A-to-I edited miR-411-5p targets MET and promotes TKI response in NSCLC

doi:10.21203/rs.3.rs-1957094/v1

Download PDF

Article

A-to-I edited miR-411-5p targets MET and promotes TKI response in NSCLC

https://doi.org/10.21203/rs.3.rs-1957094/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

The epidermal growth factor receptor (EGFR) is a tyrosine kinase receptor (TKR) frequently mutated in lung cancer. Despite initially favorable clinical responses of non-small cell lung cancer (NSCLC) patients harboring an EGFR mutation to treatment with tyrosine kinase inhibitors (TKIs), rapid resistance occurs mainly because of genetic alterations, including amplification of the hepatocyte growth factor receptor (MET). RNA post-transcriptional modifications that contribute to aberrant expression of MET in cancer are under-investigated. Among them, adenosine to inosine (A-to-I) RNA editing regulates RNA sequence, function, degradation, and structure. RNA editing has been observed in microRNAs (miRNAs), a class of small non-coding RNAs involved in post-transcriptional gene regulation. High throughput interrogation of the human genome allows for the identification of miRNA editing deregulation in cancer. However, the biological impact of edited miRNAs on lung cancer progression and drug resistance remains largely unknown. A reduction of A-to-I editing in position 5 of miR-411-5p has been identified in several cancers, including NSCLC. In this study, we determined that edited miR-411-5p negatively affects the ERK1/2 pathway, directly targets MET, and promotes EGFR TKI response in NSCLC.

Lung cancer is the leading cause of cancer-related deaths in the United States (1). Genetic mutations of tyrosine kinase receptors (TKRs), like the epidermal growth factor receptor (EGFR), frequently drive lung cancer development, progression, and drug resistance (2, 3). Tyrosine kinase inhibitors (TKIs) have become the standard of care for non-small cell lung cancer (NSCLC) patients harboring an EGFR mutation (4, 5). Patients treated with EGFR TKIs achieve favorable clinical responses initially, but their tumors invariably succumb to drug resistance (6, 7). One of the most frequent mechanisms of resistance against EGFR TKIs is hepatocyte growth factor receptor (MET) amplification (8). MET and its downstream signaling pathways (i.e., MAPK, PI3K-AKT) are constitutively activated in several cancers and drive cell survival, proliferation, migration, invasion, and drug resistance (9–11).

Lung cancer research has rapidly evolved from broad evaluation of the genetic contributors of disease to more detailed study of the post-transcriptional modifications that may drive cancerous phenotype and drug resistance (12). In particular, coding and non-coding RNAs can be modified by adenosine deamination into inosine (A-to-I editing) catalyzed by the Adenosine Deaminase Acting on the RNA (ADAR) protein family (13, 14). A-to-I editing is dysregulated in cancer and involved in drug resistance, including against EGFR TKIs (14, 15). For example, the altered A-to-I editing of the glycogen synthase kinase 3 (GSK3β) mRNA generates a mis-splicing and induces β-catenin expression, contributing to cancer progression and TKI resistance (16).

Recently, our group identified the dysregulation of A-to-I editing of non-coding RNAs in both tissue and circulation of NSCLC patients (17). MicroRNAs (miRNAs) are a class of small non-coding RNAs that repress gene expression at the post-transcriptional level (18). Mature miRNA sequences have a short "seed region" at their 5' end which binds to complementary regions in the 3' UTR of target mRNA, inhibiting its translation or promoting its degradation (19). miRNAs are uniquely deregulated in cancer, acting as tumor suppressors or oncomiRs (20). Several studies have focused on the regulatory relationship between EGFR, MET, and miRNAs in NSCLC (21–24). Researchers have observed that miR-130a directly targets MET, activating miR-221/222 expression through the c-Jun transcription factor and inducing resistance to TNF-related apoptosis-inducing ligand (TRAIL) in lung adenocarcinoma (23). Furthermore, MET regulates multiple miRNAs, including miR-221/222, miR-30b/c, miR-103, miR-203, and the miRNA cluster 23a ~ 27a ~ 24 − 2 (21, 24). The miR-221/222 cluster induces TKI resistance in NSCLC and miR-27a regulates the crosstalk between MET and EGFR, directly targeting both and suppressing Sprouty2 (22). These studies, among others, have focused on studying miRNA expression and deregulation in cancer. However, few studies to date have investigated miRNA post-transcriptional modifications such as A-to-I editing and their role in cancer and drug resistance (12). A-to-I editing of miRNAs can alter both their maturation and expression (25). Furthermore, edits at the seed region can drastically alter the miRNA targetome, thus impacting function (26, 27). We previously observed that miR-411-5p editing in position 5 of the seed region (ed.miR-411-5p) is reduced in NSCLC patients (17). Other groups have corroborated these findings in other cancers, including glioblastoma, stomach, bladder, and breast cancer (28). However, the biological role of miRNA A-to-I editing in NSCLC remains unknown (28).

In this study, we identified MET as a target for ed.miR-411-5p. Given the role of MET in EGFR TKI resistance, we investigated the role of non-coding RNA editing on MET signaling, focusing on EGFR TKI resistance in NSCLC.

