CpG island status as an epigenetic alteration for NIS promoter in thyroid neoplasms; a cross- sectional study with a systematic review

doi:10.21203/rs.3.rs-1944653/v1

Download PDF

Research Article

CpG island status as an epigenetic alteration for NIS promoter in thyroid neoplasms; a cross- sectional study with a systematic review

https://doi.org/10.21203/rs.3.rs-1944653/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background

Gene silence via methylation of the CpG island is the most common epigenetic modification in cancer. Aberrant DNA methylation interferes with active transcription and is also significantly associated with poor tumor differentiation and prognosis. Given the highly significant role of NIS in thyroid cancer differentiation, this cross-sectional study aimed to investigate the DNA methylation pattern in seven CpG islands (CpG1-7 including + 846, +918, + 929, +947, + 953, +955, and + 963, respectively) of the NIS promoter in patients diagnosed with PTC, FTC, and MNG compared with the matched non-tumoral tissues.

Methods

Thyroid specimens from 64 patients met the eligibility criteria, consisting of 28 PTCs, 9 FTCs, and 27 benign MNG cases. The expression of NIS mRNA was tested by qRT-PCR. The bisulfite sequencing PCR technique was performed was performed to evaluate the promoter methylation pattern of the NIS gene. Sequencing results were received in chromatograph, FASTA, SEQ, and pdf formats and were analyzed using Chromas. The methylation percentage at each position and for each sample was calculated by mC/ (mC + C) formula for all examined CpGs; following that, the methylation percentage was also calculated at each CpG site.

Results

NIS mRNA levels decreased in tissue samples of patients with PTC (P = 0.04) and FTC (P = 0.03) compared to their matched non-tumoral tissues. The methylation of NIS promoter was not common in PTC samples, but it was frequent in FTC (P < 0.05). Significant differences were observed in the methylation levels in the 4th (+ 947), 6th (+ 955), and 7th (+ 963) CpGs sites in the forward strand of NIS promoter between FTC tumoral and MNG tissues (76.34 ± 3.12 vs 40.43 ± 8.42, P = 0.004, 69.63 ± 3.03 vs 23.29 ± 6.84, P = 0.001 and 50.33 ± 5.65 vs 24 ± 6.89, P = 0.030, respectively). There was no significant correlation between the expression and methylation status of NIS in PTC and FTC tumoral tissues.

Conclusion

Perturbation in NIS promoter’s methylation individually may have a potential utility in differentiating MNG and FTC tissues. The absence of a distinct methylation pattern implies the importance of other epigenetic processes, which may alter the production of NIS mRNA. In addition, according to the reversibility of DNA methylation, it is anticipated that the design of particular targeted demethylation medicines will lead to a novel cancer therapeutic strategy.

papillary thyroid cancer

follicular thyroid cancer

multinodular goiter

DNA methylation

CpG islands

epigenetics

sodium/iodide symporter

Thyroid cancers are the most common malignancies and represent approximately 95% of all endocrine tumors. The global incidence of thyroid cancer was estimated to be 586,000 cases in 2020, and nearly 43,646 patients were presumed to die from thyroid cancer [1]. Thyroid cancer comprises several subtypes with remarkably different biological characteristics. Among these subtypes, papillary and follicular thyroid cancers (PTC and FTC) are referred to as well-differentiated thyroid cancers (WDTCs), accounting for more than 90% of all thyroid malignancies [2]. WDTCs typically are well managed and represent a favorable prognosis; however, sometimes, patients progress toward poorly differentiated and more aggressive subtypes [3].

Nowadays, environmental factors, alongside genetic alterations, play a pivotal role in developing thyroid cancers [4, 5]. Ecological factors in regulating gene expression are known as epigenetic alterations [6–8]. Aberrant DNA methylation has been introduced as a major epigenetic event in tumorigenesis [9, 10]. Gene inactivation through hypermethylation of CpG islands located in promoter regions was described in many cancers, especially thyroid cancer, which correlated with progression and tumorigenesis [11].

Solute carrier family 5-member 5 (SLC5A5, also called NIS) gene is localized on chromosome 19 (19p13.11) and encodes an 80–90 kDa transmembrane glycoprotein that actively transports iodide from the bloodstream into the thyroid follicular cells [12, 13]. Indeed, thyroid-stimulating hormone (TSH) can regulate NIS protein activity. In this process, a Na+/K+-ATPase pump generates a sodium gradient, transporting two Na⁺ to an I⁻ as the first step in the thyroid hormones biosynthesis [14]. The role of NIS in thyroid cancer diagnosis and treatment is important since NIS primarily mediates radioactive iodine (RAI) accumulation. Accordingly, the reduced NIS mRNA levels and/or impairment in NIS plasma membrane trafficking are well-demonstrated factors showing poor prognosis in thyroid cancer [15]. However, the association between NIS and thyroid cancer is complex and poorly understood [13].

