Brazilian methicillin-resistant Staphylococcus aureus (MRSA) strains carrying a diversity of mupirocin-resistance plasmids

doi:10.21203/rs.3.rs-1954114/v1

Download PDF

Short Report

Brazilian methicillin-resistant Staphylococcus aureus (MRSA) strains carrying a diversity of mupirocin-resistance plasmids

https://doi.org/10.21203/rs.3.rs-1954114/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Methicillin-resistant Staphylococcus aureus (MRSA) are widespread causative agents of hard-to-treat infections in the nosocomial environment, with increasingly narrower treatment possibilities. Mupirocin is an antibiotic commonly used to promote nasal decolonization and prevent transmission of MRSA in hospitals. Resistance to high levels of mupirocin is emerging globally, being mainly conferred by the product of the mupA gene. In this study, we analyzed the levels of resistance to mupirocin, the presence of the mupA gene, the transmissibility and diversity of plasmids among Staphylococcus isolated from nosocomial infections. Five mupA-carrying and mupirocin-resistant MRSA strains were studied in terms of the plasmidial origin of mupA, which was confirmed by curing during heat stress, plasmid extraction and PCR. Resistance was associated with high-molecular weight plasmids, which were transferred by conjugation to methicillin-sensitive S. aureus, and then to a MRSA strain. The plasmids were shown to be diverse by analysis of the presence, orientation, and distance of the insertion sequence IS257 from the mupA gene, and by their restriction patterns. This study reinforces that, given the decline of possibilities to treat MRSA infections and the easy transfer of mupirocin-resistance plasmids among Staphylococcus, the use of this antibiotic must be carefully monitored.

mupirocin

plasmids

antimicrobial resistance

MRSA

Staphylococcus

horizontal gene transfer

Staphylococcus aureus is a major pathogen in the nosocomial environment, with a diverse virulence arsenal that grants it the capacity to cause a variety of diseases, ranging from skin infections, food poisoning and toxic shock syndrome, to bacteremia and endocarditis (Lee et al. 2018).

Since the introduction of antibiotic therapy, multi-drug resistant strains have arisen, becoming the greatest concern in the treatment of opportunistic infections in hospitals. Methicillin-resistant S. aureus (MRSA) are widespread, with staphylococcal infections ranging from 1–5% in Northern Europe to more than 50% in South America (Lee et al. 2018). Resistance is mediated by the mecA gene, acquired by horizontal gene transfer of the mobile genetic element staphylococcal cassette chromosome mec, SCCmec (Bitrus et al. 2018).

Because mecA encodes a penicillin-binding protein (PBP2a) with low affinity for beta-lactams, its presence confers resistance to this entire class of antimicrobials (Turner et al. 2019). Drugs used as alternatives to treat infections caused by MRSA include vancomycin, daptomycin and linezolid, but resistance to all of them has emerged (Liu et al. 2021).

To avoid spreading of MRSA strains in the hospital environment and the occurrence of new infections, the antibiotic mupirocin is often used as a choice for nasal decolonization of patients and healthcare personnel (Septimus and Schweizer 2016; Khoshnood et al. 2019). Mupirocin inhibits bacterial growth by binding to the bacterial isoleucyl-tRNA synthetase, encoded by the ileS gene, thus impeding translation. Resistance to this antibiotic is widespread and its global prevalence is extremely varied (Dadashi et al. 2020). Low-level mupirocin resistance (MIC of 8–64 µg/mL) occurs due to point mutations in ileS; high-level mupirocin resistance (MIC ≥ 512 µg/mL) is mediated by the mupA (or ileS2) gene, encoding an alternative Ile-tRNA synthetase that does not bind to the drug, or the less common and more recently discovered mupB gene, which has 65% similarity to mupA and 45% to ileS (Khoshnood et al. 2019). Clinical strains with MICs ≥ 128 µg/mL are uncommon. High-level mupirocin resistance conferred by mupA or mupB are usually encoded by plasmids larger than 25kb (Udo et al. 2001; Christine et al. 2012), but mupirocin resistance above 1024 µg/mL has been linked to chromosomal mupA before (Udo et al. 2003).