Cell culture, transfection, and chemicals

All cell lines (H520, A549, H1299, PC9, HCC827, Hek-293) were grown in RPMI with 10% FBS, L-glutamine, and antibiotics (Sigma - Burlington, MA, United States). Transfections were performed using Lipofectamine 3000 (ThermoFisher - Waltham, Massachusetts, USA) as suggested by the manufacturer. All cell lines were transfected at 60% confluence in OPTIMEM^® (ThermoFisher) without antibiotics and then transfected with 100 nmol of custom-made ed.miR-411-5p oligonucleotides or negative control (Horizon Cambridge, United Kingdom) for the indicated time.

Western blot analysis

H520, A549, H1299, PC9, HCC827, HCC827R mild, HCC827R, and PC9R cells were seeded and grown in RPMI (Sigma) with 10% FBS in 6 well plates for 24 hr before the transfection. Then, 48 hr after transfection, cells were washed in PBS 1X and collected for RNA and protein extraction. Cells for protein extraction were subjected to lysis in RIPA (ThermoFisher) buffer plus protease (Roche - Basel, Switzerland) and phosphatase inhibitors (Roche). Equal amounts of protein lysates and rainbow molecular weight marker (Bio-Rad Laboratories - Hercules, California, USA) were separated by 4–20% SDS/PAGE and then electrotransferred to nitrocellulose membranes. The membranes were blocked with a buffer containing 5% nonfat dry milk or BSA (depending on the antibody) in Tris-buffered saline with 0.1% Tween-20 for at least 1 hr and incubated overnight with antibodies at 4°C. After a second wash with Tris-buffered saline with 0.1% Tween 20, the membranes were incubated with peroxidase-conjugated secondary antibodies (GE Healthcare - Amersham Chicago, Illinois, USA) and developed with an enhanced chemiluminescence detection kit (Pierce - Waltham, Massachusetts, USA).

Antibody used for western blot analysis

Vinculin (Abcam - Cambridge, UK) was used as a loading control. p-Akt, p-ERK1/2, p-ELK, Akt, ERK, ELK, c-Met, c-Fos, c-Jun, and c-Myc antibodies were obtained from Cell Signaling Technologies (Danvers, Massachusetts, USA).

RNA extraction

Total RNA was extracted using the RNA Cleanup and Concentration Kit (Norgen - Thorold, ON, Canada) following the kit protocol

Real-time qRT-PCR

All the qRT-PCRs were performed with Taqman^® technology as previously described (29). For ed.miR-411-5p, we used a custom Taqman probe (ThermoFisher)

Luciferase assay

To generate c-Met and c-Fos luciferase reporter constructs, a part of the 3’UTRs was amplified by PCR and cloned downstream of Renilla CDS in the psicheck2 plasmid (Promega). Mutations were introduced into the miRNA-binding sites using the QuikChange Mutagenesis Kit (Stratagene - La Jolla, California, USA). HEK-293 cells were transfected with the Psicheck2-met-3’UTR, Psicheck2-met-3’UTR-MUT, Psicheck2-Fos-3’UTR, and Psicheck2-Fos-3’UTR-MUT plasmids and amiRs using Lipofectamine 3000 (Thermo Fisher). After 24 hr, cells were lysed and assayed with Dual Luciferase Assay (Promega) according to the manufacturer’s instructions.

The primers used for the cloning were as follows:

c-Fos FW: CCGCTCGAGCGGGGTGCATTACAGAGAGGAGAAA

c-Fos RV: AAGGAAAAAAGCGGCCGCAAAAGGAAAACCTCAACAATGCATGATCAGTAAC

MET FW: CCGCTCGAGCGGCTATGTCCATGTGAACGCTACT

MET RV: AAGGAAAAAAGCGGCCGCAAAAGGAAAATATGATCACACCACTGCACTAC

Cell death and cell proliferation assays

Growth density assay

The cells were harvested 6 hr after transfection by trypsinization, and 5 x 10⁵ cells were seeded into 10 mm plates in triplicate. The cells were then fixed and stained with Crystal violet solution (Sigma) and density was assessed by using ImageJ.

Apoptosis

Apoptosis was assessed using the Annexin V-FITC apoptosis detection kit (ThermoFisher) followed by flow-cytometric analysis. PC9R and HCC827R cells were transfected and, after 24 hr, treated with 5µM gefitinib. After incubation, cells were washed with cold PBS and removed from the plates by trypsinization. The resuspended cells were washed with cold PBS and stained with FITC-conjugated annexin V antibody according to the manufacturer’s instructions (ThermoFisher). Samples were allowed to stand for 15 min in the dark and immediately analyzed using the FACSCalibur flow cytometer (BD Bioscience - Franklin Lakes, New Jersey, USA).