Traditionally, it has been argued that CpG islands exist within the promoter of the NIS gene. In this regard, several studies have demonstrated that this island is a methylation target, which could have a vital role in DNA methylation, causing the reduction of NIS mRNA expression in thyroid carcinomas [12, 16–20].

In molecular cancer medicine development history, epigenetics has been thought of as a critical factor. In essence, epigenetic alterations depend on different factors, including race, environmental changes, lifestyle, nutrition, and physical activity. As above-mentioned, there are several studies regarding NIS promoter’s methylation in thyroid cancers. However, no previous study has investigated changes in those factors in an Iranian population as epigenetic modifications are strongly linked with race. Therefore, according to the mentioned challenges, this study seeks to investigate the methylation degree of a large region of NIS promoter in a set of multinodular goiters (MNG) samples (as the benign samples), malignant thyroid tumors including PTC and FTC, and their surrounding non-tumor tissue samples to suggest a methylation region as a discriminatory biomarker for early diagnosis of thyroid nodules. In addition, a systematic review of the literature was completed to bring together studies regarding methylation of NIS gene promoters, to reach a general conclusion about the role of NIS promoter methylation in tumorigeneses, and to discuss with our results.

Tissue Samples: Patients who underwent surgical resection of thyroid tumor at Erfan and Atiyeh hospitals in Tehran, Iran, were selected from 2015 to 2016. An experienced pathologist reviewed all tissue samples and confirmed the PTC, FTC, and MNG subjects based on pathological evidence and clinical outcomes. The pathologist also separated the matched non-tumoral slices from tumoral samples. Overall, 64 patients met the eligibility criteria, consisting of 28 PTCs, 9 FTCs cases (tumoral tissues and the matched non-tumoral tissues from the same patients), and 27 benign cases (non-tumoral tissues from patients with MNG). Tissue samples were collected in RNase and DNase-free tubes, frozen in liquid nitrogen, and then stored at -80°C for further analysis.

Genomic DNA extraction: Genomic DNA was isolated according to the manufacturer’s instructions from the fresh frozen thyroid specimens using the FavorPrep Tissue Genomic DNA Extraction Mini Kit, USA. Then, DNA quality and quantity were determined using the NanoDrop 1000c (Thermo Scientific, USA), considering the 260/280 absorbance ratio.

Design of primers: Met-primer online Software was used to design primers for hot-start PCR. These primers were designed for the promoter region of NIS gene (Table. 1). In summary, 1000 nucleotides upstream of the start codon were selected from genome databases. Islands in the promoter were detected according to the specific inclusion criteria, including island size >100, GC percent >50.0, and obs/exp >0.6, CpG. Finally, we found seven CpG sites for NIS promoter (CpG1-7 including +846, +918, +929, +947, +953, +955, and +963, respectively) and investigated methylation status in these sites (Fig.1). In order to evaluate the expression of NIS gene, primers for qRT-PCR were designed using GeneRunner software (version 4.0) and checked in NCBI Primer Blast (Table. 1).

Bisulfite modification and quantitative methylation detection: According to the manufacturer's protocol, bisulfite conversion was performed using the EZ DNA Methylation-gold kit (Zymo Research, USA). The sodium bisulfite-treated genomic DNA was amplified by hot-start PCR with the TEMPase HotStar Master Mix kit (Amplicon, UK). The PCR conditions were as follows: initial step at 95°C for 3 min, followed by 35 cycles at 95°C for 30 sec, annealing at 55-60°C for 30 sec, elongation at 72°C for 30 sec, and the final elongation at 72°C for 3 min. Direct DNA sequencing was used to determine the methylation pattern. The primers and purified PCR products were transferred to Kowsar Biotech Company (KBC, Iran, Tehran), using the power read DNA sequencing service. Sequencing results were received in chromatograph, FASTA, SEQ, and pdf formats and were analyzed using Chromas version 2.6.5. The methylation percentage at each position and for each sample was calculated by mC/ (mC+C) formula for all examined CpGs; following that, the methylation percentage was also calculated at each CpG site.

Extraction of RNA and synthesis of cDNA: After histological control, total RNA was extracted from fresh snap-frozen tissue samples using the TRIzol reagent (Ambion, USA), according to the manufacturer’s instructions. Finally, total RNA was reverse transcribed with the cDNA synthesis kit (Bio Fact, USA) according to the manufacturer’s protocol in a SENSOQUEST, Germany thermocycler.

qRT‐PCR: To evaluate the NIS expression, quantitative reverse transcriptase real-time PCR (qRT-PCR) was performed using the Rotor-Gene 6000 (Corbett Research, Sydney, Australia). All experiments were performed duplicate for each sample in a total volume of 25µl using the SYBR Green master mix (Bio Fact, Korea).