We have previously shown that high-level mupirocin resistance could be transferred by conjugative and mobilizable plasmids from Staphylococcus haemolyticus and Staphylococcus epidermidis to S. aureus, thus increasing its potential to resist drug therapy (Ferreira et al. 2011; Rossi et al. 2016, 2018). In this work, we analyzed the frequency of resistance to mupirocin, the presence of the mupA gene, the transmissibility and diversity of plasmids between S. aureus isolated from nosocomial infections.

Bacterial strains

This study was conducted with five MRSA nosocomial previously characterized as mupirocin-resistant, coming from to different clones and patients. They were selected from a collection of 191 coagulase-negative and coagulase-positive Staphylococcus spp. clinical strains, which included 47 MRSA and 20 mupirocin-resistant strains (but only five resistant to both), belonging to the bacterial collection of the Laboratório de Microbiologia Molecular (Universidade Federal do Rio de Janeiro), isolated in the past two decades from patients from three different hospitals in Southeastern Brazil.

Disc diffusion assay

Mupirocin-resistant strains were identified by disc diffusion with mupirocin discs (200 µg, Oxoid, Ireland), following the criteria preconized by the Clinical and Laboratory Standards Institute (CLSI 2021). Strains that showed no inhibition zones in Mueller Hinton agar were considered as resistant to high levels of the drug.

Detection of the mupA gene

The mupA gene was detected in the mupirocin-resistant strains by PCR. First, one colony from each strain was separately resuspended in 100 µL TE buffer and submitted to thermal lysis in a T100^TM Thermal cycler (BioRad, CA, USA) for 15 min at 100 °C. The suspension was centrifuged (9000 g, 30 s) and 10 µL of the supernatant were used as DNA template for the amplification of mupA. Amplification was performed in 50 µL reactions containing 1U of Taq DNA-polymerase (Gibco, MA, USA) in the provided buffer, 0.1 mM dNTPs and 50 pmol of the primers M1 (5’ GTTTATCTTCTGATGCTGAG 3’) and M2 (5’ CCCCAGTTACACCGATATAA 3’). Cycle parameters were the same indicated previously for the M1/M2 primers (Nunes et al. 1999). The S. aureus HU1A strain (Bastos et al. 1999) was used as a positive control. The 237 bp amplicon was detected after 1% agarose gel electrophoresis and staining with ethidium bromide (0.5 µg/mL).

Confirmation of plasmidial origin of mupirocin resistance

The plasmidial origin of mupirocin resistance was confirmed by inducing plasmid loss (curing) by growing the strains under temperature stress, as described before (Rossi et al. 2016). Briefly, strains were cultivated in brain heart infusion (BHI) at 43 ºC with gentle agitation. Every 24 h, an aliquot of the bacterial culture was transferred to a fresh medium (1:100 dilution), until the experiment completed 96 h. Then, bacterial cells were plated on BHI agar plates and cultivated for 24 h at 37 °C. The next day, each separate colony was transferred to BHI replica plates: one containing 256 µg/mL mupirocin and one with no antibiotic added. After another period of incubation for 24 h at 37 °C, colonies that were able to grow in the absence of mupirocin but not in its presence were considered to have been cured. Curing was confirmed by PCR to detect the mupA gene, as described above.

Analysis of antimicrobial susceptibility of the cured strains

The susceptibility of the mupirocin-cured and original strains was evaluated by disc diffusion with the following antibiotics (Oxoid): ampicillin (10 µg), cephalothin (30 µg), ciprofloxacin (5 µg), clindamycin (2 µg), chloramphenicol (30 µg), erythromycin (15 µg), gentamicin (10 µg), kanamycin (30 µg), mupirocin (200 µg), oxacillin (1 µg), tetracycline (30 µg) and sulfamethoxazole-trimethoprim (25 sulfamethoxazole-trimethoprim). Experiments were performed in triplicate, following the CLSI guidelines (CLSI 2021). The minimum inhibitory concentration (MIC) of mupirocin was also calculated with E-Test strips (AB Biodisk, Sweden), following the manufacturer’s instructions.

