Cloning, Characterization, and Heterologous Expression of a Candidate Hirudin Gene from the Salivary Gland Transcriptome of Hirudo nipponia

doi:10.21203/rs.3.rs-1963215/v1

Download PDF

Article

Cloning, Characterization, and Heterologous Expression of a Candidate Hirudin Gene from the Salivary Gland Transcriptome of Hirudo nipponia

https://doi.org/10.21203/rs.3.rs-1963215/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 27 Mar, 2023

Read the published version in Scientific Reports →

You are reading this latest preprint version

Gene cloning and rapid amplification of cDNA ends (RACE) were used to determine the full-length cDNA sequence of a previously reported candidate hirudin gene (c16237_g1) in the salivary gland transcriptome of Hirudo nipponia Whitman. The 489-bp cDNA sequence (GenBank accession number: MN 116511) was predicted to encode an 83-aa polypeptide (including a 20-aa signal peptide sequence) and to possess several properties of the hirudin “core” motifs associated with binding to the thrombin catalytic pocket—including CLC and a GSNV region conservatively replaced by the chemically similar NSNL in H. nipponia. All six cysteine residues, presumably involved in three disulfide bonds, were also evolutionarily conserved. The putative protein’s aa sequence showed 62% (E-value = 2e-13), 54% (E-value = 6e-14), and 53% (E-value = 5e-13) similarity to HV3 (PA) (ALA22935.1), HV1 (VV) (ALA22934.1), and HV2 (ALA14576.1) sequences of H. medicinalis Linnaeus, respectively. A fusion expression vector (pPIC9K-Hirudin) was constructed to successfully produce GS115 transformants (GS115/pPIC9K-Hirudin). This confirmed candidate protein expression under inductive conditions, with antithrombin activity of 800 ATU/mL. These findings provide a basis for further elucidating the molecular anticoagulation mechanism of hirudin, helping fill China’s current commercial gap for engineered H. nipponia hirudin and meeting the considerable demand for hirudin-based clinical drugs, including products that target important cardiovascular and cerebrovascular diseases.

leech

traditional Chinese medicine

recombinant protein

yeast expression system

anticoagulant

Hirudo nipponia is a blood-sucking leech with significant medicinal value in traditional Chinese medicine, first recorded in the classic book on Chinese Materia Medica, Shen-Nong-Ben-Cao-Jing (ca. 100 AD)^1–3. Hirudo nipponia has been widely used to treat cardiovascular and cerebrovascular diseases, as well as cerebral thrombosis, coronary heart disease, and cerebral edema^4–6. Hirudo nipponia is also listed in the Pharmacopoeia of the People’s Republic of China owing to its powerful antithrombin activity⁷.

One of the main pharmacologically active substances in blood-sucking leaches is hirudin, which is a naturally occurring peptide produced in the salivary glands with a blood anticoagulant property, representing the strongest natural thrombin-specific inhibitor identified to date^8–11. Hirudin and several hirudin analogues have also been demonstrated to have specific anticoagulant effect and are widely used in clinical setting. Among these, two recombinant hirudins and a hirudin analogue have gained marketing approval from the United States Food and Drug Administration, for various applications¹². The anticoagulant activity of H. nipponia was reported to be significantly higher than that of the other two leech species (Whitmania pigra Whitman and Whitmania acranulata Whitman) listed in the Pharmacopoeia of the People’s Republic of China¹³.

Wild H. nipponia have experienced sharp population reduction due to environmental pollution, over-harvesting, and large-scale habitat destruction, resulting in a lack of raw material resources to meet the high demand for hirudin^13,14. Despite progress in artificial breeding, the industrialized production of this medicinal leech has yet to be realized¹³. Thus, safe and effective means of hirudin production are needed to prevent endangering wild H. nipponia in nature, thereby preventing the depletion of natural resources while simultaneously promoting the modernization of traditional Chinese medicine. From this point of view, utilizing genetically engineered microorganisms to produce recombinant hirudin has proven an effective strategy^15–17.