Statistical analysis: Graph Pad Prism 8.0.1 and SPSS version 20 was used for statistical analyses. Kolmogorov-Smirnov-Test was employed to test the normal distribution of the data. Non-normally distributed variables were analyzed with the Wilcoxon rank test to assess paired comparisons and Mann–Whitney U test for unpaired comparisons. Methylation results are presented with mean and standard error measurements of the mean. The mRNA expression results are expressed with Median and interquartile (25th, 75th percentiles). For all comparisons, p-values <0.05 were considered statistically significant. Relative quantitation of mRNA levels of NIS was performed by the comparative Ct method using the 2^−ΔΔCT method [21]. The relationship between the expression and total methylation of NIS in tumoral tissues of PTC and FTC patients was examined by calculating Pearson correlation coefficients.

Systematic literature search

The current systematic review was designed according to the latest version of the PRISMA checklist for systematic review [22]. A literature search by using the terms including “Thyroid Neoplasm” OR "Thyroid Carcinoma" OR "Thyroid Cancer" AND "DNA Methylations” OR “hypermethylation" OR "CpG Island" AND “sodium iodide symporter” OR "SLC5A5” was conducted in PubMed/MEDLINE, Web of Science, and Scopus databases. The search was performed without restricting publication date. Only articles in English were evaluated. The search results were managed by EndNote version X7. Titles and abstracts were reviewed, and relevant studies were selected. Inclusion criteria were as follows: The study indicated methylation of the NIS gene promoter in differentiated thyroid cancer (PTC and FTC). Then the full-text versions of selected articles were retrieved. The unrelated studies, reviews, meta-analysis, whole-genome, and wide genome studies were excluded. However, the references of related reviews were checked to identify additional papers. The following characteristics were collected from included studies: authors, year of publication, sample size groups, methodology, methylation status, and potential clinical values.

Demographic and clinicopathological characteristics

The mean±SD of age in PTC, FTC, and MNG groups were 37.89±12.17, 55±18.15, and 48.67±14.75 years, respectively (P=0.001). The Mean±SD of tumor size were 1.62±0.96 and 3.26±1.68 cm in PTC and FTC groups, respectively (P=0.002). Blood vascular invasion and TNM stages were significantly different between PTC and FTC groups (P=0.007 and P=0.001, respectively). However, there was no significant difference in the extracapsular invasion, extrathyroidal extension, and lymph node metastasis between PTC and FTC patients (P=0.057, P=0.068, and P=0.407, respectively). The demographic and clinicopathological characteristics of patients are shown in Table 2.

Analysis of NIS mRNA expression and its promoter methylation in PTC patients

The results showed that the NIS mRNA level was significantly reduced in PTC tumoral tissues compared to their matched non-tumoral tissues (0.45 vs 1.49, respectively, P=0.04, Fig.2a). There were no significant changes in the expression of NIS mRNA levels between PTC patients and MNG participants (0.84 vs 2.00, P=0.76, Fig.2b). The findings demonstrated no significant differences between total methylation status in PTC and the matched non-tumoral tissues (31.71±4.54 vs 24.25±4.39, P=0.10, Fig.2c). We also performed the analysis in each CpG site, and the differences were not significant in none of the CpG sites (Fig.2d). In addition, no significant differences were observed in total methylation status (31.69±4.56 vs 30.41±4.24, P=0.61, Fig.2e), and none of the CpG sites between PTC and MNG tissues (Fig. 2f).

Analysis of NIS mRNA expression and its promoter methylation in FTC patients

The NIS expression level was significantly reduced in FTC tumoral tissues compared to the matched non-tumoral tissues (0.53 vs 1.11, P=0.03, Fig.3a). There were marginally differences in the expression of NIS mRNA levels between FTC patients and MNG participants (0.69 vs 2.42, P=0.07, Fig.3b). Total methylation degree was substantially increased in FTC compared to the matched non-tumoral tissues (50.6±2.67 vs 35.06±6.83, P=0.03, Fig.3c). The methylation levels in FTC tumoral and the matched non-tumoral were found to be 69.63 ±3.03 vs 43.92 ±8.63 for the 6^th(-955) CpG site (P=0.03) and 50.33±5.65 vs 27.21±7.68 for 7^th(-963)CpG site (P=0.02) (Fig.3d). However, total methylation levels of FTC tumoral tissues were considerably higher than MNG tissues (50.6±2.68 vs 30.41±4.24, P=0.005, Fig.3e). Further, significant differences were observed in the methylation levels in the 4^th (-947), 6^th (-955), and 7^th (-963) CpGs sites in the forward strand of NIS promoter between FTC tumoral and MNG tissues (76.34±3.12 vs 40.43±8.42, P=0.004, 69.63±3.03 vs 23.29±6.84, P=0.001 and 50.33±5.65 vs 24±6.89, P=0.030, respectively, Fig.3f).