Bacterial conjugation of mupirocin resistance

The transmissibility of the detected plasmids was analyzed by conjugation experiments, performed on filter matings, as described by Projan and Archer (1989). Conjugation was done over 1 cm² nitrocellulose membranes, placed on BHI agar plates, on top of which 100 µL of a mixture of the mupirocin resistant donor and the recipient strains were dispensed (10⁸CFU each). S. aureus RN8411, which is resistant to novobiocin, rifampicin and tetracycline and devoid of plasmids (Projan and Archer 1989), was used as the recipient strain. After incubation for 24 h at 37 °C, the content on the nitrocellulose membranes was resuspended in 1 mL of PBS and aliquots of 100 µL were plated on selective agar plates containing mupirocin (150 µg/mL), novobiocin (10 µg/mL) and rifampicin (10 µg/mL). These plates were incubated for 24 h at 37 °C for growth of the transconjugants. Conjugation was confirmed by PCR to detect the mupA gene, as described above. A second round of conjugation was performed as above, using the transconjugants obtained as donors, and a mupirocin-sensitive derivative strain of S. aureus HU1A, as the recipient (Nunes et al. 1999). The transconjugants were then selected on BHI agar plates containing tetracycline (10 µg/mL) and mupirocin (150 µg/mL). The conjugation frequencies were calculated as the CFU/mL of the obtained transconjugants divided by the CFU/mL of the donor cells.

Plasmid extraction

Plasmids were extracted from 5 mL of donor and transconjugant strains after cultivating the microorganisms in BHI containing mupirocin (512 µg/mL). Extraction was performed following the protocol described by Giambiagi-deMarval et al. (1990). S. aureus HU1A (Nunes et al. 1999) and S. aureus RN7242 (Projan and Archer 1989) were used as positive controls and for plasmid size comparison, since both strains harbor high-molecular weight plasmids, of 35 kb (pMG1) and 52 kb (pGO1), respectively. Plasmids were observed after 0.8% agarose gel electrophoresis, followed by staining with ethidium bromide.

Analysis of plasmid diversity and mupA genetic environment

Plasmid diversity was assessed by analyzing the mupA flanking region and its vicinity for the presence of the insertion sequence IS257 by PCR, combining primers targeting this mobile genetic element,1234 (5’ GGCATGGCGAAAATCCGTAG 3’) and 1235 (5’ TGGCGTATTGATGAGACGTACATC 3’), and primers targeting the mupA gene, M1 (5’ GTTTATCTTCTGATGCTGAG 3’) and MupA_R (5’ CTCTAATTCAACTGGTAAGCC 3’), as suggested by Woodford et al.(Woodford et al. 1998). Amplicons were visualized in a 1.0% agarose gel stained with ethidium bromide. Additionally, the restriction profiles of the plasmids when digested with the enzymes EcoRI and HindIII were also analyzed. For this purpose, plasmid DNA was extracted as described before, separated by gel electrophoresis, purified from gel with Wizard® SV Gel and PCR Clean-Up System (Promega), following the manufacturer’s protocols, and digested for 24 h at 37 ºC, with the restriction enzymes, following the manufacturer’s guidelines (Gibco, ThermoFisher). The resulting DNA fragments were then separated by electrophoresis and subjected to Southern blotting, as suggested by Green and Sambrook (Green and Sambrook 2012). The digoxigenin-labeled probe was amplified with the primers M1/M2 (Table 1), using the PCR DIG Probe Synthesis kit (Roche, Germany), and hybridization was done under high stringency conditions using the DIG High Prime DNA Labeling and Detection Starter kit II (Roche), according to the manufacturer’s instructions. All these methods were performed using the plasmid DNA from the strain HU1A as a positive control.

Mupirocin-resistant strains

From a collection of 191 coagulase-negative and coagulase-positive Staphylococcus, which included 20 strains previously identified as resistant to mupirocin and 47 MRSA, we selected the ones that were both MRSA and resistant to mupirocin. This included five strains, identified as HU10A, HU10C, HU14A, UFU5 and UFU5P, all obtained from different patients. All strains were positive for the presence of the mupA gene and harbored at least one high-molecular weight plasmid, with strains HU10A and HU10C seemingly harboring two (Fig. 1A, left).