Natural hirudin exists in three isoforms (HV1, HV2, and HV3), comprising 65 or 66 aa residues with a molecular weight of approximately 7,000 Da^18–22. In recent years, genetic recombinant technology has been used to meet pharmacological and clinical demand through bacterial and eukaryotic expression systems, including Escherichia coli and Pichia pastoris, which secrete recombinant hirudin isolated from H. medicinalis and Hirudinaria manillensis Lesson^{15–18,23−25}. However, few studies have focused on the expression of the hirudin gene and the production of recombinant hirudin from H. nipponia using molecular biotechnology techniques^26,27.

Accordingly, the aims of the present study were to clone and characterize the full-length cDNA sequence of a candidate hirudin gene (c16237_g1), which was identified in our previous study on the salivary gland transcriptome of H. nipponia²⁷. We further aimed to evaluate the use of a eukaryotic expression system for recombinant hirudin production. To the best of our knowledge, this is the first report of a recombinant hirudin protein from H. nipponia. Therefore, this study will lay the foundation for further research into uncovering the molecular anticoagulation mechanism of hirudin; it will also help to fill China’s current market gap for engineered H. nipponia hirudin and meet the huge demand for hirudin-based clinical drugs, including products that target important cardiovascular and cerebrovascular diseases.

Molecular cloning of the Hirudin gene in H. nipponia

Based on the annotated Hirudin transcript in the salivary gland transcriptome data of H. nipponia, one intermediate fragment of 271 bp, a 201-bp fragment amplified by 5′-RACE, and a 217-bp fragment by 3′-RACE (Fig. 1) were assembled by DNASTAR ver. 7.1 to obtain the full-length sequence of Hirudin in H. nipponia. The full-length cDNA of Hirudin was 489 bp, including a 5′-terminal UTR of 123 bp, a 3′-terminal UTR of 114 bp, and a 252-bp ORF encoding a 83-aa protein polypeptide. The complete Hirudin cDNA sequence was deposited in the GenBank database under accession number GenBank MN 116511.

Sequence analysis and multiple sequence alignment of hirudin

The 489-bp full-length cDNA sequence encoded an 83-aa hirudin protein, containing a 20-aa N-terminal signal peptide and 63-aa mature protein sequence (Fig. 2). After removal of the signal peptide, the predicted molecular weight and the theoretical pI of the mature protein were 6.97 kDa and 6.72, respectively. The protein contained eight negatively charged residues (Asp and Glu) and eight positively charged residues (Arg and Lys). The aliphatic index was 37.14 and grand average of hydropathicity was − 1.070.

The homologous protein search using the NCBI-blastp tool in GenBank revealed 62%, 60%, 54%, 53%, 53%, 53%, 52%, and 48% similarities to the H. medicinalis hirudin variant HV3 (PA) (ALA22935.1), Hirudinaria manillensis hirudin variant HV1 (P81492.2), H. medicinalis hirudin variant HV1 (VV) (ALA22934.1), H. medicinalis hirudin variant HV2 (ALA14576.1), Hirudo verbana hirudin variant HV1-VV (APA20831.1), Hirudo orientalis hirudin variant HV3-PAF (APA20857.1), H. manillensis hirudin-HM1 (Q07558.1), and P. manillensis hirudin (CAA51293.1), respectively. The multiple sequence alignment of hirudin is shown in Fig. 2, in accordance with the known structure information in the hirudin database^26,27,28. The highly conserved motif was ³⁴CLC³⁶; the GSNV region was conservatively replaced by the chemically similar ³⁸NSNL⁴¹ sequence in H. nipponia; and six cysteines residues, presumably involved in three disulfide bonds, were also found to be evolutionarily conserved.