Differential expression analysis after edited miR-411-5p transfections

We performed differential expression analysis of 770 genes of the nCounter PanCancer Pathways Panel in biological triplicates. Sixty nanograms of total RNA were hybridized overnight with nCounter Reporter (20 µL) probes in hybridization buffer and excess of nCounter Capture probes (5 µL) at 65°C for 16 − 20 hr. After overnight hybridization, excess probes were removed using two-step magnetic beads-based purification on an automated fluidic handling system (nCounter Prep Station). Biotinylated capture probe-bound samples were immobilized and recovered on a streptavidin-coated cartridge. The abundance of specific target molecules was then quantified using the nCounter digital analyzer. Individual fluorescent barcodes and target molecules present in each sample were recorded with a CCD camera by performing a high-density scan (600 fields of view). Normalization was performed using the nSolver Analysis Software (Version 4.0; NanoString Technologies), applying the geometric mean of the negative controls for negative background subtraction; the positive controls for the technical normalization; and the housekeeping genes for the biological normalization in all samples, as recommended by NanoString. P values were calculated using the limma package (v3.48.3) from the Bioconductor R project. P values were used to rank all genes, retaining those under a significant threshold of 0.01 and with a geometric mean expression of > 20 counts (in at least one condition) after negative background subtraction and a |linear fold-change| > 1.25.

Edited miR-411-5p targeting prediction for MET and c-Fos genes

We predicted binding sites on 3′UTR sequences (UCSC.hg19) of MET and c-Fos genes by using RNAhybrid (v2.1.2) predictor tool (30), considering a ΔG ≤ 20 kcal/mol (free energy).

Pathway enrichment analysis after edited miR-411-5p transfection in H1299 and H520 cell lines

Using Ingenuity Pathway Analysis, we performed functional enrichment analysis on the retained set of differentially expressed genes (mentioned above). Settings used included experimentally observed data for the human species.

A-to-I edited miR-411-5p targets MET and negatively impacts the ERK/MAPK and PI3K/AKT pathways in NSCLC cell lines

In a previous study, we found miR-411-5p hypoedited in position 5 of the seed region in NSCLC tissues compared with uninvolved lung samples (paired samples) (17). To further investigate the role of miR-411-5p editing in position 5 in NSCLC, we generated a custom-designed mimic of the edited form of (ed.)miR-411-5p, where the inosine in position 5 (I) was replaced by guanosine (G). The replacement of I-to-G is commonly used to mimic the inosine functions experimentally (31). We then overexpressed the ed.miR-411-5p by transfection in two NSCLC cell lines (H1299 and H520) (Fig. 1a left). A NanoString nCounter PanCancer Pathways Panel was then performed to identify dysregulated genes associated with 13 different cancer-associated pathways. We found 30 dysregulated genes in H520 and 83 genes in H1299 (P < 0.01) (Fig. 1a right; Suppl. Table 1; see Materials and Methods section for more details). A functional enrichment analysis was conducted to detect the most relevant pathways involved in lung cancer development and progression. We used the Ingenuity Pathway Analysis® (IPA®) software to accomplish this and found a significant negative impact of ed.miR-411-5p (negative Z score) on the ERK/MAPK and PI3K/AKT pathways in H1299 (Fig. 1b; Suppl Table 2).

To identify possible direct targets of ed.miR-411-5p, we considered the downregulated genes common to both cell lines (Fig. 1a red circle; Suppl. Table 1). Among them, we elected to study MET for its preeminent role in the ERK/MAPK and PI3K/AKT pathways, NSCLC biology, and drug resistance (8, 9, 32). We also predicted, in silico, that the MET mRNA 3’ untranslated region (3’UTR) would be targeted by ed.miR-411-5p (Fig. 1c) but not miR-411-5p WT. We preliminarily assessed by western blot the effect of ed.miR-411-5p on the MET protein compared to the scramble (Scr) control and miR-411-5p wildtype (WT) in two NSCLC cell lines (H1299 and A549). We found that only the ed.miR-411-5p but not the miR-411-5p WT represses MET protein levels (Fig. 1d).

To further validate the MET mRNA direct targeting by ed.miR-411-5p, we cloned a portion of the MET mRNA 3'UTR containing the predicted binding site for ed.miR-411-5p into a psicheck2 vector (Promega Corporation - Madison, Wisconsin, USA) downstream of the luciferase open reading frame (ORF) of a luciferase reporter gene. The MET-3’UTR luciferase reporter plasmid was co-transfected with the ed.miR-411-5p and a Scr control. The ed.miR-411-5p significantly repressed the luciferase activity of the reporter vector when compared to the Scr control, demonstrating the direct targeting of MET (Fig. 1e - left). We then mutated the predicted binding region on MET 3'UTR as a control, finding a significant increment of the luciferase activity (Fig. 1e - right).