Plasmid curing

When subjected to temperature stress, upon cultivation for 96 h at 43 ºC, we were able to cure all strains of their resistance to mupirocin. Loss of the mupA gene was associated with the loss of plasmids, although strains HU10A and HU10C maintained one of their two high-molecular weight plasmids (Fig. 1A, right). The experiment was conducted with 300 to 500 colonies from each strain, and curing frequency ranged from 1.6% (strain HU14A) to 21.6% (strain HU10C). The MIC of the selected cured derivatives (MIC_mup) decreased significantly: while the original strains had MIC_mupof 512 to >1024 µg/mL, the MIC_mupof the cured derivatives ranged from <1 to 16 µg/mL (Table 1). In most cases, loss of mupirocin resistance occurred concomitantly with loss of resistance to other antimicrobials. The only exceptions were the H10C and UFU5P strains (Table 1).

Transfer of mupirocin resistance

Two conjugation experiments were performed: the first comprised the transfer of mupirocin resistance from the MRSA clinical strains used in this work to the recipient, plasmid-free RN8411 strain; the second involved the transfer of the plasmids acquired by the RN8411 transconjugants obtained to the clinical multidrug resistant HU1A strain, previously cured from its original mupirocin resistance. In this experiment, transconjugants were recovered in all attempts. Conjugation frequencies ranged from 6.5 ± 2.2 x 10^-8to 4.7 ± 2.3 x 10^-6 (Table 2). All transconjugants showed a significant increase in MIC_mup, regardless the round of conjugation from which they were obtained: while the original recipient strains had MIC_mupof <1 µg/mL (in RN8411) or 8 µg/mL (in HU10A Mup^S), the transconjugants had MIC_mup ranging from 256 to 2048 µg/mL (Table 2). All of them were confirmed to have received the mupA gene, by PCR (data not shown).

Mupirocin plasmids diversity

Plasmid diversity was assessed by the presence and orientation of IS257 in the vicinity of the mupA gene and restriction profile exhibited by the plasmids. All plasmids were positive for IS257 on both sides of mupA, with all strains displaying the insertion sequences in different numbers, orientations and distances (Fig. 1B). Strains such as HU10A, HU14A and UFU5P probably have two copies (or fragments) of IS257 mupA upstream in the two possible orientations (direct or inverted), since both primer combinations (1234 or 1235) with the oligonucleotide Mup_AR resulted in amplicons with sizes ranging from 1.0 kb to 1.6 kb. Likewise, the HU10C strain amplified two fragments downstream of mupA, corresponding to the two possible orientations of IS257, detected by combining the primer M1 with 1234 or 1235 (Fig. 1B). All plasmids were cleaved with EcoRI, producing fragments that hybridized with the mupA probe, with molecular sizes ranging from 5.0 to 11.0 kb. The plasmid fragments generated from strains HU10A and HU10C and HU14A, and the positive control (strain HU1A) were of the same size (Fig. 1C). Only plasmids from UFU5 and UFU5P strains, in addition to the positive control, were apparently cleaved with HindIII producing fragments smaller than 7.0 kb. None of them was of the same size.

Despite being one of the drugs of choice to prevent the spread of MRSA in the nosocomial environment, mupirocin topical use has contributed to the emergence of resistance of this antibiotic, as has emerged resistance to all most common antibiotics used to treat staphylococcal infections. A recent review by Dadashi et al. (2020) has shown that the global prevalence of mupirocin resistance may be as little as 1.0% in some regions (for studies performed in certain areas of Australia, India, France and Iran, for example) to more than 50% (studies from the United States of America, Egypt and other areas from India). Recent studies with Brazilian Staphylococcus strains from hospitals have reported mupirocin resistance frequencies ranging from 2% (Bes et al. 2021) to 33% (Chamon et al. 2017). In Staphylococcus isolated from domestic animals from Brazil, these frequencies were considerably lower, from 0.8% in strains isolated from dogs (Rossi et al. 2018) to 1% in strains isolated from cats (Rossi et al. 2017).