Identification of the recombinant plasmid pPIC9K-Hirudin

The positive transformants were screened and digested with EcoRI and NotI. Following double enzyme digestion, two bands were observed in accordance with our expectations, as the recombinant plasmid was 9276 bp in length and the target gene was 252 bp in length. These results indicated that the recombinant plasmid pPIC9K-Hirudin had been constructed successfully (Fig. 3).

PCR detection of the recombinant yeast transformant GS115/pPIC9K-Hirudin

Primers targeting the yeast alcohol oxidase 1 gene (AOX1) were used during PCR amplification. As shown in Fig. 4, two bands were both completely amplified in P. pastoris GS115/pPIC9K and GS115/pPIC9K-Hirudin. A band of approximately the same size (~ 2,200 bp) was identified as the P. pastoris GS115 AOX1 gene^29,30 along with a copy of the recombinant integrated target gene of approximately 755 bp (Fig. 4B). Thus, the PCR results demonstrated that the recombinant plasmid pPIC9K-Hirudin had been successfully transformed into P. pastoris GS115 cells.

Target protein quantification by SDS-PAGE and western blot

Samples were analyzed by SDS-PAGE electrophoresis and western blot after 24 h, 48 h, and 72 h induction. As indicated in the western blot, the specific bands were visualized at approximately 15 kDa (Fig. 5B, C), revealing that the target protein was successfully expressed in the yeast culture supernatants.

Antithrombin activity of hirudin

The antithrombin activity of hirudin in the supernatants of P. pastoris GS115/pPIC9K-Hirudin after 72 h induction reached 800 ATU/mL.

Hirudin is currently the strongest known natural thrombin inhibitor and interacts with thrombin to from a tight equimolar complex^31–34. The structure of a protein determines its physicochemical properties and biological functions, and disulfide bonds play a critical role in protein stability by forming cross-links between different regions of polypeptide chains³⁵. Resolution of the three-dimensional structure of hirudin showed a tightly folded N-terminal globular region formed by three disulfide bonds and a flexible C-terminal tail³⁶. Our analysis revealed that the putative hirudin protein is 6.97 kDa with six cysteine residues, which presumably form three pairs of disulfide bonds, and thus might greatly strengthen and stabilize the tertiary structure of the mature protein³⁷. In addition, multiple sequence alignment demonstrated that the highly conserved “core” motif (³⁴CLC³⁶) is present in the H. nipponia sequence, which is associated with hirudin’s binding to the active center of thrombin to block its hydrolysis activity³⁸. Indeed, natural hirudin loses its anticoagulant properties when degraded or the disulfide bonds are oxidized³⁶.

The methylotrophic yeast P. pastoris has been widely used for producing various heterologous proteins, especially after the release of its genome sequence in 2009³⁹. More than 500 proteins have been successfully expressed in P. Pastoris to date, including a variety of proteins with high medicinal or economic value, such as antibodies and vaccines⁴⁰. High secretory capacity, a strong alcohol oxidase (AOX) promoter, and the existence of a glycosylation pathway are three attractive advantages of yeast over other eukaryotic expression systems^41–43. In this study, the successfully constructed pPIC9K-Hirudin recombinant plasmid was effectively expressed in P. pastoris GS115. In addition, the target protein was secreted into the extracellular space, which was convenient for further protein purification. However, the size of the target protein bands revealed in Fig. 5 were not consistent with the putative molecular weight of hirudin. The factors influencing exogenous gene expression in P. pastoris are complex and diverse, such as the structural, physical and chemical characteristics of the exogenous protein; transformant phenotype; and the induction conditions³⁰. Owing to the structural characteristics of hirudin, which mostly exists as dimers, polymers, a multimeric aggregate appears in the process of SDS-PAGE^44–46. In fact, dimer formation may account for the molecular weight of hirudin protein recovered in the present study, which was much greater than the expected molecular weight (15 kDa, Fig. 5C).