Edited miR-411-5p reduces c-Fos expression and AP1 activity in NSCLC

c-Met regulates AP1 activity and c-Fos expression through the ERK pathway (Fig. 2a) (33). To validate the predicted negative impact of ed.miR-411-5p in this pathway presented in Fig. 1b, we first evaluated MET/MAPK/ERK signaling by western blot after transfection with the ed.miR-411-5p and Scr control and found a downregulation of p-ERK and p-ELK levels in H1299 after transfection with ed.miR-411-5p (Fig. 2b). To further validate this effect, we used a Serum Response Element (SRE) luciferase reporter vector (BPS Bioscience - San Diego, California, USA) to monitor the MAPK/ERK pathway transcriptional activity. After transfection with ed.miR-411-5p, the luciferase activity in A549 cells was significantly reduced compared to the Scr control (Fig. 2c). We also evaluated p-ELK levels in A549 cells after transfection with ed.miR-411-5p or Scr control, finding Elk activation is diminished as a consequence of ed.miR-411-5p overexpression (Fig. 2d). Due to the presence of SRE elements on the c-Fos promoter and transcriptional activation of c-Fos by Elk (34, 35), we next evaluated the effect of ed.miR-411-5p on c-Fos expression by assessing c-Fos mRNA levels by qRT-PCR (Fig. 2e) and protein levels by western blot in NSCLC cell lines (Fig. 2f and Suppl. Figure 1a - top). We found that overexpression of ed.miR-411-5p but not the miR-411-5p (WT) reduces c-Fos expression (Suppl. Figure 1a - bottom). Intriguingly, we also predicted a possible ed.miR-411-5p binding site in the c-Fos mRNA 3’UTR (Suppl. Figure 1b). The c-Fos 3′UTR containing the ed.miR-411-5p binding site was cloned into a psicheck2 vector (Promega Corporation) downstream of the luciferase ORF to investigate whether c-Fos is a direct target of ed.miR-411-5p. A luciferase assay was performed co-transfecting the ed.miR-411-5p, miR-222 (positive control), and a Scr control along with the aforementioned luciferase plasmid. We selected miR-222 as a positive control because there is a known miR-222 binding site present in the portion of the c-Fos 3’UTR that we cloned in the psicheck2 vector (36). As shown in Suppl. Figure 1c, we did not find any direct targeting of the c-Fos 3’UTR by the ed.miR-411-5p.

We also wanted to test the role of ed.miR-411-5p on the AP1 pathway. AP1 activity is greatly dependent on ERK activity (37). For this objective, we employed a luciferase plasmid in which the responsive element for the AP1 complex was cloned as a promoter element (38). As shown in Fig. 2g, the luciferase activity was significantly reduced after transfection of ed.miR-411-5p. An ERK inhibitor (Sigma) (3µM) was used as a positive control in this set of experiments. Considering the role of AP1 on c-Myc and c-Jun transcription factors (24, 39), we also assessed the protein and mRNA levels of c-Jun and c-Myc after ed.miR-411-5p overexpression in H1299 cells. We found a reduced expression of c-Jun and c-Myc protein and mRNA (Fig. 2h-2i). These results further confirm the inhibiting role of ed.miR-411-5p on the ERK-AP1 pathway.

Edited miR-411-5p increases gefitinib sensitivity in NSCLC

Overexpression of c-Met is a common mechanism of resistance to EGFR TKIs (8). To test the effect of ed.miR-411-5p on TKI resistance, we rendered an EGFR mutated and TKI sensitive NSCLC cell line (HCC827) resistant to gefitinib by treating the cells with two different concentrations of gefitinib (2.5µM and 5µM) for four weeks. We generated two cell lines with different degrees of resistance to gefitinib which we named HCC827R mild (2.5µM) and HCC827R (5µM) and used these cell lines for our subsequent experiments (Fig. 3a). It has been reported that HCC827 can develop resistance to TKIs through MET amplification (40, 41). We assessed MET levels in the HCC827R mild and HCC827R cell lines by western blot and qRT-PCR, finding a progressive increase in MET protein expression and mRNA levels in HCC827R mild and HCC827R (Fig. 3b-3c). We first evaluated the effect of the ed.miR-411-5p on MET, p-Akt, and p-ERK levels in HCC827R mild by western blot. We found that the ed.miR-411-5p reduces MET levels and its pathway in HCC827R mild compared to the Scr control (Fig. 3d). We further evaluated the effect of ed.miR-411-5p on cell proliferation in HCC827R mild cells treated with gefitinib (5µM). The ed.miR-411-5p significantly reduced HCC827R mild cell growth when combined with gefitinib compared to the vehicle treatment (Fig. 3e; Suppl. Figure 1d). We then tested the effect of ed.miR-411-5p on MET, p-Akt, and p-ERK levels in HCC827R by western blot. As reported in Fig. 3b, the HCC827R cells express higher levels of MET protein when compared to the HCC827R mild. In HCC827R cells with higher MET upregulation, overexpression of ed.miR-411-5p fails to reduce MET and p-Akt protein levels while still reducing p-ERK levels (Fig. 3f). Furthermore, once MET expression is upregulated, the ed.miR-411-5p overexpression in combination with gefitinib (5µM) cannot repress HCC827R proliferation (Fig. 3g), confirming a link between the ed.miR-411-5p and MET signaling on TKI resistance in HCC827R cells. In addition to gefitinib, HCC827R cells were also resistant to the third-generation EGFR TKI osimertinib (41). Once the ed.miR-411-5p was overexpressed in combination with osimertinib (5µM), it was able to induce weak but significant repression in HCC827R cell growth (Fig. 3g; Suppl. Figure 3e - top). Considering the effect of ed.miR-411-5p on ERK phosphorylation in HCC827R cells independent from MET expression (Fig. 3f), we hypothesized a MET-independent effect of the ed.miR-411-5p on ERK signaling. To further investigate this hypothesis, we generated a second NSCLC cell line (PC9) that is resistant to EGFR TKI (gefitinib − 5µM) (PC9R) (Fig. 3h). PC9 cells carry an EGFR mutation and are sensitive to EGFR TKIs (41). It has been reported that PC9 cells acquire EGFR TKI resistance in a MET-independent manner (41). We evaluated MET expression in PC9R by western blot and qRT-PCR and did not detect MET amplification in this TKI-resistant NSCLC cell line (Fig. 3i). We then evaluated the effect of the ed.miR-411-5p in the PC9R cell line. We found that MET, p-Akt, and p-Erks levels were reduced when ed.miR-411-5p was overexpressed (Fig. 3j). To determine the biological effect of ed.miR-411-5p in the PC9R cell line, we performed a colony assay overexpressing the ed.miR-411-5p and treating the PC9R with EGFR TKI (gefitinib or osimertinib − 5µM). In combination with gefitinib or osimertinib, ed.miR-411-5p reduced cell proliferation in PC9R cells, which are EGFR TKI resistant but not MET amplified (Fig. 3k; Suppl. Figure 1e - bottom).