Since MRSA are one of the highest priorities for the research, discovery and development of new antimicrobial agents, as suggested by the World Health Organization (Tacconelli et al. 2018), the emergence of mupirocin-resistant MRSA represents an additional challenge and concern for the control of staphylococcal infections. For that reason, this study focused on such strains. However, mupirocin resistance in non-aureus staphylococcal strains can also be alarming, since less pathogenic or commensal Staphylococcus spp. can act as gene donors for S. aureus (Rossi et al. 2020). In previous studies, we have shown that other Staphylococcus species, like S. haemolyticus and S. epidermidis, can carry conjugative or mobilizable plasmids that can be transferred to S. aureus, thus increasing its capacity to resist drug therapy (Rossi et al. 2016, 2018).

In this study, we observed that all mupirocin resistant MRSA carry high-molecular weight plasmids; some may have at least two. High-molecular weight plasmids are common among staphylococci and more likely to be transferred by either conjugation or mobilization than small plasmids (Rodríguez-Beltrán et al. 2021).

Like in most bacteria of the Firmicutes phylum, staphylococcal plasmids present a high degree of mosaicism, being mainly formed by recombination events between repetitive elements, which grants it genes from several ancestral genetic sources (Pesesky et al. 2019). One of the consequences of such recombinations is the carriage of resistance to multiple drugs by these plasmids. Among our strains, the plasmids are likely to harbor genes encoding resistance to antibiotics other than mupirocin, since their loss, induced by heat stress, was associated with the concomitant loss of resistance to other antibiotics at the same time. Although some of these phenotypes could be due to mutations, mupirocin resistance loss or transfer was shown to be related to the absence or presence of the mupA gene, respectively. The low frequency of plasmid loss in the conditions tested, detected for most strains, indicate that they might be persistent. The persistence of high-molecular weight plasmids in Staphylococcus spp. is usually due to genetic systems that grant their persistence, such as toxin-antitoxin determinants (Schuster and Bertram 2016).

Another consequence of staphylococcal plasmid mosaicism is the presence of multiple origins of transfer (oriT) and mechanisms of transfer, which include several proteins involved in conjugation (Ramsay et al. 2016; Firth et al. 2018). Alternatively, they may also rely on mobilization and conduction – when a plasmid integrates into another mobile element and “hitches a ride” on it (Rodríguez-Beltrán et al. 2021). Our results indicate that the plasmids studied in here were transferred by conjugation, since they were autonomously transferred from the transconjugants, previously plasmid-free, to a second strain acting as a recipient.

Since mupA is usually flanked by insertion sequences, such as IS257, it is possible for it to integrate into the chromosome, thus stabilizing resistance. In fact, chromosomal copies of mupA have been detected in Staphylococcus, being responsible for both high (Udo et al. 2003) and low (Ramsey et al. 1996) levels of mupirocin resistance.

IS257 is associated with the mobility of other antimicrobial resistance genes (Harmer and Hall 2021), while also being a common molecular marker to assess plasmid diversity. Here, the presence, orientation, and distance of IS257 from mupA evidenced that all five plasmids were different, even though their restriction profile indicated that some of them may have common origins.

In conclusion, this study shows that mupirocin resistance in Brazilian MRSA strains is associated with diverse high-molecular weight plasmids, which can be easily transferred between S. aureus isolates. Because of the narrowing possibilities to treat infections caused by this bacterium in the hospital environment, the use of this and other antibiotics, as well as resistance to them, should be carefully monitored.

Acknowledgments

Funding We thank the financial support from Fundação de Amparo à Pesquisa do Estado do Rio de Janeiro (FAPERJ, grants E-26/010.000172/2016; 010.00128/2016; 101056/2018; 001463/2019; 211.554/2019; 201.071/2020 and 200.895/2021), Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq, grant 305940/2018-0 and PIBIC-UFRJ-CNPq 2020) and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior Programa de Excelência Acadêmica – Finance Code 001 (CAPES ProEx, grant 23038.002486/2018-26).