Correlation between mRNA expression and total methylation

There was no significant correlation between NIS mRNA expression and methylation status in PTC (R²=0.23, p=0.229), while a marginal significant correlation was observed in FTC (R²=0.27, p=0.092).

Systematic literature results

The literature search revealed 374 papers. After removing duplicates, 360 have remained. 348 studies were excluded based on inclusion criteria in the screening process, and the remaining related articles were selected to review the full-text paper. Finally, 9 studies met the eligibility criteria and were chosen to evaluate promoter methylation of differentiated thyroid cancer for NIS gene (Fig. 5)

Thyroid cancers are the most common endocrine malignancies, which comprise several subtypes; among them, PTC and FTC are referred to WDTCs, accounting for more than 90% of all thyroid malignancies [23]. It is well accepted that increased methylation may induce dedifferentiation and decrease the expression of thyroid tissue-specific genes. DNA methylations are heritable and reversible; it is speculated that target therapy may alter methylation status of these genes to achieve the goal of tumor treatment. In this regard, the present study was designed to determine the methylation status of NIS in thyroid nodules.

NIS is a transmembrane glycoprotein mainly regulated by the TSH that mediates the active transport of iodide from the bloodstream into the follicular thyroid cells [24]. The CpG islands in the NIS gene promoter have been suggested as a methylation target in reducing gene expression [25]. The results of this study did not show significant differences in the methylation level of NIS promoter in PTC tissues compared to the corresponding non-tumoral tissues in none of the CpG sites. However, the NIS mRNA level in tumoral tissues significantly decreased compared to the matched none-tumoral tissues. In addition, NIS promoter methylation level in PTC groups had no significant differences compared to its methylation level in MNG groups; also, no significant differences between these two groups regarding NIS mRNA expression were found. In prior studies, reduced expression of NIS mRNA has been shown in malignant thyroid tissues [12, 14, 26, 27], and these changes have been related to the increased promoter methylation. Our systematic search achieved 9 studies that explored NIS gene promoter methylation status in normal thyroid tissue and benign and malignant thyroid tumors. Some studies emphasize an increase in NIS promoter methylation in malignant tissues, while others showed controversial results. In a study by Neuman et al. [28] (2004), a 42.8% (6/14) incidence of NIS methylation was found in cold nodule thyroid patients relative to non-methylation in their non-tumoral surrounding tissues. In another study conducted by Smith et al. (2007) [26], increased methylation of NIS in 22% (7/13) of patients with PTC and 0% of the control group, including follicular adenomas, goiters, and normal cases were observed. However, the author pointed out that the limited number of the study groups led to not concluding predictive value from the comparison. A pilot study by Stephen et al. in 2011 [27] showed NIS promoter was methylated in (7/13) of DTCs, (1/3) of hyperthyroid, and (1/5) of normal cases and suggested that aberrant methylation of NIS may be an early change in thyroid tumorigenesis. In 2012, Brait et al. [29] showed that PTC tumor tissues had overlapping frequencies of methylation for NIS with benign and normal thyroid samples (86% tumors vs. 86% benign vs. 100% normal). By applying semi-quantitative MSP, Galaro et al. (2013) [12] found a similar degree of methylation in PTC tumoral tissues (benign = 2.19 ± 0.50 AU, malignant = 1.92 ± 0.59 AU) and non-tumoral tissues (benign = 2.23 ± 0.58 AU, malignant = 2.20 ± 0.82 AU) and suggested that NIS promoter methylation is a common occurrence in benign and malignant tumors as well as in the surrounding tissues. Later, Galaro et al. in 2014 [16] found a novel distal enhancer regulating the mRNA expression of NIS through DNA methylation, then by using quantitative BS-sequencing, indicating that the methylation degree of 66.1% in tumoral tissues (benign, 64.3%, and malignant, 69.6%), compared to 23.2% of none tumoral tissues (benign, 20.5%; malignant, 25.1%). At the same year, Choi et al. [30], found more frequent NIS methylation in PTC tissues of patients harbouring B-rafV600E (normal 29% vs cancer 58%). Both the number of studies on this subject and the sample size were limited and the studies showed various degrees of NIS gene promoter methylation. The utilization of different techniques, study groups, and CpG island regions may have led to inconsistent results. Nonetheless, the present findings seem to be consistent with Smith et al. 2007 [26], Galaro et al. 2013 [12], Brait et al. 2012 [29], and Stephen et al. 2018 [31] findings, which found no significant differential methylation of NIS promoter in PTCs tumors.