To further assess the role of the ed.miR-411-5p in TKI response, we performed an Annexin-V5 assay in HCC827R and PC9R cell lines after ed.miR-411-5p overexpression and EGFR TKI treatment (gefitinib or osimertinib − 5µM). The ed.miR-411-5p significantly induced apoptosis in both HCC827R and PC9R cells when combined with an EGFR TKI (Fig. 4a-4b).

Finally, we also evaluated apoptosis by caspase 3/7 assay after transfecting A549 NSCLC cells with Scr, ed.miR-411-5p, or miR-411-5p (WT) and treating transfectants with gefitinib (5µM). Parental A549 cells express mutated KRAS (G12S) but WT EGFR, and are resistant to EGFR TKIs (42–44). In A549 cells, the ed.miR-411-5p induced caspase 3/7 activity in combination with gefitinib. In contrast, the miR-411-5p WT did not promote gefitinib response in the A549 cell line (Suppl. Figure 2a). We further evaluated apoptosis in A549 cells by Annexin-V5 after Scr or ed.miR-411-5p transfection and gefitinib (5µM) treatment. The ed.miR-411-5p significantly induced apoptosis when combined with gefitinib in A549 cells (Suppl. Figure 2b).

EGFR mutations occur in 10–20% of NSCLC cases in Caucasians and up to 50% of NSCLC cases in Asians (45, 46). EGFR TKIs have become the first line therapy used to treat NSCLC patients harboring a somatic mutation in EGFR (4). Unfortunately, despite a high objective response rate, many patients on EGFR TKI treatment eventually develop resistance and progress after a median of 10–14 months (47). Recently, investigators have focused on elucidating the molecular drivers and mechanisms of EGFR TKI resistance. One identified mechanism is through the amplification of the receptor tyrosine kinase MET which overrides the EGFR inhibitor’s action, inducing proliferation and resistance in up to 22% of cases of EGFR TKI resistant NSCLC (6). The molecular mechanisms of MET-induced EGFR TKI resistance in cancer have been widely investigated, including the role of MET-dependent non-coding RNAs. In particular, the dysregulated expression of miRNAs, like miR-221/222 and miR-130a, play an essential role in driving MET-induced drug resistance (21–24). Here, we focused beyond the dysregulated expression of miRNAs in cancer, examining altered post-transcriptional modification of miRNA, such as A-to-I editing in NSCLC.

In our previous work, we observed that A-to-I editing of miR-411-5p in position 5 is reduced in tissues and circulation of NSCLC patients (17). Intriguingly, the reduction of A-to-I editing within the seed region (position 5) of the miR-411-5p has also been detected in other cancers (28). A-to-I editing within the miRNAs' seed region alters its function by inducing a targetome shift and generating de facto a new miRNA (26, 27).

We decided to investigate the role of ed.miR-411-5p in NSCLC by analyzing 770 genes from 13 cancer-associated canonical pathways. We found that ed.miR-411-5p inhibits the extracellular signal-regulated kinases (ERKs) pathway and targets MET directly. We also demonstrated that only the ed.miR-411-5p in position 5, and not the miR-411-5p WT, directly targets MET and reduces MET protein levels. We validated that ed.miR-411-5p represses ERK signaling activity, which is downstream of MET activation (33). We also found that ed.miR-411-5p specifically reduces the expression of c-Fos, suppressing the phosphorylation of the ERKs and Elk-1 pathway. Additionally, we evaluated the effect of ed.miR-411-5p on the AP1 transcription factor activity in NSCLC which also depends on the MET and ERKs pathways (33, 37, 48). We found that ed.miR-411-5p represses the AP1 transcriptional activity and reduces downstream c-Myc and c-Jun levels in NSCLC cells.