The thrombin titration method has been adopted as a common method to determine the specific activity of recombinant hirudin^6,9,10. Previous studies have identified several complex and varied factors affecting antithrombin activities, including the temperature, incubation time, sample processing methods, and others^6,15,29. Our results showed that the antithrombin activity of hirudin in the supernatants of P. pastoris GS115/pPIC9K-Hirudin after 72 h induction reached 800 ATU/mL, which was significantly higher than that obtained from cultured and wild H. nipponia⁴⁷.

In conclusion, a candidate Hirudin was amplified from the salivary gland transcriptome of H. nipponia, and the resulting predicted amino acid sequence was characterized. Furthermore, a eukaryotic hirudin expression plasmid, P. pastoris GS115/pPIC9K-Hirudin, was successfully constructed and verified by SDS-PAGE and western blot. The antithrombin activity of recombinant hirudin was determined to reach 800 ATU/mL. These results lay the foundation for future studies of hirudin’s structure and properties, the development of anticoagulant drugs, and the large-scale purification of mature hirudin protein for use in commerce and medicine.

Enzymes, vectors, media, and strains

T4 DNA ligase, KOD-Plus-Neo polymerase, EcoRI, NotI, and SacI were purchased from Bao Bioengineering, Co., Ltd. (Dalian, China). PMD18-T vector, pPIC9K vector, and E. coli DH5α were purchased from Shanghai Sangon Biotech Co., Ltd. (Shanghai, China). Minimal dextrose (MD), buffered glycerol-complex (BMGY), and buffered methanol-complex (BMMY) medium were prepared according to the recipe provided in the Invitrogen Pichia pastoris expression kit instruction manual.

Animals and salivary tissue sample collection

All leeches were obtained from an adult H. nipponia colony grown in a medical leech breeding base of the Chongqing Academy of Chinese Materia Medica (Chongqing, China). Fifty healthy leeches were maintained in an aquaculture net cage filled with 15 L dechlorinated tap water at 20–22 °C with a 12h/12h day/night cycle prior to dissection. Every 5 days, half of the water was replaced with fresh water. Salivary tissue masses lying posterior to the three muscular jaws were removed aseptically using a sterilized dissecting tool; subsequently, they were rinsed in 0.5% bleach for 1 min followed by rinsing in deionized water for 1 min⁴⁸^-⁵⁰. The tissues were then stored in RNAlater (Qiagen, Hilden, Germany) according to the manufacturer’s specifications at –80 °C.

RNA extraction and cDNA preparation

Total RNA was extracted from the aforementioned salivary tissues of H. nipponia using Trizol reagent (Tiangen, Beijing, China) according to the manufacturer instructions. RNA quality was assessed by electrophoresis on a 1.0% agarose gel, and RNA concentration was determined using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). First-strand cDNA was synthesized using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, USA).

Molecular cloning of the hirudin gene of H. nipponia

The transcript (c16237_g1) that we previously isolated from the salivary gland transcriptome databases of H. nipponia²⁷ was screened for further analysis. Since this transcript showed the highest homology with the Hirudin variant HV1(VV) (ALA22934.1), with an e-value of 3e-13, we designated this as a Hirudin transcript. Amplification primers were designed using Primer Premier 5 software to clone the coding sequence of Hirudin and synthesized by Shanghai Sangon Co., Ltd. (see Table 1). The cycling parameters were 94 °C for 2 min; followed by 35 cycles of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 30 s; and final extension at 72 °C for 10 min. To obtain full-length cDNA of the Hirudin, rapid amplification of 5′ and 3′ cDNA ends (RACE) was performed using a FirstChoice RLM-RACE Kit (Invitrogen, Waltham, MA, USA) according to the manufacturer’s manual. Pairs of gene-specific primers were designed for 5′ and 3′ RACE polymerase chain reaction (PCR) based on the acquired coding DNA sequence (Table 1).

