High-intensity interval training relieves osteoarthritis-induced neuropathic pain through promoting the polarization of M1 to M2 in microglia via the Jak2/Stat3 pathway in rats

doi:10.21203/rs.3.rs-1960187/v1

Download PDF

Research Article

High-intensity interval training relieves osteoarthritis-induced neuropathic pain through promoting the polarization of M1 to M2 in microglia via the Jak2/Stat3 pathway in rats

https://doi.org/10.21203/rs.3.rs-1960187/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Objective: Osteoarthritis (OA)-induced neuropathic pain is closely related to microglial polarization in the central nervous system. This study aimed to determine whether high-intensity interval training (HIIT) could relieve neuropathic pain and promote the polarization of M1 to M2 in microglia through the Jak2/Stat3 pathway in OA rats.

Methods: Wistar rats received intra-articular injection of monosodium iodoacetate for an OA model. After four weeks, moderate-intensity continuous training (MICT) or HIIT was conducted consecutively for six weeks. Pain threshold was measured by the von Frey test. The degree of cartilage damage was analyzed by magnetic resonance imaging and safranin-O staining. Tmem119, substance P (SP), Vglut2, c-Fos, and IL6 were detected by immunofluorescence. The CD68 and CD163 were analyzed by flow cytometry. The proteomics sequencing and quantitative real-time polymerase chain reaction analyzed the differences in protein and mRNA expression levels between MICT and HIIT groups. Intraperitoneal injection of C-A1 activated the Jak2/Stat3 pathway in OA rats, followed by HIIT treatment, and pain neurotransmitters were detected by Western blotting.

Results: The pain threshold was significantly decreased from third weeks to tenth weeks in OA rats. HIIT treatment promoted the polarization of M1 to M2 in microglia and down-regulated Tmem119, SP, Vglut2, c-Fos, and IL6. Moreover, HIIT suppressed Jak2 and Stat3 expression levels when compared with MICT rats. The pain threshold and pain neurotransmitters were lower in C-A1+HIIT rats than in C-A1 rats.

Conclusions: HIIT relieves OA-induced neuropathic pain and promotes the polarization of M1 to M2 in microglia through the Jak2/Stat3 pathway.

HIIT

microglia

neuropathic pain

osteoarthritis

polarization

Osteoarthritis (OA) is the most common musculoskeletal disease among middle-aged and elderly people. With the increase in susceptible factors (such as aging and obesity) over time, the prevalence of OA has reached 7% [1]. Pain is the main clinical manifestation of OA, often accompanied by varying degrees of limited joint mobility, deformity, and peripheral muscle weakness [2]. Pain is mainly related to the infiltration of proinflammatory factors in the intra-articular environment. Neurons in the posterior horn of the spinal cord are sensitive to inflammatory factors and pain-causing neurotransmitters, both of which in turn lead to increased neuronal excitability and aggravated neuropathic pain [3, 4]. Neuropathic pain caused by OA is positively correlated with intractable synovitis of the knee joint with repeated effusion and bone marrow edema, which stimulates the central nervous system (CNS) to release neurotransmitters [5]. Moreover, patients become more and more sensitive to pain and also fail to pain-killer drugs with the progression of OA [6]. High-intensity interval training (HIIT) is a type of physical therapy that not only relieves pain but also strengthens muscles around joints, thereby delaying the progression of OA [7]. However, the mechanisms of action by which HIIT would alleviate OA-induced neuropathic pain are needed to elucidate to further provide substantial evidence for use of HIIT in the treatment of OA in clinical settings.

Microglia are one of the glial cells, which are the main components of the innate immune system of the nervous tissues and the first line of defense in the CNS [8]. Nociceptive factors activate microglia in the CNS, manifesting as proliferation and migration. Activated microglia are mainly divided into M1- and M2-type microglia. M1 promotes the release of proinflammatory factors, such as TNF-α, IL-1β, and IL-6, leading to cell death and tissue damage. By contrast, M2 plays a neuroprotective role and releases anti-inflammatory factors, such as IL-10, IL-4, and TGF-β, all of which inhibit neuroinflammation and promote tissue repair [9–11]. Recently, a large number of studies have shown that promoting the polarization of M1 to M2 in microglia is the key idea for relieving chronic neuropathic pain and exerting neuroprotective effects [12–14].