Considering the prominent role of MET and ERK pathways in NSCLC drug resistance (8), we decided to investigate the effect of ed.miR-411-5p on EGFR TKI resistance by generating two EGFR mutated NSCLC cell lines that have developed EGFR TKI resistance (gefitinib and osimertinib). We chose two NSCLC cell lines that develop resistance to EGFR TKIs differently: the HCC827 cell line generally develops resistance through MET amplification, while the PC9 cell line develops resistance in a MET-independent manner (40, 41). Considering the role of ed.miR-411-5p on MET, we wanted to assess the effect of its overexpression on HCC827R mild and HCC827R, which were made resistant to different concentrations of gefitinib. The HCC827R mild cells overexpress MET compared to the HCC827 parental cells and are resistant to ≤ 2.5µM of gefitinib or osimertinib. The HCC827R cells express the highest level of MET compared to the HCC827 parental and HCC827R mild cells and are resistant to ≤ 5µM of gefitinib or osimertinib. We overexpressed ed.miR-411-5p in both HCC827R mild and HCC827R cells and assessed cell proliferation after treatment with gefitinib or osimertinib 5µM. We found that ed.miR-411-5p failed to repress MET and did not induce a significant response to gefitinib in HCC827R cells. This observation demonstrates that MET overexpression in HCC827R cells affects the ability of ed.miR-411-5p to induce an EGFR TKI response, proving that the effect of ed.miR-411-5p depends, at least in part, on MET targeting. We hypothesized that the lack of MET targeting in HCC827R by ed.miR-411-5p could depend on post-transcriptional modifications of MET mRNA which can render the transcript more stable and less affected by miRNA targeting (10). Interestingly, although ed.miR-411-5p does not effectively target MET in HCC827R cells, p-ERK levels were still suppressed despite the fact we consistently observed an upregulation of total ERK. These findings suggest a role for ed.miR-411-5p in the ERK pathway in a MET-independent manner. This observation is supported by the inhibition of Elk-1 activity and the EGFR TKI response induced by ed.miR-411-5p in the A549 NSCLC cell line. A549 cells are KRAS mutated (G12S), and the ERK pathway responds only minimally to upstream inhibition of MET or EGFR (44, 49).

To further investigate this, we also evaluated whether ed.miR-411-5p overexpression induces EGFR TKI response in PC9R cells that developed TKI resistance in a MET-independent manner. The ed.miR-411-5p suppressed MET, p-Akt, and p-ERK levels in PC9R cells and induced a strong EGFR TKI response to both gefitinib and osimertinib. The response of these cells to EGFR TKI treatment is minimally explained by MET repression because PC9 cells do not develop resistance by amplifying MET. We also found that ed.miR-411-5p significantly induced apoptosis in HCC827R and PC9R NSCLC cell lines.

These results shed light on the potential importance of miRNA post-transcriptional modifications in cancer. The A-to-I edited form of miR-411-5p in position 5 is reduced in cancers, including NSCLC. The A-to-I editing modification within the seed region induces a targetome shift of the edited miRNA compared to the WT. We found that ed.miR-411-5p directly targets MET and represses the MAPK pathway. We also demonstrated that ed.miR-411-5p induces EGFR TKI sensitivity in EGFR TKI-resistant cell lines only partially dependent on MET repression. More comprehensive studies are needed to further define the role of ed.miR-411-5p in cancer as a potential biomarker or therapeutic target in TKI-resistant NSCLC.

Funding

This work was supported by grants from the National Institutes of Health (NCI NCATS 5KL2TR002648) and American Lung Association (LCDA-922902).

Author Contributions

GR and MA designed the study. GR, PL, GN, MS, LM, FL, and D V-M coordinated and performed the experiments, and analyzed the corresponding results. GR, PL, and MA wrote the manuscript. All authors contributed to editing the manuscript.

Competing Interests

The authors declare no competing interests.

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.