The PCR products were analyzed on gels, and the bands of interest were excised and purified with MiniBEST Agarose Gel DNA Extraction Kit (Takara Bio Inc., Shiga, Japan). The fragments were subcloned into a pMD-18T vector and sequenced by Shanghai Sangon Co., Ltd.

Sequence analysis and multiple sequence alignment of hirudin

Based on the cloned sequence, the full-length aa sequence of hirudin protein was predicted using ORFfinder (http://www.ncbi.nlm.nih.gov/orffinder/). The molecular weight and theoretical isoelectric point (pI) were predicted using ProtParam (https://www.expasy.org/tools/protparam.html). Protein signal peptides were predicted using the SignalP 6.0 server (https://services.healthtech.dtu.dk/service.php?SignalP). Prediction of the physicochemical properties of the hirudin protein after removal of signal peptides was performed with the ExPASy ProtParam tool (https://web.expasy.org/protparam/).

A protein BLAST (http://www.ncbi.nlm.nih.gov/BLAST) search was performed based on the hirudin aa sequence. The other 17 sequences of hirudin from different leech species were obtained from the National Center for Biotechnology Information (NCBI) website and their relevant information is presented in Table 2. Multiple sequence alignment was accomplished with Clustal W ver. 2.0.10 and GeneDoc ver. 2.7.0.

Construction of pPIC9K-Hirudin recombinant plasmid

The coding sequence of Hirudin was amplified using appropriate primer pairs (Hir-p-F/Hir-p-R; Table 1) and KOD-Plus-Neo polymerase. Thus, appropriate restriction sites for the enzymes EcoRI and NotI as well as protecting bases were added to both ends of the gene. The pPIC9K vector and the PCR product were subjected to 2 h of double enzyme digestion using the same EcoRI and NotI enzymes at 37 °C and ligated with T4 DNA ligase. The recombinant plasmid pPIC9K-Hirudin was then transformed into competent E. coli DH5α cells for amplification. The positive transformants were screened and verified by colony PCR and double enzyme digestion, and the PCR product was analyzed on a 1.5% agarose gel.

Electro-transformation of Pichia pastoris GS115

P. pastoris GS115 competent cells were prepared according to the manual of Invitrogen Corporation. The recombinant expression plasmid was linearized by the SacI restriction enzyme and transformed electronically into P. pastoris GS115. Pichia pastoris GS115 cells harboring pPIC9K-Hirudin were inoculated into 200 μL of MD medium and cultivated for 3 days at 30 °C to screen positive colonies. Single yeast colonies were retrieved from the MD plate using sterile toothpicks. Colony identification was confirmed by PCR using the primers 5′ AOX1 and 3′ AOX1 (Table 1). PCR products were analyzed on a 1.5% agarose gel, and the target bands were excised and purified with MiniBEST Agarose Gel DNA Extraction Kit (Takara). P. pastoris GS115 transformants harboring pPIC9K-Hirudin were designated as GS115/pPIC9K-Hirudin. P. pastoris cells transformed with the empty pPIC9K plasmid were applied as the control and named GS115/pPIC9K.

Induction and expression of recombinant yeast transformants

The yeast clones expressing pPIC9K-Hrudin or pPIC9K were respectively inoculated into a 250-mL bottle containing 50 mL BMGY medium overnight after identified by PCR. The yeast was cultured at 28 ℃ with shaking at 250 rpm until the optical density at 600 nm (A₆₀₀) reached 2–4. The yeast was then collected and induced in 80 mL BMMY medium until the A₆₀₀reached 1.5 and cultured continuously at 28 ℃ for 3 days. During induction, samples were collected every 24 h and methanol was added to a final concentration of 0.05% (v/v). Samples were centrifuged at 12,000 ×g for 2 min at 4 ℃. The supernatant and precipitate were both collected and analyzed by 15% SDS-PAGE as described previously⁵¹.