Conflict of interest/competing interests None to declare.

Authors contribution Conceptualization: MGM, APMC, VCS, KRNS, MCFB, CCR; Methodology: APMC, VCS; Formal analysis and investigation: MGM, APMC, VCS, KRNS, MCFB, CCR; Writing – original draft preparation: MGM, CCR; Writing – review and aditing: MGM, APMC, VCS, KRNS, MCFB, CCR; Funding acquisition: MGM, KRNS, MCFB; Supervision: MGM.

Bastos MC, Mondino PJ, Azevedo ML, et al (1999) Molecular characterization and transfer among Staphylococcus strains of a plasmid conferring high-level resistance to mupirocin. Eur J Clin Microbiol Infect Dis 18:393–398. https://doi.org/10.1007/s100960050306
Bes TM, Perdigão-Neto L, Martins RR, et al (2021) Susceptibility to chlorhexidine and mupirocin among methicillin-resistant Staphylococcus aureus clinical isolates from a teaching hospital. Rev Inst Med Trop Sao Paulo 63:e27. https://doi.org/10.1590/s1678-9946202163027
Bitrus A, Olabode M, Abbas M, Dauda Goni M (2018) Staphylococcus aureus: a review of antimicrobial resistance mechanism. Vet Sci Res Rev 4:43–54. https://doi.org/10.17582/journal.vsrr/2018/4.2.43.54
Chamon RC, Ribeiro S da S, da Costa TM, et al (2017) Complete substitution of the Brazilian endemic clone by other methicillin-resistant Staphylococcus aureus lineages in two public hospitals in Rio de Janeiro, Brazil. Brazilian J Infect Dis 21:185–189. https://doi.org/10.1016/j.bjid.2016.09.015
Christine S, C. AD, Lisa L, et al (2012) MupB, a new high-level mupirocin resistance mechanism in Staphylococcus aureus. Antimicrob Agents Chemother 56:1916–1920. https://doi.org/10.1128/AAC.05325-11
CLSI (2021) Performance Standards for Antimicrobial Susceptibility Testing. Clin Laboartory Stand Inst 31st editi:
Dadashi M, Hajikhani B, Darban-Sarokhalil D, et al (2020) Mupirocin resistance in Staphylococcus aureus: A systematic review and meta-analysis. J Glob Antimicrob Resist 20:238–247. https://doi.org/https://doi.org/10.1016/j.jgar.2019.07.032
Ferreira N do C, Schuenck RP, dos Santos KRN, et al (2011) Diversity of plasmids and transmission of high-levelmupirocin mupA resistance gene in Staphylococcus haemolyticus. FEMS Immunol Med Microbiol 61:147–152. https://doi.org/10.1111/j.1574-695X.2010.00756.x
Firth N, Jensen SO, Kwong SM, et al (2018) Staphylococcal plasmids, transposable and integrative elements. Microbiol Spectr 6:
6.6.06
. https://doi.org/10.1128/microbiolspec.GPP3-0030-2018
Giambiagi-Marval M, Mafra MA, Penido EG, Bastos MC (1990) Distinct groups of plasmids correlated with bacteriocin production in Staphylococcus aureus. J Gen Microbiol 136:1591–1599. https://doi.org/10.1099/00221287-136-8-1591
Green MR, Sambrook J (2012) Molecular cloning: a laboratory manual. Cold Spring Harb Lab Press Fourth Edi:2028pp
Harmer CJ, Hall RM (2021) IS26 Family members IS257 and IS1216 also form cointegrates by copy-in and targeted conservative routes. mSphere 5:e00811-19. https://doi.org/10.1128/mSphere.00811-19
Khoshnood S, Heidary M, Asadi A, et al (2019) A review on mechanism of action, resistance, synergism, and clinical implications of mupirocin against Staphylococcus aureus. Biomed Pharmacother 109:1809–1818. https://doi.org/10.1016/j.biopha.2018.10.131
Lee AS, de Lencastre H, Garau J, et al (2018) Methicillin-resistant Staphylococcus aureus. Nat Rev Dis Prim 4:18033. https://doi.org/10.1038/nrdp.2018.33
Liu W-T, Chen E-Z, Yang L, et al (2021) Emerging resistance mechanisms for 4 types of common anti-MRSA antibiotics in Staphylococcus aureus: A comprehensive review. Microb Pathog 156:104915. https://doi.org/https://doi.org/10.1016/j.micpath.2021.104915