According to our study, promoter methylation of the NIS gene is not a common event in PTC tumors, their matched non-tumor, and MNG tissues; consequently, promoter methylation of NIS gene could not be a possible mechanism leading to reducing its expression. Maybe other regulatory mechanisms that affect this gene’s expression during neoplastic transformations are involved. However, there are many other CpG sites in the NIS gene promoter and the lack of methylation difference in this region cannot be generalized to the overall percentage of promoter methylation. In fact, the study of methylation of all CpG promoter sites of this gene will provide valuable information.

According to our results, the methylation levels of the NIS promoter were significantly higher in FTC tissues compared to the matched non-tumoral. These findings were consistent with the hyper-methylation of 3th, 6^th, and 7th CpG positions of a forward strand of the NIS promoter. In the contrary, mRNA expression was reduced significantly in tumoral tissues. Further, we found highly significant results with over 20% differences in methylation levels between tumoral and MNG tissues. According to our literature review, only two studies has investigated the methylation status of NIS gene in FTC tumoral tissues compared to matched-tumoral and benign tissues. Stephen et al. in 2018 [31] found significant differences in methylation levels of NIS promoter between FTC and normal thyroid groups. These findings imply that the NIS promoter hyper-methylation may result in a reduction of its expression in FTC. Furthermore, in 2015, Stephen et al. [32] investigated the promoter methylation status of NIS gene related to thyroid cancers in a cohort of FTC compared to 26 Hurthle and 27 classic subtypes using the qMSP method. NIS gene was methylated (qMSP values > 0.0), but the methylation degrees were not statistically significant between different subtypes. However, contrary to Stephen's findings [32], we showed a significant increase in the NIS promoter methylation degrees in FTC samples than in their matched non-tumoral and MNG samples.

The strengths of the present study include this being the first study that determined the promoter methylation status in the selected region of NIS, a functional gene, in an Iranian population diagnosed with thyroid nodules. In order to obtain reliable results, and to avoid false-positive results from non-quantitative methods such as MSP, we evaluated NIS promoter methylation with a quantitative methodology. However, as for limitations for this cross-sectional study, we had a small sample size and a lack of available clinicopathological information. Time and budget constraints limited us to examine more CpG sites of this gene. Therefore, further investigations including other sites that may be concerned in epigenetic regulation of NIS expression.

The present study provides additional evidence with respect to NIS promoter methylation in thyroid nodules. Although we could not find significant differences regarding NIS methylation in PTC patients, but the NIS mRNA expression was substantially decreased in PTC cases, which were correlated with lymph node metastasis. Overall, these differences in aberrantly methylated CpGs between PTC and FTC reflect a potentially interesting finding and provide the following insights for future research. Intriguing results were found for PTC cases about the methylation pattern of the sodium-iodide symporter in CpGs islands. Nevertheless, there was no statistically significant difference between tumoral and benign for PTC cases. One hypothesis that warrants further review is that promoter regions are methylated more frequently in FTC than in PTC in our study. This hypothesis cannot be confirmed with our modest number of cases, but it does raise questions that can be investigated further. However, there were several limitations to this analysis, including the influence of the small sample size in cases and the non-achievable clinicopathological information. According to the limited number of studies, more clinical research with larger sample size is required to elucidate the role of epigenetic mechanisms in the progression of thyroid nodules, leading to finding novel diagnostic biomarkers and improving the effectiveness of therapies.

There are no distinct patterns of methylation linked with transcriptional failure. This shows that thyroid nodule methylation is heterogeneous. The absence of a distinct methylation pattern also implies the importance of other epigenetic processes, which may alter the production of NIS mRNA. We underlined the need for additional research to understand the epigenetic mechanisms underlying the reduction of NIS mRNA expression, which could lead to the development of novel treatments to enhance radioiodine uptake in thyroid carcinoma cells. These investigations can also contribute to a greater comprehension of the mechanisms through which epigenetic events influence gene expression. These findings would be supported by additional confirmation in larger cohorts involving other sites that may be implicated in methylation regulation of NIS expression are warranted which would validate their role as early markers of thyroid cancer. Additionally, it is anticipated that the design of particular targeted demethylation medicines, which may play a role in redifferentiation of thyroid carcinomas, will lead to a novel cancer therapeutic strategy.