Western blot analysis

Supernatants and precipitates from GS115/pPIC9K and GS115/pPIC9K-Hirudin were respectively loaded on a 150 g/L SDS-PAGE gel for protein separation and transferred to a polyvinylidene difluoride membrane by electrotransfer (54 mA, 80 min). After blocking with 1.5% BSA in blocking buffer at 4 ℃ overnight, the membrane was incubated with 1000× dilutions of Penta-His antibody (Qiagen) at room temperature for 1 h, washed three times with tris-buffered saline, and mixed with 1000× dilutions of rabbit anti-mouse IgG antibody coupled with horseradish peroxidase (Takara) at room temperature for 1 h. The bands were visualized by TrueBlue Peroxidase Substrate (Takara) for 1 min and then with WesternBright^TM ECL (Takara) for 5 min.

Antithrombin activity analysis

The antithrombin activity of hirudin in the supernatants of P. pastoris GS115/pPIC9K-Hirudin after 72 h induction was evaluated according to the Pharmacopoeia of the People’s Republic of China (2020 edition)⁷ and a previously reported method⁵². Briefly, antithrombin activity was quantitatively measured by titrating a solution of thrombin and expressed in antithrombin units (ATU): one unit is defined as the neutralization of one NIH unit of thrombin (Sigma, Germany) at 37 ℃. For the activity assay, 200 μL of 0.05% bovine fibrinogen solution prepared with 50 mM Tris-HCl buffer (pH 7.4) was thoroughly mixed with 100 μL of the sample, and then 5 μL of 40 NIH/mL thrombin solution (0.2 NIH unit) was added progressively and mixed gently. The above reaction mixture was incubated at 37 ℃ ± 0.5 ℃ for 1 min. The endpoint of the titration was considered to occur when a fibrin clot formed within 1 min. Otherwise, another 5 μL of thrombin solution was added continuously until a fibrin clot was observed.

Ethical approval

We declare that the experiments described in this paper comply with the current laws in China. This article does not contain any studies with human participants performed by any of the authors.

Data availablity

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Acknowledgments

This work was financially supported by the Fundamental Research Funds for the Chongqing Science and Technology Bureau of China (cstc2019jxjl-jbky10009) and the Natural Science Foundation of Chongqing (cstc2018jcyjAX0674).

Author contributions statement

P.S. and J.W. designed the study and prepared the manuscript. P.S. and H.J.Y. conducted the experiments. S.J.C. and F.Y.T. analyzed the data. Z.H.L. supervised the practical and theoretical works. All authors approved the final version before submission.

Competing interests

The authors declare no competing interests.