Nunes EL, dos Santos KR, Mondino PJ, et al (1999) Detection of ileS-2 gene encoding mupirocin resistance in methicillin-resistant Staphylococcus aureus by multiplex PCR. Diagn Microbiol Infect Dis 34:77–81. https://doi.org/10.1016/s0732-8893(99)00021-8
Pesesky MW, Tilley R, Beck DAC (2019) Mosaic plasmids are abundant and unevenly distributed across prokaryotic taxa. Plasmid 102:10–18. https://doi.org/https://doi.org/10.1016/j.plasmid.2019.02.003
Projan SJ, Archer GL (1989) Mobilization of the relaxable Staphylococcus aureus plasmid pC221 by the conjugative plasmid pGO1 involves three pC221 loci. J Bacteriol 171:1841–1845
Ramsay JP, Kwong SM, Murphy RJT, et al (2016) An updated view of plasmid conjugation and mobilization in Staphylococcus. Mob Genet Elements 6:e1208317. https://doi.org/10.1080/2159256X.2016.1208317
Ramsey MA, Bradley SF, Kauffman CA, Morton TM (1996) Identification of chromosomal location of mupA gene, encoding low-level mupirocin resistance in staphylococcal isolates. Antimicrob Agents Chemother 40:2820–2823. https://doi.org/10.1128/AAC.40.12.2820
Rodríguez-Beltrán J, DelaFuente J, León-Sampedro R, et al (2021) Beyond horizontal gene transfer: the role of plasmids in bacterial evolution. Nat Rev Microbiol 19:347–359. https://doi.org/10.1038/s41579-020-00497-1
Rossi CC, da Silva Dias I, Muniz IM, et al (2017) The oral microbiota of domestic cats harbors a wide variety of Staphylococcus species with zoonotic potential. Vet Microbiol 201:136–140. https://doi.org/10.1016/j.vetmic.2017.01.029
Rossi CC, Ferreira NC, Coelho MLV, et al (2016) Transfer of mupirocin resistance from Staphylococcus haemolyticus clinical strains to Staphylococcus aureus through conjugative and mobilizable plasmids. FEMS Microbiol Lett 363:fnw121. https://doi.org/10.1093/femsle/fnw121
Rossi CC, Pereira MF, Giambiagi-Demarval M (2020) Underrated Staphylococcus species and their role in antimicrobial resistance spreading. Genet Mol Biol 43:e20190065. https://doi.org/10.1590/1678-4685-gmb-2019-0065
Rossi CC, Salgado BAB, Barros EM, et al (2018) Identification of Staphylococcus epidermidis with transferrable mupirocin resistance from canine skin. Vet J 235:70–72. https://doi.org/10.1016/j.tvjl.2018.03.009
Schuster CF, Bertram R (2016) Toxin-Antitoxin systems of Staphylococcus aureus. Toxins (Basel) 8:140. https://doi.org/10.3390/toxins8050140
Septimus EJ, Schweizer ML (2016) Decolonization in prevention of health care-associated infections. Clin Microbiol Rev 29:201–222. https://doi.org/10.1128/CMR.00049-15
Tacconelli E, Carrara E, Savoldi A, et al (2018) Discovery, research, and development of new antibiotics: the WHO priority list of antibiotic-resistant bacteria and tuberculosis. Lancet Infect Dis 18:318–327. https://doi.org/https://doi.org/10.1016/S1473-3099(17)30753-3
Turner NA, Sharma-Kuinkel BK, Maskarinec SA, et al (2019) Methicillin-resistant Staphylococcus aureus: an overview of basic and clinical research. Nat Rev Microbiol 17:203–218. https://doi.org/10.1038/s41579-018-0147-4
Udo EE, Al-Sweih N, Noronha BC (2003) A chromosomal location of the mupA gene in Staphylococcus aureus expressing high-level mupirocin resistance. J Antimicrob Chemother 51:1283–1286. https://doi.org/10.1093/jac/dkg188
Udo EE, Jacob LE, Mathew B (2001) Genetic analysis of methicillin-resistant Staphylococcus aureus expressing high- and low-level mupirocin resistance. J Med Microbiol 50:909–915. https://doi.org/10.1099/0022-1317-50-10-909
Woodford N, Watson AP, Patel S, et al (1998) Heterogeneous location of the mupA high-level mupirocin resistance gene in Staphylococcus aureus. J Med Microbiol 47:829–835. https://doi.org/10.1099/00222615-47-9-829