The Janus kinase 2 (Jak2)/ signal transducer and activator of transcription 3 (Stat3) pathway is involved in microglia activation and regulation of neuropathic pain [15]. In addition, the Jak2/Stat3 pathway is also involved in various pathophysiological processes, such as inflammation regulation, and apoptosis, and has become a hotspot in the field of cytokine research [16]. When the Jak2/Stat3 pathway was inhibited, the inflammatory response mediated by microglia was attenuated and thus inflammatory pain would be alleviated [17]. Some studies have shown that exercise training can modulate the Jak2/Stat3 pathway. For example, in a rat model of myocardial infarction, exercise improved myocardial infarct size and fibrosis via Jak2/Stat3 [18]. In a mouse model of asthma, aerobic exercise participated in the regulation of airway inflammation through the Jak2/Stat3 signaling pathway, remodeling the effect of airway hyperresponsiveness [19]. Endurance exercise also increased the expression of Jak2 and Stat3 in the hypothalamus, thereby activating leptin signaling [20]. However, whether HIIT could activate microglial polarization through Jak2/Stat3 has not been elucidated.

Chronic neuropathic pain caused by OA is not only mediated by joint structure and inflammation, more evidence suggested that microglia activation in the CNS is also involved in the regulation of pain [4, 21–23]. In this study, we established a rat model of OA to verify the existence of neuropathic pain in chronic OA and to determine whether HIIT could promote the polarization of M1 to M2 in microglia through the Jak2/Stat3 signaling pathway, thereby reducing release of pain neurotransmitters and inflammatory factors.

Experimental animals

The adult male Wistar rats, weighed 250–300 g, aged 8 week old, were purchased from the Laboratory Animal Center of Nanjing First Hospital (Jiangsu, China). They were housed under the constant temperature and humidity (24 ± 2 ℃, and 50 ± 5%). All animals were housed in group of 3 per cage (cage type: 46cm×35cm×20cm ventilated cage). All rats were euthanized by intraperitoneal injection of 10% chloral hydrate after the behavioral experiments. All animal experiments were approved by the experimental Animal Welfare and Ethics Committee, Nanjing First Hospital (Nanjing, Jiangsu, China).

Experimental design

A total of 102 rats were included in the four experiments of this study. The experimental timeline and the sample size of rats were illustrated in Fig. 1. Experiment 1 included control rats (n = 6) and OA rats (n = 6). Experiment 2 included 24 OA rats and were randomly divided into moderate-intensity continuous training group (MICT, n = 12), and HIIT group (n = 12). MICT and HIIT treatment were conducted at week 4 and continued for 6 weeks (5 times per week). Experiment 3 included 12 OA rats and were randomly divided into MICT group (n = 6), and HIIT group (n = 6). After 6 weeks of exercise, the brain tissue was harvested and analyzed by proteomics sequencing and quantitative real-time polymerase chain reaction (qRT-PCR). Experimental 4 included 54 OA rats and were randomly divided into OA + NS (0.9% normal saline) group (n = 18), OA + C-A1 (MCE, New Jersey, USA) group, and OA + C-A1 + HIIT group (n = 18). JAK2/STAT3 pathway agonist C-A1 was administered by intraperitoneal injection (100ug/kg) once a day for 28 days [24]. Meanwhile, OA rats were treated with HIIT starting at fourth week.

Rat model of OA

After five days of adaptive feeding, all rats were anesthetized with 10% chloral hydrate. OA group rats (n = 96) was injected monosodium iodoacetate (MIA, 1 mg/50µL, 50µL, Sigma-Aldrich) into the right knee intraarticularly. Control group (n = 6) received an intraarticular injection of equal volume of NS (50µL) [25].

Pain threshold testing

Pain threshold was measured by the von Frey testing (NC12775-99, North Coast, NewYork USA). The mechanical withdrawal threshold (MWT) was one of the main indicators used to evaluate pain threshold. Briefly, we placed the rats in a chamber with a wire mesh floor (22 × 12 × 12 cm³ ) and acclimated to the environment for 20 min. The plantar surface of the right hind paw was stimulated by von Frey filaments ranging from 2.0 to 15.0 g in sequence. The MWT value was recorded while withdrawing the paw. The results were presented as the following formula:

50% threshold (g) = (10^{[ Xf+ Kδ]}) /10000.

where X_f referred to as the value of the final von Frey filaments, k as coefficient value for the pattern of positive/negative responses, and δ was equal to 0.224[26].

Magnetic Resonance Imaging (MRI)

The knee articular of rats were imaged in the MRI (SkyScan1172 X-ray microtomograph, Antwerp, Belgium) with 5 µm/pixel, 50 kV, 200 µA, and 1600 ms exposure.