Funding: This paper received no specific funding from a private or public institution.

Conflicts of interest/Competing interests: The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Availability of data and material: The datasets used during the current study available from the corresponding author on reasonable request.

Code availability: Non-applicable

Authors' contributions: MH, MZ participated in the study design. NA, SSH and SAF participated in the data collection. MSJ and SSH performed the statistical analysis. MZ, ZN and NA participated in the manuscript writing. RA, SHH and MH critically revised the manuscript. All authors contributed to the data analysis, drafting or revising the article, and approved the final version.

Ethics approval: This study was approved by the Ethics Committee of the Research Institute of Endocrine Sciences of the Shahid Beheshti University of Medical Sciences (IR.SBMU.ENDOCRINE.REC.1395.216), and we conducted the current study in accordance with the Declaration of Helsinki and RIES institutional guidelines

Consent to participate: Written informed consent was obtained from all patients.

Consent for publication: Non-applicable

Zhu Y, Song Y, Xu G, Fan Z, Ren W. Causes of misdiagnoses by thyroid fine-needle aspiration cytology (FNAC): our experience and a systematic review. Diagnostic Pathology. 2020;15(1):1.
Cooper DS, Doherty GM, Haugen BR, Kloos RT, Lee SL, Mandel SJ, et al. Revised American Thyroid Association management guidelines for patients with thyroid nodules and differentiated thyroid cancer: the American Thyroid Association (ATA) guidelines taskforce on thyroid nodules and differentiated thyroid cancer. Thyroid. 2009;19(11):1167-214.
Hannallah J, Rose J, Guerrero MA. Comprehensive literature review: recent advances in diagnosing and managing patients with poorly differentiated thyroid carcinoma. Int J Endocrinol. 2013;2013:317487-.
Anand P, Kunnumakara AB, Sundaram C, Harikumar KB, Tharakan ST, Lai OS, et al. Cancer is a Preventable Disease that Requires Major Lifestyle Changes. Pharmaceutical Research. 2008;25(9):2097-116.
Nozhat Z, Hedayati M. PI3K/AKT pathway and its mediators in thyroid carcinomas. Molecular diagnosis & therapy. 2016;20(1):13-26.
Zarkesh M, Zadeh-Vakili A, Azizi F, Foroughi F, Akhavan MM, Hedayati M. Altered Epigenetic Mechanisms in Thyroid Cancer Subtypes. Molecular Diagnosis & Therapy. 2018;22(1):41-56.
Zarkesh M, Zadeh-Vakili A, Azizi F, Fanaei SA, Foroughi F, Hedayati M. The Association of BRAF V600E Mutation With Tissue Inhibitor of Metalloproteinase-3 Expression and Clinicopathological Features in Papillary Thyroid Cancer. International journal of endocrinology and metabolism. 2018;16(2):e56120-e.
Zarkesh M, Zadeh-Vakili A, Akbarzadeh M, Nozhat Z, Fanaei SA, Hedayati M, et al. BRAF V600E mutation and microRNAs are helpful in distinguishing papillary thyroid malignant lesions: Tissues and fine needle aspiration cytology cases. Life sciences. 2019;223:166-73.
Xing M. Gene Methylation in Thyroid Tumorigenesis. Endocrinology. 2007;148(3):948-53.
Herman JG. Epigenetic changes in cancer and preneoplasia. Cold Spring Harb Symp Quant Biol. 2005;70:329-33.
Sproul D, Kitchen RR, Nestor CE, Dixon JM, Sims AH, Harrison DJ, et al. Tissue of origin determines cancer-associated CpG island promoter hypermethylation patterns. Genome Biology. 2012;13(10):R84.
Galrao A, Sodré A, Camargo R, Friguglietti C, Kulcsar M, Lima E, et al. Methylation levels of sodium–iodide symporter (NIS) promoter in benign and malignant thyroid tumors with reduced NIS expression. Endocrine. 2013;43(1):225-9.