Dong, H. et al. Chinese Medicinal Leech: Ethnopharmacology, Phytochemistry, and Pharmacological Activities. Evid-Based Compl Alt. 2016, 7895935. http://dx.doi.org/10.1155/2016/7895935 (2016).
Lu, Y. X. et al. Studies on effects of water temperature, stocking density and feeding cycle on growth and feeding in. Hirudo Nipponia. Zhongguo Zhong Yao Za Zhi. 42, 2443–2448. Chinese. (2017).
Shi, P. et al. Study on Reproductive Performance of Hirudo Nipponia. Zhong yao cai. 38, 1144–1147. Chinese. (2015).
Guo, G. Y. et al. Single factor Analysis on Effect of Compound Shuizhi Capsule in Preventing and Treating Atherosclerosis. Lishizhen Med. Mater. Med. Res. 18, 531–532. Chinese. (2007).
Yang, H., Zhang, X., Liu, K., Du, Z., Bai, X. Effects of hirudo on blood metabolism and its related gene expression in blood stasis syndrome rabbits. Chin. J. Mod. Appl. Pharm. 30, 959–963. Chinese. (2013).
Liang, J. Q., Wang, N. S. & Mi, S. Q. The relation between anticoagulant and antithrombotic activity of leech and its variety and extraction method. Chinese Journal of Integrative Medicine on Cardio-/Cerebro Vascular Disease 7, 1096–1098. Chinese. (2009).
Chinese Pharmacopoeia Editorial Committee. The Pharmacopoeia of the People’s Republic of China: part I. (China Medical Science and Technology Press, Beijing, 2020).
Markwardt, F., Sturzebecker, J. & Griessbach, U. Hirudin as an inhibitor of thrombin. Method. Enzymol. 924–932 (1970).
Sawyer, R. T. Thrombolytics and anti-coagulants from leeches. Biotechnology (N Y) 9, 513–515, 518 (1991).
Markwardt, F. The development of hirudin as an antithrombotic drug. Thromb. Res. 74, 1–23 (1994).
Zhang, W., Zhang, R. X., Li, J., Liang, F. & Qian, Z. Z. Species study on Chinese medicine leech and discussion on its resource sustainable utilization. Zhongguo Zhong Yao Za Zhi. 38, 914–918. Chinese. (2013).
Sohn, J. H. et al. Current status of the anticoagulant hirudin: its biotechnological production and clinical practice. Appl. Microbiol. Biotechnol. 57, 606–613 (2001).
Shi, P., Lu, Z., Zeng, W., Chen, S. A research progress and the prospective of Hirudo Nipponia. World Sci. Technol./Modernization Trad. Chin. Med. 18, 2013–2016. Chinese. (2016).
Ding, Q., Qiu, Y. J., Fang, K. H., Hu, H. B. & Wu, Y. Animal drugs quality status and reason analysis. Zhongguo Zhong Yao Za Zhi. 40, 4309–4312. Chinese. (2015).
Li, T. et al. Transcriptomic analysis of the influence of methanol assimilation on the gene expression in the recombinant Pichia pastoris producing hirudin variant 3. Genes. 10, 606 (2019).
Huang, C., Lv, J., Wu, W., Tan, S., Wang X. A new method of secretion and expression of rHV3 in E. coli. J. Southeast Univ. (Med Sci Edi). 30, 877–882. Chinese. (2011).
Lin, C. S. & Chen, W. W. Construction of recombinant secretory hirudin II engineering strains. J. Zhejiang Univ. Technol. 42, 50–53. Chinese. (2014).
Harvey, R. P. et al. Cloning and expression of a cDNA coding for the anticoagulant hirudin from the bloodsucking leech, Hirudo medicinalis. Proc. Natl Acad. Sci. U. S. A. 83, 1084–1088 (1986).
Dodt, J., Müller, H. P., Seemüller, U. & Chang, J. The complete amino acid sequence of hirudin, a thrombin specific inhibitor: application of colour carboxymethylation. FEBS Lett. 165, 180–184 (1984).
Dodt, J., Machleidt, W., Seemüller, U., Maschler, R. & Fritz, H. Isolation and characterization of hirudin isoinhibitors and sequence analysis of hirudin PA. Biol. Chem. Hoppe Seyler 367, 803–811 (1986).
Johnson, P. H., Sze, P., Winant, R., Payne, P. W. & Lazar, J. B. Biochemistry and genetic engineering of hirudin. Semin. Thromb. Hemost. 15, 302–315 (1989).
Greinacher, A. & Warkentin, T. E. The direct thrombin inhibitor hirudin. Thromb. Haemost. 99, 819–829 (2008).