Exercise prescription

The OA rats were trained on the treadmill (YS101, Tianjin, China) for one week (10 m/min; 15 min). Exercise intensity was determined by maximal oxygen uptake (VO₂max)[27]. Rats of the HIIT group were received exercise as follows, low-speed running at 15 m/min (45% − 55% VO₂max) for 4 min, followed by high-speed running at 25 m/min (90% − 95% VO₂max) for 1 min and cool-down at a constant speed of 10 m/min for 1 min (9 bouts of exercise/recovery intervals). Rats of the MICT group ran at 15 m/min for the same time schedule as HIIT. Both of exercise prescription were performed in 5 sessions per week for consecutive 6 weeks.

Safranin-O staining

The articular part of the right knee of rats was isolated and then dehydrated, decalcified, and embedded in paraffin. The knee articular tissue was placed in EDTA decalcification (Servicebio, Wuhan, China) solution for decalcification, and the speed of the constant temperature (25℃-30℃) shaker was controlled at 120 rpm. Longitudinal-oriented sections (3 µm each) of the knee joint were cut using a paraffin microtome (RM2265, Leica, Germany) and stained with Safranin O for 1 h. After being soaked in alcohol, slides were stained with fast green staining for 2 h. Finally, the sections were washed with absolute ethanol for 30 s, and then sealed in optical resin.

Immunofluorescence

The brain tissues of rats were fixed 6 h in 4% paraformaldehyde and then embedded in paraffin. Coronal plane of the brain was cut using a paraffin microtome (3 µm each). Primary antibodies used were anti-Tmem119 (1:100, Novus Biologicals, New York, USA), anti-SP (1:100, Santa Cruz Biotechnology, Dallas, Texas, USA), anti-Vglut2 (1:500, Abcam, Cambridge, UK), anti-c-Fos (1:100, Santa Cruz Biotechnology), and anti-IL6 (1:200, Absin, Shanghai, China). The primary antibodies were incubated at 4 ℃ overnight, and subsequently, secondary antibodies were incubated at room temperature for 1 h. Nucleus were then stained by mounting medium with DAPI fluorescent sealing reagent (Elabscience, Wuhan, China) for 3–5 min. The images were observed with a digital pathology image scanner (DM5000B, Leica, Germany).

Flow Cytometry

The expression levels of the M1 (anti-CD68) and M2 (anti-CD163) in the microglial cell of the brain were analyzed by the flow cytometry (Cytomics FC 500, Beckman, USA). The brain tissues were digested by the pancreatin (Beyotime, Shanghai, China) at 37℃ for 5 min. The cell suspension was centrifuged at 1,000 rpm for 5 min, and then transferred to an 1.5-mL EP tube. The total number of cells was 10⁶. The anti-CD68 (1:500, Abcam) and anti-CD163 (1:60, Abcam) were incubated at room temperature for 30 min in the dark. Finally, the expression levels of the anti-CD68 and anti-CD163 were detected by flow cytometer (Cytomics FC 500, Beckman).

Quantitative technique of protein mass spectrometry and KEGG pathway analysis

The protein sequencing and quantification were performed at Guangzhou Omicsmart Corp. Guangzhou, China. The brain samples were treated with lysis buffer (KeyGEN) for 30 min on ice, and then were homogenized using an ultrasonic homogenizer (Voshin, Wuxi, Jiangsu, China) for 2 min. The homogenate was centrifuged at 12000 rpm for 15 min at 4℃ and the supernatant was collected. The protein mass spectrometry was determined by direct data-independent acquisition (dDIA). To explore the biological functions of the different genes involved, gene ontology (GO) terms (http://www.geneontology.org/) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis were performed using the cluster profiler method. The calculated p value was carried out through FDR correction, taking FDR ≤ 0.05 as a threshold. Protein-protein interaction (PPI) network was identified using string, which determined genes as nodes and interaction as lines in a network. The network file was visualized using cytoscape software (version 3.6.1) to present a core and hub gene biological interaction.

qRT-PCR

Total RNA from brain tissues was extracted with Trizol (KeyGEN). The cDNA was first synthesized with a reverse transcription reagent kit (Vazyme Biotech, Piscataway, NJ, USA) according to the manufacturer's instructions. The reagent mixes were prepared with the ChamQ Universal SYBR QPCR Master Mix (Vazyme Biotech) and cDNA was amplified using specific oligonucleotide primers (Table 1). The qRT-PCR was conducted with the PCR System (QTOWER 2.2, Analytik Jena, Germany) using settings of 95°C for 30 s, followed by 40 cycles of 95°C for 10 s, 60°C for 20 s, and a final 72°C for 1 min. The relative expression of target genes was calculated using the 2 ^−ΔΔCT method and normalized to Gapdh.

