric acute renal failure. Kidney Int 49, 314 – 26 (1996)
- Knochel JP. Mechanisms of rhabdomyolysis. Curr Opin Rheumatol 5, 725–31.
- Reeder BJ, Svistunenko DA, Cooper CE, Wilson MT. The radical and redox chemistry of myoglobin and hemoglobin: from in vitro studies to human pathology. Antioxid Redox Signal 6, 954–66 (2004)
- Hu Z, Zhang H, Yang SK, Wu X, He D, Cao K, et al. Emerging Role of Ferroptosis in Acute Kidney Injury. Oxid Med Cell Longev 2019, 8010614 (2019)
- Rashed RR, Deghiedy NM, El-Hazek RM, El-Sabbagh WA, Rashed ER, El-Ghazaly MA. Effectiveness of deferiprone-loaded nanocarrier in experimentally induced rhabdomyolysis: A dose-comparison study. Bioorg Chem 100, 103913 (2020)
- Shepherd G. Deferoxamine*. In: Wexler P, editor. Encyclopedia of Toxicology (Second Edition). New York: Elsevier; 2005. p. 731–3.
- Dixon SJ, Lemberg KM, Lamprecht MR, Skouta R, Zaitsev EM, Gleason CE, et al. Ferroptosis: an iron-dependent form of nonapoptotic cell death. Cell 149, 1060–72 (2012)
- Viswanathan VS, Ryan MJ, Dhruv HD, Gill S, Eichhoff OM, Seashore-Ludlow B, et al. Dependency of a therapy-resistant state of cancer cells on a lipid peroxidase pathway. Nature 547, 453–7 (2017)
- Li Y, Feng D, Wang Z, Zhao Y, Sun R, Tian D, et al. Ischemia-induced ACSL4 activation contributes to ferroptosis-mediated tissue injury in intestinal ischemia/reperfusion. Cell Death Differ 26, 2284–99 (2019)
- Singh AP, Junemann A, Muthuraman A, Jaggi AS, Singh N, Grover K, et al. Animal models of acute renal failure. Pharmacol Rep: PR 64, 31–44 (2012)
- Esterbauer H, Eckl P, Ortner A. Possible mutagens derived from lipids and lipid precursors. Mutat Res 238, 223–33 (1990)
- Tang D, Chen X, Kang R, Kroemer G. Ferroptosis: molecular mechanisms and health implications. Cell Res 31, 107–25 (2021)
- Chen X, Comish PB, Tang D, Kang R. Characteristics and Biomarkers of Ferroptosis. Front Cell Dev Biol 9, 637162 (2021)
- Chen W, Yuan X, Li Z, Lu Z, Kong S, Jiang H, et al. CN128: A New Orally Active Hydroxypyridinone Iron Chelator. J Med Chem 63, 4215–26 (2020)
- Kang H, Han M, Xue J, Baek Y, Chang J, Hu S, et al. Renal clearable nanochelators for iron overload therapy. Nat Commun 10, 5134 (2019)
- Bergeron RJ, Wiegand J, McManis JS, Bharti N. Desferrithiocin: a search for clinically effective iron chelators. J Med Chem 57, 9259–91 (2014)
- Huang Y, Wang J, Jiang K, Chung EJ. Improving kidney targeting: The influence of nanoparticle physicochemical properties on kidney interactions. J Control Release 334, 127–37 (2021)
- Chen J, Lu MM, Liu B, Chen Z, Li QB, Tao LJ, et al. Synthesis and structure-activity relationship of 5-substituent-2(1H)-pyridone derivatives as anti-fibrosis agents. Bioorg Med Chem Lett 22, 2300–2 (2012)
- Xiong G, Wu Z, Yi J, Fu L, Yang Z, Hsieh C, et al. ADMETlab 2.0: an integrated online platform for accurate and comprehensive predictions of ADMET properties. Nucleic Acids Res 49, W5-w14 (2021)
- Waikar SS, Bonventre JV. Biomarkers for the diagnosis of acute kidney injury. Nephron Clin Pract 16, 557 – 64 (2007)
- Larmour KE, Maxwell AP. Early intervention can improve outcomes in acute kidney injury. Practitioner 259, 25 – 8, 3 (2015)
- Hirschberg R, Bennett W, Scheinman J, Coppo R, Ponticelli C. Acute kidney injury due to deferoxamine in a renal transplant patient. Nephrol Dial Transplant 23, 1061–4 (2008)
- Bird ST, Swain RS, Tian F, Okusanya OO, Waldron P, Khurana M, et al. Effects of deferasirox dose and decreasing serum ferritin concentrations on kidney function in paediatric patients: an analysis of clinical laboratory data from pooled clinical studies. Lancet Child Adolesc Health 3, 15–22 (2019)
- ElAlfy MS, Sari TT, Lee CL, Tricta F, El-Beshlawy A. The safety, tolerability, and efficacy of a liquid formulation of deferiprone in young children with transfusional iron overload. J Pediatr Hematol Oncol 32, 601–5 (2010)
- Agarwal A, Dong Z, Harris R, Murray P, Parikh SM, Rosner MH, et al. Cellular and Molecular Mechanisms of AKI. J Am Soc Nephrol 27, 1288–99 (2016)
- Zhou P, Sun X, Zhang Z. Kidney-targeted drug delivery systems. Acta Pharm Sin B 4, 37–42 (2014)
- Mishra AP, Chandra S, Tiwari R, Srivastava A, Tiwari G. Therapeutic Potential of Prodrugs Towards Targeted Drug Delivery. Open Med Chem J 12, 111–23 (2018)
- Wilk S, Mizoguchi H, Orlowski M. gamma-Glutamyl dopa: a kidney-specific dopamine precursor. J Pharmacol Exp Ther 206, 227 – 32 (1978)
- Lin Y, Sun X, Gong T, Zhang ZR. Synthesis and in vivo distribution of 2-deoxy-2-aminodiglucose–prednisolone conjugate (DPC). Chin Chem Lett 23, 557–60 (2012)
- Perazella MA. Pharmacology behind Common Drug Nephrotoxicities. Clin J Am Soc Nephrol 13, 1897 – 908 (2018)
- Zhang F, Tao Y, Zhang Z, Guo X, An P, Shen Y, et al. Metalloreductase Steap3 coordinates the regulation of iron homeostasis and inflammatory responses. Haematologica 97, 1826–35 (2012)
- Xin Y, Gao H, Wang J, Qiang Y, Imam MU, Li Y, et al. Manganese transporter Slc39a14 deficiency revealed its key role in maintaining manganese homeostasis in mice. Cell Discov 3, 17025 (2017)
(Not answered)