de Morais RM, Sobrinho AB, de Souza Silva CM, de Oliveira JR, da Silva ICR, de Toledo Nóbrega O. The role of the NIS (SLC5A5) gene in papillary thyroid cancer: a systematic review. Int J Endocrinol. 2018;2018.
Venkataraman GM, Yatin M, Marcinek R, Ain KB. Restoration of Iodide Uptake in Dedifferentiated Thyroid Carcinoma: Relationship to Human Na+/I− Symporter Gene Methylation Status1. The Journal of Clinical Endocrinology & Metabolism. 1999;84(7):2449-57.
De la Vieja A, Santisteban P. Role of iodide metabolism in physiology and cancer. Endocrine-related cancer. 2018;25(4):R225-R45.
Galrão AL, Camargo RY, Friguglietti CU, Moraes L, Cerutti JM, Serrano-Nascimento C, et al. Hypermethylation of a new distal sodium/iodide symporter (NIS) enhancer (NDE) is associated with reduced NIS expression in thyroid tumors. The Journal of Clinical Endocrinology & Metabolism. 2014;99(6):E944-E52.
Gaohong Z, Lijun X. Research Progress of DNA Methylation in Thyroid Cancer. DNA Methylation Mechanism. 2020.
Ishida E, Nakamura M, Shimada K, Higuchi T, Takatsu K, Yane K, et al. DNA hypermethylation status of multiple genes in papillary thyroid carcinomas. Pathobiology. 2007;74(6):344-52.
Morari EC, Marcello MA, Guilhen ACT, Cunha LL, Latuff P, Soares FA, et al. Use of sodium iodide symporter expression in differentiated thyroid carcinomas. Clinical endocrinology. 2011;75(2):247-54.
Wang S, Liang J, Lin Y, Yao R. Differential expression of the Na+/I‑symporter protein in thyroid cancer and adjacent normal and nodular goiter tissues. Oncology letters. 2012;5(1):368-72.
Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. methods. 2001;25(4):402-8.
Page MJ, McKenzie JE, Bossuyt PM, Boutron I, Hoffmann TC, Mulrow CD, et al. The PRISMA 2020 statement: an updated guideline for reporting systematic reviews. Systematic reviews. 2021;10(1):1-11.
Lloyd R, Osamura R, Kloppel G, Rosai J. WHO Classification of Tumours of Endocrine Organs: WHO Classification of Tumours. International Agency for Research on Cancer: Lyon, French; 2017.
Portulano C, Paroder-Belenitsky M, Carrasco N. The Na+/I- symporter (NIS): mechanism and medical impact. Endocr Rev. 2014;35(1):106-49.
Caillou B, Troalen Fdr, Baudin E, Talbot M, Filetti Sb, Schlumberger M, et al. Na+/I− symporter distribution in human thyroid tissues: an immunohistochemical study. The Journal of Clinical Endocrinology & Metabolism. 1998;83(11):4102-6.
Smith JA, Fan C-Y, Zou C, Bodenner D, Kokoska MS. Methylation status of genes in papillary thyroid carcinoma. Archives of otolaryngology–head & neck surgery. 2007;133(10):1006-11.
Stephen JK, Chitale D, Narra V, Chen KM, Sawhney R, Worsham MJ. DNA methylation in thyroid tumorigenesis. Cancers. 2011;3(2):1732-43.
Neumann S, Schuchardt K, Reske A, Reske A, Emmrich P, Paschke R. Lack of correlation for sodium iodide symporter mRNA and protein expression and analysis of sodium iodide symporter promoter methylation in benign cold thyroid nodules. Thyroid. 2004;14(2):99-111.
Brait M, Loyo M, Rosenbaum E, Ostrow KL, Markova A, Papagerakis S, et al. Correlation between BRAF mutation and promoter methylation of TIMP3, RARβ2 and RASSF1A in thyroid cancer. Epigenetics. 2012;7(7):710-9.
Choi YW, Kim H-J, Kim YH, Park SH, Chwae YJ, Lee J, et al. B-RafV600E inhibits sodium iodide symporter expression via regulation of DNA methyltransferase 1. Experimental & molecular medicine. 2014;46(11):e120-e.
Stephen J, Chen K-M, Merritt J, Chitale D, Divine G, Worsham MJ. Methylation markers differentiate thyroid cancer from benign nodules. Journal of endocrinological investigation. 2018;41(2):163-70.
Stephen JK, Chen KM, Merritt J, Chitale D, Divine G, Worsham MJ. Methylation markers for early detection and differentiation of follicular thyroid cancer subtypes. Cancer and clinical oncology. 2015;4(2):1.