Table 1

༎ Primer sequences for quantitative real-time polymerase chain reaction in rats.
Gene		Primer sequence (5’→3’)
Gapdh	F	CAAGTTCAACGGCACAGTCA
Gapdh	R	CCCCATTTGATGTTAGCGGG
Stat3	F	AAGGAGGAGGCATTCGGAAA
Stat3	R	ACATCGGCAGGTCAATGGTA
Stat1	F	TTGCCTCTGGAATGATGGGT
Stat1	R	GTGAATGTGATGGCCCCTTC
Grb2	F	ACCAGCAGATATTCCTCCGG
Grb2	R	ATGAAGTCTCCTCGGCGAAA
Jak2	F	AACTGTCACGGCCCAATTTC
Jak2	R	ACGGCAAAGGTCAGGAAGTA
F, forward; R, reverse.

Western blotting (WB)

The protein in the brain tissues was extracted with lysis buffer (KeyGEN, Nanjing, China) and protein concentrations were measured using the BCA assay kit (KeyGEN). An SDS loading buffer (5 ×) was added to the protein samples and denatured at 95 ℃ for 15 min. Protein samples were separated on the 4% − 20% SDS-PAGE gel and then transferred onto PVDF membranes (Immobilon, Shanghai, China). The transferred membranes were blocked with blocking buffer (NCM Biotech, Suzhou, China) for 10 min at ambient temperature. The anti-Jak2 (1:500, Santa Cruz Biotechnology, TX, USA), anti-Stat3 (1:1000, Cell Signaling, Danvers, MA, USA), anti-SP (1:1000), anti-Vglut2 (1:1000), anti-IL6 (1:1000), anti-c-Fos (1:500), and anti-Gapdh ( 1:1000, Abcam) were incubated overnight at 4 ℃. Gapdh was used as a loading control. The secondary antibodies were incubated for 2 h at room temperature. The proteins were visualized using an enhanced chemiluminescence reagent (ThermoFisher) and quantified using the Image 4000 system (Tanon 6600, Beijing, China).

Statistical analysis

The data were presented as mean with 95% confidence intervals (CI) and statistical graphs were performed by the GraphPad Prism 9.0 (GraphPad Software Inc., San Diego, CA, USA). The normality of the data in each group was measured by the Shapiro-Wilk test. Statistical comparisons were performed by the one-way analysis of variance (ANOVA) or independent t-test. Pain threshold data satisfied the assumptions of normality, variance, and sphericity, and repetitive measures ANOVA was used. LSD method was used as a post-hoc test. P < 0.05 was considered statistically significant.

OA induced neuropathic pain and brain microgliosis

OA rats developed neuropathic pain, manifesting as lower in threshold when the hind paw was stimulated by the von Frey test. Compared with control rats, OA rats exhibited significantly decreased MWT from week 3 to 10 (Fig. 2A; P < 0.001, [CI: 6.281,11.41]; P < 0.001, [CI:7.234,11.65]; P < 0.001, [CI: 6.192,10.96]; P < 0.001, [CI: 6.261,9.859]; P < 0.001, [CI: 9.240,11.27]; P < 0.001, [CI: 6.157,10.47]; P < 0.001, [CI:9.141,10.74]; P < 0.001, [CI: 7.849,12.16]). Shown in Fig. 2B was the representative MRI images of the right knee articular of rats, with a white arrow indicative for degeneration of cartilage. To further confirm the degree of cartilage degeneration in OA rats, Safranin O staining was performed. Compared with control rats, OA rats displayed significantly decreased cartilage area (P = 0.0019, [CI:-20.20,-6.133], Fig. 2C-D). Tmem119 was the main indicator of brain microgliosis. We detected Tmem119 in the brain by immunofluorescence between control group and OA group, respectively. The expression level of Tmem119 was significantly higher in OA rats than in control rats (P < 0.001,[CI：70.37，84.12] , Fig. 2E-F).

HIIT promoted the polarization of M1 to M2 in microglia and down-regulated pain factors

To assess the effects of HIIT on microglia polarization and pain in OA rats, microglia phenotype factor and pain neurotransmitter expression in the brain were detected by flow cytometry and immunofluorescence, respectively. The flow cytometry results showed that the expression level of CD68 was lower in the OA-HIIT group than in the OA-MICT group (P < 0.001,[CI：-9.116，-6.854]), but the expression level of CD163 (P = 0.012, [CI：5.995，9.535]) was higher in the OA-HIIT group than in the OA-MICT group (Fig. 3A). In addition, HIIT increased pain threshold of OA rats from week 5 to 10 (Fig. 3B; P = 0.032, [CI：0.280，5.130]; P = 0.002, [CI：2.144，7.392]; P = 0.007, [CI：1.136，5.538]; P < 0.001, [CI：2.940，5.984]; P < 0.001, [CI：2.718，5.125]; P < 0.001, [CI：2.722，5.128]). Moreover, OA-HIIT rats exhibited decreased expression levels of Vglut2 (P = 0.002, [CI: -68.93, -30.78]), c-Fos (P = 0.0121, [CI: -32.70, -7.227]), SP (P = 0.0478, [CI: -39.66, 1.672]), and IL-6 (P = 0.002, [CI: -45.14, -29.21]) compared with OA-MICT rats (Fig. 3C-D).