Table 1

Phenotypic characteristics of mupirocin-resistant Staphylococcus aureus strains before and after they were submitted to plasmid curing by temperature stress
Strain	Curing	MIC_mup (µg/mL)	Antimicrobial resistance*
HU10A		> 1024	amp, cph, cip, cli, chl, ery, gen, kan, mup, tet, oxa, sft
HU10A^C	2.3%	16	cli, gen, tet, oxa
HU10C		> 1024	amp, cph, cip, cli, chl, ery, gen, kan, mup, tet, oxa, sft
HU10C^C	21.6%	8	amp, cph, cip, cli, chl, ery, gen, kan, tet, oxa, sft
HU14A		512	amp, cph, cip, cli, chl, ery, gen, kan, mup, tet, oxa, sft
HU14A^C	1.6%	< 1	chl
UFU5		> 1024	amp, cph, cip, cli, chl, ery, gen, kan, mup, tet, oxa, sft
UFU5^C	6.3%	< 1	amp, cph, cip, cli, chl, ery, gen, kan, oxa, sft
UFU5P		> 1024	amp, cph, cip, cli, chl, ery, gen, kan, mup, tet, oxa, sft
UFU5P^C	4.3%	1	amp, cph, cip, cli, chl, ery, gen, kan, tet, oxa, sft
^CThe overwritten letter indicate the strains’ names after they were cured. *Antibiotics: ampicillin (amp), cephalothin (cph), ciprofloxacin (cip), clindamycin (cli), chloramphenicol (chl), erythromycin (ery), gentamicin (gen), kanamycin (kan), mupirocin (mup), oxacillin (oxa), tetracycline (tet) and sulfamethoxazole-trimethoprim (sft).

Table 2

Phenotypic characteristics of Staphylococcus aureus strains before and after they were conjugated with plasmids from MRSA.
Strain	Conjugation frequency	MIC_mup (µg/mL)
Recipients
RN8411	-	< 1
HU1A Mup^S	-	8
First conjugation^a
RN8411 + pHU10A	5.6 ± 3.7 x 10^− 7	2048
RN8411 + pHU10C	2.8 ± 1.0 x 10^− 6	2048
RN8411 + pHU14A	6.5 ± 2.2 x 10^− 8	256
RN8411 + pUFU5	4.4 ± 2.6 x 10^− 7	2048
RN8411 + pUFU5P	3.3 ± 1.7 x 10^− 7	2048
Second conjugation
HU1A Mup^S + pHU10A	1.4 ± 0.5 x 10^− 7	2048
HU1A Mup^S + pHU10C	4.7 ± 2.3 x 10^− 6	2048
HU1A Mup^S + pHU14A	6.0 ± 2.1 x 10^− 7	256
HU1A Mup^S + pUFU5	3.9 ± 3.2 x 10^− 7	2048
HU1A Mup^S + pUFU5P	2.9 ± 3.6 x 10^− 6	2048
^aThese strains were the transconjugants from the first round of conjugation with RN8411 and the donors in the second round of conjugation with HU1A cured from mupirocin resistance (Mup^S). The letter “p” denotates the plasmid from the respective strain

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Brazilian methicillin-resistant Staphylococcus aureus (MRSA) strains carrying a diversity of mupirocin-resistance plasmids

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Declarations

References

Tables

Additional Declarations

Status:

Version 1