Siegel RL, Miller KD, Fuchs HE, Jemal A. Cancer statistics, 2022. CA Cancer J Clin. 2022;72(1):7–33.
Lin JJ, Cardarella S, Lydon CA, Dahlberg SE, Jackman DM, Janne PA, et al. Five-Year Survival in EGFR-Mutant Metastatic Lung Adenocarcinoma Treated with EGFR-TKIs. J Thorac Oncol. 2016;11(4):556–65.
Cheng L, Alexander RE, Maclennan GT, Cummings OW, Montironi R, Lopez-Beltran A, et al. Molecular pathology of lung cancer: key to personalized medicine. Mod Pathol. 2012;25(3):347–69.
Gelatti ACZ, Drilon A, Santini FC. Optimizing the sequencing of tyrosine kinase inhibitors (TKIs) in epidermal growth factor receptor (EGFR) mutation-positive non-small cell lung cancer (NSCLC). Lung Cancer. 2019;137:113–22.
Tan CS, Gilligan D, Pacey S. Treatment approaches for EGFR-inhibitor-resistant patients with non-small-cell lung cancer. Lancet Oncol. 2015;16(9):e447-e59.
Remon J, Moran T, Majem M, Reguart N, Dalmau E, Marquez-Medina D, et al. Acquired resistance to epidermal growth factor receptor tyrosine kinase inhibitors in EGFR-mutant non-small cell lung cancer: a new era begins. Cancer Treat Rev. 2014;40(1):93–101.
Leonetti A, Sharma S, Minari R, Perego P, Giovannetti E, Tiseo M. Resistance mechanisms to osimertinib in EGFR-mutated non-small cell lung cancer. Br J Cancer. 2019;121(9):725–37.
Coleman N, Hong L, Zhang J, Heymach J, Hong D, Le X. Beyond epidermal growth factor receptor: MET amplification as a general resistance driver to targeted therapy in oncogene-driven non-small-cell lung cancer. ESMO Open. 2021;6(6):100319.
Guo R, Luo J, Chang J, Rekhtman N, Arcila M, Drilon A. MET-dependent solid tumours - molecular diagnosis and targeted therapy. Nat Rev Clin Oncol. 2020;17(9):569–87.
Zhang J, Babic A. Regulation of the MET oncogene: molecular mechanisms. Carcinogenesis. 2016;37(4):345–55.
Friedlaender A, Drilon A, Banna GL, Peters S, Addeo A. The METeoric rise of MET in lung cancer. Cancer. 2020;126(22):4826–37.
Song H, Liu D, Dong S, Zeng L, Wu Z, Zhao P, et al. Epitranscriptomics and epiproteomics in cancer drug resistance: therapeutic implications. Signal Transduct Target Ther. 2020;5(1):193.
Romano G, Saviana M, Le P, Li H, Micalo L, Nigita G, et al. Non-Coding RNA Editing in Cancer Pathogenesis. Cancers (Basel). 2020;12(7).
Hua H, Zeng J, Xing H, He Y, Han L, Zhang N, et al. The RNA editing enzyme ADAR modulated by the rs1127317 genetic variant diminishes EGFR-TKIs efficiency in advanced lung adenocarcinoma. Life Sci. 2022;296:120408.
Han L, Diao L, Yu S, Xu X, Li J, Zhang R, et al. The Genomic Landscape and Clinical Relevance of A-to-I RNA Editing in Human Cancers. Cancer Cell. 2015;28(4):515–28.
Abrahamsson AE, Geron I, Gotlib J, Dao KH, Barroga CF, Newton IG, et al. Glycogen synthase kinase 3beta missplicing contributes to leukemia stem cell generation. Proc Natl Acad Sci U S A. 2009;106(10):3925–9.
Nigita G, Distefano R, Veneziano D, Romano G, Rahman M, Wang K, et al. Tissue and exosomal miRNA editing in Non-Small Cell Lung Cancer. Sci Rep. 2018;8(1):10222.
Saliminejad K, Khorram Khorshid HR, Soleymani Fard S, Ghaffari SH. An overview of microRNAs: Biology, functions, therapeutics, and analysis methods. J Cell Physiol. 2019;234(5):5451–65.
Bartel DP. MicroRNAs: target recognition and regulatory functions. Cell. 2009;136(2):215–33.
Acunzo M, Romano G, Wernicke D, Croce CM. MicroRNA and cancer–a brief overview. Adv Biol Regul. 2015;57:1–9.
Garofalo M, Romano G, Di Leva G, Nuovo G, Jeon YJ, Ngankeu A, et al. EGFR and MET receptor tyrosine kinase-altered microRNA expression induces tumorigenesis and gefitinib resistance in lung cancers. Nat Med. 2011;18(1):74–82.
Acunzo M, Romano G, Palmieri D, Lagana A, Garofalo M, Balatti V, et al. Cross-talk between MET and EGFR in non-small cell lung cancer involves miR-27a and Sprouty2. Proc Natl Acad Sci U S A. 2013;110(21):8573–8.
Acunzo M, Visone R, Romano G, Veronese A, Lovat F, Palmieri D, et al. miR-130a targets MET and induces TRAIL-sensitivity in NSCLC by downregulating miR-221 and 222. Oncogene. 2012;31(5):634–42.
Garofalo M, Di Leva G, Romano G, Nuovo G, Suh SS, Ngankeu A, et al. miR-221&222 regulate TRAIL resistance and enhance tumorigenicity through PTEN and TIMP3 downregulation. Cancer Cell. 2009;16(6):498–509.
Nishikura K. A-to-I editing of coding and non-coding RNAs by ADARs. Nat Rev Mol Cell Biol. 2016;17(2):83–96.
Kawahara Y, Zinshteyn B, Sethupathy P, Iizasa H, Hatzigeorgiou AG, Nishikura K. Redirection of silencing targets by adenosine-to-inosine editing of miRNAs. Science. 2007;315(5815):1137–40.
Kume H, Hino K, Galipon J, Ui-Tei K. A-to-I editing in the miRNA seed region regulates target mRNA selection and silencing efficiency. Nucleic Acids Res. 2014;42(15):10050–60.
Wang Y, Xu X, Yu S, Jeong KJ, Zhou Z, Han L, et al. Systematic characterization of A-to-I RNA editing hotspots in microRNAs across human cancers. Genome Res. 2017;27(7):1112–25.
Romano G, Nigita G, Calore F, Saviana M, Le P, Croce CM, et al. MiR-124a Regulates Extracellular Vesicle Release by Targeting GTPase Rabs in Lung Cancer. Front Oncol. 2020;10:1454.