HIIT suppress JAK2/STAT3 signaling pathway

To elucidate the mechanisms of action by which HIIT would relieve OA-induced neuropathic pain, the protein sequencing approach was used to map the transcriptome after MICT or HIIT treatment in OA model. A total of 32 genes showed significant differences, of which 10 genes were up-regulated and 22 genes were down-regulated when compared OA-HIIT with OA-MICT group (Fig. 4A, E). PPI network shows the interactions between different proteins (Fig. 4B). KEGG pathway analysis was shown in Fig. 4C-D, in which Jak2/Stat3 signaling pathway is closer to HIIT treatment. qRT-PCR analysis verified down-regulation of genes related to HIIT, with the expression levels of Stat3 (P < 0.05,[CI：-1.470，-1.173]), Stat1(P < 0.05,[CI：-0.8795，-0.2721]), Jak2 (P < 0.05,[CI：-2.057，-1.383]), and Grb2 (P < 0.05,[CI：-1.133，-0.7201]) significantly down-regulated in the OA-HIIT group compared with the OA-MICT group (Fig. 4F).

HIIT promoted microglial M2 polarization and relieved pain in OA rats through JAK2/STAT3 pathway

To examine the mechanisms by which HIII would alleviate OA-induced neuropathic pain through Jak2/Stat3 pathway, we activated the Jak2/Stat3 signaling pathway by intraperitoneal injection of C-A1 in OA rats, followed by HIIT treatment. OA rats were randomly divided into three groups, including OA+NS (control group), OA+ C-A1 group, and OA+C-A1+HIIT group (n = 6). The MWT values were compared in the hind paw of rats among three group. Compared with OA+NS rats, intraperitoneal injection of C-A1 significantly decreased MWT from week 6 to 10 after OA. However, the MWT values of C-A1+HIIT rats were higher from week 5 to 10 than those of OA+ C-A1 rats (Fig. 5A; P = 0.0002, [CI: 1.553, 5.867]; P < 0.001, [CI: 5.303,9.617]; P < 0.001, [CI: 6.157,10.47]; P < 0.001, [CI: 5.468,9.782]; P < 0.001, [CI: 2.308,6.622]; P < 0.001, [CI: 1.205,5.518]). The qRT-PCR showed that C-A1 significantly increased the mRNA expression levels of Jak2 (P = 0.0002, [0.2074, 0.4652]) and Stat3 (P < 0.001, [0.3557, 0.5828]), but that HIIT reversed these changesin OA rats (Fig. 5B). Flow cytometry results confirmed the CD68 expression of the OA+ C-A1 rats was higher than that of OA+NS rats (P < 0.001, [5.363, 10.57]), indicating that C-A1 promoted M1 polarization in microglia. The expression levels of CD163 were higher in OA+C-A1+HIIT rats than in OA+ C-A1 rats (P < 0.001, [13.29, 17.10]), indicating that HIIT promoted M2 polarization in microglia (Fig. 5C-D). Subsequently, pain-causing neurotransmitters in microglia of the CNS were measured by Western blotting to determine whether Jak2/Stat3 pathway could affect their release. C-A1 activated the expression of the OA-induced vglut2 (P = 0.0122, [CI: -1.490, -0.2329]), c-Fos (P = 0.0474, [CI: 0.01558, 2.427]), SP (P = 0.014, [CI: 0.0110, 3.617]), and IL-6 (P = 0.0331, [CI: -0.1581, 2.566]) in microglia, while HIIT significantly reversed these changes (Fig. 5E-F).

In the present study, we found the decreased pain threshold with the progression of OA, activated M1-type microglia in the CNS, and increased expression of pain-causing neurotransmitters, suggesting the presence of neuropathic pain. We also demonstrated that HIIT treatment promoted the polarization of M1 to M2 in microglia and thus down-regulated pain neurotransmitter and proinflammatory cytokines. Moreover, Jak2/Stat3 pathway exerts a critical role in microgliosis and neuropathic pain. When we overexpressed Jak2/Stat3 by intraperitoneal injection of C-A1, followed by HIIT exercise, pain neurotransmitter, and proinflammatory cytokines were decreased. Therefore, HIIT promotes the polarization of M1 to M2 in microglia through the Jak2/Stat3 signaling pathway and relieves neuropathic pain.