Table 1. The information of methylation and qRT-PCR primers

Genes	Accession number	Sequence 5´→3´	Start	Tm (°C)	Product size (bp)	No. CpG
		Methylation primers
NIS	NG_012930.1	F:GTGATTAGGGGATTATAGTGTATGG	-775	57.13	210	7
NIS	NG_012930.1	R:TAAATTACAAATTTATTAAACTCCC	-988	52.69	210	7
		qRT-PCR primers
NIS	NM_000453.3	F:CCCAGACCAGTACATGCCTC	-	59.82	86	-
NIS	NM_000453.3	R:TGTAAGCACAGGCCAGGAA	-	58.85	86	-
Β-actin	NM_001101.5	F:GATCAAGATCATTGCTCCTCCT	-	57.65	108	-
Β-actin	NM_001101.5	R:TACTCCTGCTTGCTGATCCA	-	58.43	108	-

Tm: temperature

Table 2. Demographic and clinicopathological characteristics of patients

Parameters	PTC	FTC	MNG	Total
Patients number	28	9	27	64
Gender
Male	2 (7.1)	4 (50)	8 (29.6)	14 (22.2)
Female	26 (92.9)	4 (50)	19 (70.4)	49 (77.8)
Age (years)
<45	21 (75)	3 (37.5)	8 (29.6)	32 (50.8)
≥45	7 (25)	5 (62.5)	19 (70.4)	31 (49.2)
BRAF V600E mutation
Positive	12 (46.2)	2 (22.2)	-	-
Negative	14 (53.8)	7 (77.8)	-	-
Tumour size (cm)
<2	13 (46.4)	2 (25)	-	-
≥2	15 (53.6)	6 (75)	-	-
Extrathyroidal extension
Positive	4 (14.8)	3 (42.9)	-	-
Negative	23 (85.2)	4 (57.1)	-	-
Extracapsular invasion
Positive	4 (14.8)	3 (42.9)	-	-
Negative	23 (85.2)	4 (57.1)	-	-
Lymph node metastasis
Positive	8 (29.6)	1 (14.3)	-	-
Negative	19 (70.4)	6 (85.7)	-	-
Blood vascular invasion
Positive	4 (14.8)	2 (71.4)
Negative	23 (85.2)	5 (28.6)
TNM stage (AJCC)
I&II	23 (82.1)	4 (57.1)	-	-
III&IV	5 (17.9)	3 (42.9)	-	-

PTC: papillary thyroid cancer; FTC: follicular thyroid cancer; MNG: multinodular goiter; AJCC: American Joint Committee on Cancer

Table 3; Characteristic collected from included studies

Studies	Method	Studied groups	Methylation status			Potential Clinical Value
Studies	Method	Studied groups	NT	BTLs	DTC
Neuman et al. (2004)	MSP	NT (14), CTN (14)	0/14	6/14		–
Smith et al. (2007)	MSP	NT (2), NG (15), FA (10), PTC (30)	0	0	7/32	No prognostic factor
Stephen et al. (2011)	MSP	NT (5), NG (3), PTC (11), FTC (2)	1/5	1/3	7/13	Early event
Brait et al, (2012)	MSP	NT (8), BLTs (31), TC (32)	8/8	30/31	31/32	No significant difference
Galrão et al. (2013)	sq-MSP	NT (30), BTLs (10), PTC (18), FTC (2)	2.21	2.19	1.92	–
Galrão et al. (2014)	BS-sequencing	NT (30), BTLs (10), PTC (18), FTC (2)	23.2	64.3	69.6	Identifying new CpGs islands Correlation with expression
Choi et al. (2014)	MSP	NT (24), PTC (24)	7/24	–	14/24	Related to BRAF(V600E)
Stephen et al. (2015)	qMSP	HCTC (26), FTC (27)	–	–	>0	No differences between HCTC and FTC
Stephen et al, (2018)	qMSP	NT (68), FA (83), PTC (85), FTC (90)	0.001	0.014	PTC (0.009) FTC (0.02)	–

MSP, methyl-sensitive PCR; qMSP, quantitative MSP; BS-sequencing, Bisulfite sequencing

BTLs, benign thyroid lesions; FA, follicular adenoma; TC, thyroid cancer, FTC, follicular thyroid cancer; NG, nodular goiter; PTC, papillary thyroid cancer; DTC, differentiated thyroid cancer; HCTC, Hürthle cell thyroid carcinoma

Methylation status of gene promoter: MSP results (methylated/total samples), expressed as arbitrary unit (AU), BS sequencing results; as percent.

No competing interests reported.

Download PDF

Editorial decision: Major revision
31 Aug, 2022
Reviews received at journal
30 Aug, 2022
Reviewers agreed at journal
30 Aug, 2022
Reviewers invited by journal
30 Aug, 2022
Editor assigned by journal
10 Aug, 2022
Submission checks completed at journal
10 Aug, 2022
First submitted to journal
09 Aug, 2022

You are reading this latest preprint version

CpG island status as an epigenetic alteration for NIS promoter in thyroid neoplasms; a cross- sectional study with a systematic review

Status:

Version 1

Abstract

Background

Methods

Results

Conclusion

Figures

Introduction

Methods And Materials

Results

Discussion

Conclusion

Declarations

References

Tables

Additional Declarations

Status:

Version 1