Rehmsmeier M, Steffen P, Hochsmann M, Giegerich R. Fast and effective prediction of microRNA/target duplexes. RNA. 2004;10(10):1507–17.
Krepl M, Otyepka M, Banas P, Sponer J. Effect of guanine to inosine substitution on stability of canonical DNA and RNA duplexes: molecular dynamics thermodynamics integration study. J Phys Chem B. 2013;117(6):1872–9.
Zhang Y, Xia M, Jin K, Wang S, Wei H, Fan C, et al. Function of the c-Met receptor tyrosine kinase in carcinogenesis and associated therapeutic opportunities. Mol Cancer. 2018;17(1):45.
Viticchie G, Muller PAJ. c-Met and Other Cell Surface Molecules: Interaction, Activation and Functional Consequences. Biomedicines. 2015;3(1):46–70.
Zhang HM, Li L, Papadopoulou N, Hodgson G, Evans E, Galbraith M, et al. Mitogen-induced recruitment of ERK and MSK to SRE promoter complexes by ternary complex factor Elk-1. Nucleic Acids Res. 2008;36(8):2594–607.
Cavigelli M, Dolfi F, Claret FX, Karin M. Induction of c-fos expression through JNK-mediated TCF/Elk-1 phosphorylation. EMBO J. 1995;14(23):5957–64.
Errico MC, Felicetti F, Bottero L, Mattia G, Boe A, Felli N, et al. The abrogation of the HOXB7/PBX2 complex induces apoptosis in melanoma through the miR-221&222-c-FOS pathway. Int J Cancer. 2013;133(4):879–92.
Whitmarsh AJ, Davis RJ. Transcription factor AP-1 regulation by mitogen-activated protein kinase signal transduction pathways. J Mol Med (Berl). 1996;74(10):589–607.
Iavarone C, Catania A, Marinissen MJ, Visconti R, Acunzo M, Tarantino C, et al. The platelet-derived growth factor controls c-myc expression through a JNK- and AP-1-dependent signaling pathway. J Biol Chem. 2003;278(50):50024–30.
Vartanian R, Masri J, Martin J, Cloninger C, Holmes B, Artinian N, et al. AP-1 regulates cyclin D1 and c-MYC transcription in an AKT-dependent manner in response to mTOR inhibition: role of AIP4/Itch-mediated JUNB degradation. Mol Cancer Res. 2011;9(1):115–30.
Baldacci S, Kherrouche Z, Cockenpot V, Stoven L, Copin MC, Werkmeister E, et al. MET amplification increases the metastatic spread of EGFR-mutated NSCLC. Lung Cancer. 2018;125:57–67.
Cross DA, Ashton SE, Ghiorghiu S, Eberlein C, Nebhan CA, Spitzler PJ, et al. AZD9291, an irreversible EGFR TKI, overcomes T790M-mediated resistance to EGFR inhibitors in lung cancer. Cancer Discov. 2014;4(9):1046–61.
Eberhard DA, Johnson BE, Amler LC, Goddard AD, Heldens SL, Herbst RS, et al. Mutations in the epidermal growth factor receptor and in KRAS are predictive and prognostic indicators in patients with non-small-cell lung cancer treated with chemotherapy alone and in combination with erlotinib. J Clin Oncol. 2005;23(25):5900–9.
Ferrer I, Zugazagoitia J, Herbertz S, John W, Paz-Ares L, Schmid-Bindert G. KRAS-Mutant non-small cell lung cancer: From biology to therapy. Lung Cancer. 2018;124:53–64.
Singh A, Greninger P, Rhodes D, Koopman L, Violette S, Bardeesy N, et al. A gene expression signature associated with "K-Ras addiction" reveals regulators of EMT and tumor cell survival. Cancer Cell. 2009;15(6):489–500.
Rosell R, Moran T, Queralt C, Porta R, Cardenal F, Camps C, et al. Screening for epidermal growth factor receptor mutations in lung cancer. N Engl J Med. 2009;361(10):958–67.
Shi Y, Au JS, Thongprasert S, Srinivasan S, Tsai CM, Khoa MT, et al. A prospective, molecular epidemiology study of EGFR mutations in Asian patients with advanced non-small-cell lung cancer of adenocarcinoma histology (PIONEER). J Thorac Oncol. 2014;9(2):154–62.
Wu SG, Shih JY. Management of acquired resistance to EGFR TKI-targeted therapy in advanced non-small cell lung cancer. Mol Cancer. 2018;17(1):38.
Deng L, Vallega KA, Zhang S, Shi P, Sun SY. MET inhibition downregulates DR4 expression in MET-amplified lung cancer cells with acquired resistance to EGFR inhibitors through suppressing AP-1-mediated transcription. Neoplasia. 2021;23(8):766–74.
Martinelli E, Morgillo F, Troiani T, Ciardiello F. Cancer resistance to therapies against the EGFR-RAS-RAF pathway: The role of MEK. Cancer Treat Rev. 2017;53:61–9.

There is NO conflict of interest to disclose.

Download PDF

Editorial decision: revise
10 Oct, 2022
Review #1 received at journal
09 Oct, 2022
Review #2 received at journal
12 Sep, 2022
Reviewer #2 agreed at journal
02 Sep, 2022
Reviewer #1 agreed at journal
02 Sep, 2022
Reviewers invited by journal
01 Sep, 2022
Submission checks completed at journal
15 Aug, 2022
Editor assigned by journal
12 Aug, 2022
First submitted to journal
12 Aug, 2022

You are reading this latest preprint version

A-to-I edited miR-411-5p targets MET and promotes TKI response in NSCLC

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Cell culture, transfection, and chemicals

Western blot analysis

Antibody used for western blot analysis

RNA extraction

Real-time qRT-PCR

Luciferase assay

Cell death and cell proliferation assays

Growth density assay

Apoptosis

Differential expression analysis after edited miR-411-5p transfections

Edited miR-411-5p targeting prediction for MET and c-Fos genes

Pathway enrichment analysis after edited miR-411-5p transfection in H1299 and H520 cell lines

Results

Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1