Microglia activation plays a key role in the development of neuropathic pain. At the early stage of injury, microglia usually differentiate into M1-type and release proinflammatory cytokines. While M2-type microglia can inhibit inflammation and increase antiinflammatory mediators, promoting tissue repair and regulating the neuronal release of pain-causing substances [28–30]. In this study, we found that there was M1-type polarization of microglia in the brain of OA rats, and that HIIT promoted the polarization of microglia from M1 to M2-type, thereby alleviating the OA-induced neuroinflammatory response and suppressing pain. These findings suggest that HIIT exerts a pain-relieving effect by regulating microglia activation and balancing anti-inflammatory and pro-inflammatory cytokines.

OA rats were subjected to MICT and HIIT exercise for six weeks, respectively. The dDIA technology was used to analyze the differences in the protein levels between the two groups. The key proteins, such as Stat1, Stat2, Stat5b, Stat6, Sos1, and Pdgfrb, were found through PPI, and most genes were related to the Stat family. Then we analyzed the top 20 pathways between the two groups by KEGG enrichment, among which the pathway Jak2/Stat3 was screened. Previous studies have shown that microglial activation was affected by multiple pathways, and activation of Jak2/Stat3 pathway may be the main pathway leading to microglial polarization [31, 32]. We found that HIIT can reduce the expression of Jak2 and Stat3. To demonstrate that HIIT mediates microglial activation through the Jak2/Stat3 pathway. We activated the Jak/Stat pathway by intraperitoneal injection of C-A1 and then provided HIIT intervention. Our results suggest that HIIT promoted the polarization of microglia from M1 to M2-type in CNS, and that the expression levels of inflammatory factors and pain neurotransmitters were down-regulated. Taken together, HIIT promotes the polarization of M1 to M2 in microglia through the Jak2/Stat3 signaling pathway and affects the release of pain-causing neurotransmitters and proinflammatory cytokines.

A major limitation of this study is the lack of effects of proinflammatory cytokines in the joint synovium of OA rats on neuropathic pain. Neuropathic pain caused by OA is mediated by a variety of factors, including changes in joint structure [33], secretion of proinflammatory cytokines in articular cartilage, synovium, and muscles [34, 35], and release of neurotransmitters from peripheral and central neurons [36], microglia phenotype transformation, and ion channel changes [37]. The management of OA pain needs to be considered comprehensively. As a simple and non-invasive treatment method, HIIT can not only reduce levels of inflammatory cytokines and pain neurotransmitters in the CNS, but also improve muscle strength and further delay the degeneration of articular cartilage [38, 39]. Compared with regular exercise, HIIT has the highest level of exercise efficiency and exercise performance [40], providing new insights into the molecular mechanisms and diagnosis and treatment for OA.

In conclusion, our findings provide substantial evidence that HIIT improves OA-associated neuropathic pain through regulation of the polarization of M1 to M2 in microglia via the Jak2/Stat3 signaling pathway.

Acknowledgments

We thank the National Natural Science Foundation of China (No.82072541) for financial support. Thanks to MogoEdit (https://www.mogoedit.com) for its English editing during the preparation of this manuscript.

Contributions

XW, PX and XL conceived and designed the study. XW analyzed data and wrote the manuscript. XW, FK and YS performed the experiments. PX and QL reviewed and edited the manuscript. KC and AC provided technical and logistic support. All authors read and approved the final version of the manuscript.

Role of the funding source

National Natural Science Foundation of China (No.82072541) provided experimental funds, including laboratory supplies and reagents.

Competing interests

The authors declare that they have no competing interests.

Leifer VP, Katz JN, Losina E. The burden of OA-health services and economics. Osteoarthritis Cartilage, 2021,30(1):10–16.
Driban JB, Harkey MS, Barbe MF, et al. Risk factors and the natural history of accelerated knee osteoarthritis: a narrative review. BMC Musculoskelet Disord, 2020. 21(1): 332.
Dimitroulas T, Duarte RV, Behura A, et al. Neuropathic pain in osteoarthritis: a review of pathophysiological mechanisms and implications for treatment. Semin Arthritis Rheum, 2014. 44(2):145–54.
Mease PJ, Hanna S, Frakes EP, et al. Pain Mechanisms in Osteoarthritis: Understanding the Role of Central Pain. J Rheumatol, 2011. 38(8):1546–1551.
Zhang Y, Nevitt M, Niu J, et al. Fluctuation of knee pain and changes in bone marrow lesions, effusions, and synovitis on magnetic resonance imaging. Arthritis Rheum, 2011. 63(3): 691–699.
Staud, R. Peripheral and central mechanisms of fatigue in inflammatory and noninflammatory rheumatic diseases. Curr Rheumatol Rep, 2012. 14(6): 539–48.
Townsend K, Imbert I, Eaton V, et al. Voluntary exercise blocks ongoing pain and diminishes bone remodeling while sparing protective mechanical pain in a rat model of advanced osteoarthritis pain. Pain, 2022,163(3):476–487.
Hanani M, Verkhratsky A. Satellite Glial Cells and Astrocytes, a Comparative Review. Neurochem Res., 2021. 46(10): 2525–2537.
Ma L, Peng S, Wei J, et al. Spinal microglial β-endorphin signaling mediates IL-10 and exenatide-induced inhibition of synaptic plasticity in neuropathic pain. CNS Neurosci Ther, 2021. 27(10): 1157–1172.
Guo A, Li J, Luo L, et al. Valproic acid mitigates spinal nerve ligation-induced neuropathic pain in rats by modulating microglial function and inhibiting neuroinflammatory response. International Immunopharmacology, 2021. 92: 107332.
Pan TT, Pan F, Gao W, et al. Involvement of Macrophages and Spinal Microglia in Osteoarthritis Pain. Curr Rheumatol Rep, 2021. 23(5): 29.
Sun ZQ, Liu JF, Luo W, et al. Lycium barbarum extract promotes M2 polarization and reduces oligomeric amyloid-β-induced inflammatory reactions in microglial cells. Neural Regen Res, 2022, 17(1): 203–209.
Borgonetti V, Galeotti N. Intranasal delivery of an antisense oligonucleotide to the RNA-binding protein HuR relieves nerve injury-induced neuropathic pain. Pain, 2021, 162(5): 1500–1510.
Zhong Z, Chen A, Fa Z, et al. Bone marrow mesenchymal stem cells upregulate PI3K/AKT pathway and down-regulate NF-κB pathway by secreting glial cell-derived neurotrophic factors to regulate microglial polarization and alleviate deafferentation pain in rats. Neurobiol Dis, 2020, 143: 104945.
Li D, Yan Y, Yu L, et al. Procaine Attenuates Pain Behaviors of Neuropathic Pain Model Rats Possibly via Inhibiting JAK2/STAT3. Biomol Ther (Seoul), 2016, 24(5): 489–94.
Hao Y, Yang X, Chen C, et al. STAT3 signalling pathway is involved in the activation of microglia induced by 2.45 GHz electromagnetic fields. Int J Radiat Biol, 2010, 86(1): 27–36.
Yu S, Zhao G, Han F, et al. Muscone relieves inflammatory pain by inhibiting microglial activation-mediated inflammatory response via abrogation of the NOX4/JAK2-STAT3 pathway and NLRP3 inflammasome. International Immunopharmacology, 2020, 82: 106355.
Zhang L, Wang X, Zhang H, et al. Exercise-induced peptide EIP-22 protect myocardial from ischaemia/reperfusion injury via activating JAK2/STAT3 signalling pathway. Cell Mol Med, 2021, 25(7): 3560–3572.
Almeida-Oliveira AR, Aquino-Junior J, Abbasi A, et al. Effects of aerobic exercise on molecular aspects of asthma: involvement of SOCS-JAK-STAT. Exerc Immunol Rev, 2019, 25: 50–62.
Zhao J, Tian Y, Xu J, et al. Endurance exercise is a leptin signaling mimetic in hypothalamus of Wistar rats. Lipids Health Dis., 2011,10: 225.
Dimitroulas T, Duarte RV, Behura A, et al. Neuropathic pain in osteoarthritis: A review of pathophysiological mechanisms and implications for treatment. Seminars in arthritis and rheumatism, 2014, 44(2): 145–154.
Balbinot G, Schuch CP, Nascimento PSD, et al. Photobiomodulation therapy partially restores cartilage integrity and reduces chronic pain behavior in a rat model of osteoarthritis: involvement of spinal glial modulation. Cartilage, 2021,13(2):1309–1321.
Hahm SC, Lee JS, Yoon YW, et al. Analgesic tolerance development during repetitive electric stimulations is associated with changes in the expression of activated microglia in rats with osteoarthritis. Biomedicines, 2020, 8(12).
Liu GL, Liu J, Wang JS, et al. Bulleyaconitine a attenuates oxaliplatin-induced neuropathic pain by down-regulating Nav1.6 expression through JAK2/STAT3 signaling pathway. Chinese Journal of Pathophysiology, 2021, 37(9): 1628–1635.
Amodeo G, Niada S, Moschetti G, et al. Secretome of human adipose-derived mesenchymal stem cell relieves pain and neuroinflammation independently of the route of administration in experimental osteoarthritis. Brain, Behavior, and Immunity, 2021. 94: 29–40.
Mazzitelli M, akhnitsa V, Neugebauer B, et al. Optogenetic manipulations of CeA-CRF neurons modulate pain- and anxiety-like behaviors in neuropathic pain and control rats. Neuropharmacology, 2022, 210: 109031.
Li F, Sun L, Wu DS, et al. Proteomics-based identification of different training adaptations of aged skeletal muscle following long-term high-intensity interval and moderate-intensity continuous training in aged rats. Aging (Albany NY), 2019, 11(22): 10781–10782.
Scholz J, Woolf C. The neuropathic pain triad: neurons, immune cells and glia. Nat Neurosci, 2007, 10(11): 1361–8.
Wang X, Jiang Y, Li J, et al. DUSP1 promotes microglial polarization toward M2 phenotype in the medial prefrontal cortex of neuropathic pain rats via inhibition of MAPK Pathway. ACS Chem Neurosci, 2021, 12(6): 966–978.
Lively S, Schlichter L. Microglia responses to pro-inflammatory stimuli (LPS, IFNγ + TNFα) and reprogramming by resolving cytokines (IL-4, IL-10). Front Cell Neurosci., 2018, 12: 215.
Pisanu A, Lecca D, Mulas G, et al. Dynamic changes in pro- and anti-inflammatory cytokines in microglia after PPAR-γ agonist neuroprotective treatment in the MPTPp mouse model of progressive Parkinson's disease. Neurobiol Dis, 2014, 71: 280–91.
Dominguez E, Rivat C, Pommier B, et al. JAK/STAT3 pathway is activated in spinal cord microglia after peripheral nerve injury and contributes to neuropathic pain development in rat. Neurochem, 2008, 107(1): 50–60.
Allen K, Walsh D. Modelling pathology: pain relationships in osteoarthritis. Osteoarthritis Cartilage, 2021, 29(10): 1386–1388.
Xia P, Wang X, Wang Q, et al. Low-intensity pulsed ultrasound promotes autophagy-mediated migration of mesenchymal stem cells and cartilage repair. Cell Transplantation, 2021, 30: 963689720986142.
Chiu YS, Bamodu OA, Fong IH, et al. The JAK inhibitor tofacitinib inhibits structural damage in osteoarthritis by modulating JAK1/TNF-alpha/IL-6 signaling through Mir-149-5p. Bone, 2021, 151: 116024.
Soni A, Wanigasekera V, Mezue M, et al. Central sensitization in knee osteoarthritis: relating presurgical brainstem neuroimaging and painDETECT-based patient stratification to arthroplasty outcome. Arthritis & Rheumatology, 2019, 71(4): 550–560.
Pitake S, Middleton LJ, Abdus-Saboor I, et al. Inflammation Induced Sensory Nerve Growth and Pain Hypersensitivity Requires the N-Type Calcium Channel Cav2.2. Frontiers in Neuroscience, 2019, 13:1009.
Holm PM, Petersen KK, Wernbom M, et al. Strength training in addition to neuromuscular exercise and education in individuals with knee osteoarthritis-the effects on pain and sensitization. Eur J Pain, 2021, 25(9): 1898–1911.
Hall M, Dobson F, Van Ginckel A, et al. Comparative effectiveness of exercise programs for psychological well-being in knee osteoarthritis: A systematic review and network meta-analysis. Semin Arthritis Rheum, 2021, 51(5): 1023–1032.
Keogh JW, Grigg J, Vertullo CJ. Is high-intensity interval cycling feasible and more beneficial than continuous cycling for knee osteoarthritic patients? Results of a randomised control feasibility trial. PeerJ, 2018, 6: 4738.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

High-intensity interval training relieves osteoarthritis-induced neuropathic pain through promoting the polarization of M1 to M2 in microglia via the Jak2/Stat3 pathway in rats

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Experimental animals

Experimental design

Rat model of OA

Pain threshold testing

Magnetic Resonance Imaging (MRI)

Exercise prescription

Safranin-O staining

Immunofluorescence

Flow Cytometry

Quantitative technique of protein mass spectrometry and KEGG pathway analysis

qRT-PCR

Western blotting (WB)

Statistical analysis

Results

OA induced neuropathic pain and brain microgliosis

HIIT promoted the polarization of M1 to M2 in microglia and down-regulated pain factors

HIIT suppress JAK2/STAT3 signaling pathway

HIIT promoted microglial M2 polarization and relieved pain in OA rats through JAK2/STAT3 pathway

Discussion

Declarations

References

Additional Declarations

Status:

Version 1