Steiner, V. et al. Primary structure and function of novel o-glycosylated hirudins from the leech Hirudinaria manillensis. Biochemistry 31, 2294–2298 (1992).
Scacheri, E. et al. Novel hirudin variants from the leech Hirudinaria manillensis. Amino acid sequence, cDNA cloning and genomic organization. Eur. J. Biochem. 214, 295–304 (1993).
Tan, E. G. & Liu, X. P. Cloning and sequencing of hirudin gene of Hirudinaria manillensis in Guangdong, China. Acad. J. SUMS. 23, 84–86. Chinese. (2002).
Cheng, B. et al. Identification and characterization of hirudin-HN, a new thrombin inhibitor, from the salivary glands of Hirudo Nipponia. PeerJ. 7, e7716 (2019).
Lu, Z. H., Shi, P., You, H. J., Liu, Y. & Chen, S. Transcriptomic analysis of the salivary gland of medicinal leech Hirudo nipponia. PLOS ONE. 13, e0205875 (2018).
Müller, C., Lukas, P., Sponholz, D. & Hildebrandt, J. P. The hirudin-like factors HLF3 and HLF4-hidden hirudins of European medicinal leeches. Parasitol. Res. 119, 1767–1775 (2020).
Ma, J. C. et al. Construction of a multi-copy secretory expression vector and hirudin expression in Pichia pastoris. Tianjin Med. J. 38, 112–114. Chinese. (2010).
Du, W. et al. Expression of recombinant myostatin propeptide pPIC9K-Msp plasmid in pichia pastoris. Genet. Mol. Res. 14, 18414–18420 (2015).
Johnson, P. H. HIRUDIN: clinical potential of a thrombin inhibitor. Annu. Rev. Med. 45, 165–177 (1994).
Priestle, J. P., Rahuel, J., Rink, H., Tones, M. & Grütter, M. G. Changes in interactions in complexes of hirudin derivatives and human α-thrombin due to different crystal forms. Protein Sci. 2, 1630–1642 (1993).
Chang, J. Y. The functional domain of hirudin, a thrombin-specific inhibitor. FEBS Lett. 164, 307–313 (1983).
Zheng, Q. Y. Research situation of hirudin and recombinant hirudin. Strait Pharm. J. 25, 108–110 (2013).
Fujitani, N. et al. Structure of the antimicrobial peptide tachystatin A.J. J. Biol. Chem. 277, 23651–23657 (2002).
Vitali, J. et al. The structure of a complex of bovine alpha-thrombin and recombinant hirudin at 2.8-A resolution. J. Biol. Chem. 267, 17670–17678 (1992).
Liu, H. & May, K. Disulfide bond structures of IgG molecules: structural variations, chemical modifications and possible impacts to stability and biological function. mAbs. 4, 17–23 (2012).
Rydel, T. J., Tulinsky, A., Bode, W. & Huber, R. Refined structure of the hirudin-thrombin complex. J. Mol. Biol. 221, 583–601 (1991).
Zahrl, R. J., Peña, D. A., Mattanovich, D. & Gasser, B. Systems biotechnology for protein production in Pichia pastoris. FEMS Yeast Res. 17, 15 (2017).
Weinacker, D. et al. Applications of recombinant Pichia pastoris in the healthcare industry. Braz. J. Microbiol. 44, 1043–1048 (2013).
Juturu, V. & Wu, J. C.. Heterologous Protein Expression in Pichia pastoris: Latest Research Progress and Applications. ChemBioChem. 19, 7–21 (2018).
Laukens, B., De Wachter, C. D. & Callewaert, N. Engineering the Pichia pastoris N-glycosylation pathway using the GlycoSwitch technology. Methods Mol. Biol. 1321, 103–122 (2015).
Gasser, B., Steiger, M. G. & Mattanovich, D. Methanol regulated yeast promoters: production vehicles and toolbox for synthetic biology. Microb. Cell Fact. 14, 196 (2015).
Thannhauser, T. W. & Scheraga, H. A. State of aggregation of recombinant hirudin in solution under physiological conditions. J. Protein Chem. 15, 751–753 (1996).
Konno, S., Fenton, J. W. & Villanueva, G. B. Analysis of the secondary structure of hirudin and the mechanism of its interaction with thrombin. Arch. Biochem. Biophys. 267, 158–166 (1988).
Nowak, G. & Schrör, K. Hirudin-the long and stony way from an anticoagulant peptide in the saliva of medicinal leech to a recombinant drug and beyond. A historical piece. Thromb. Haemost. 98, 116–119 (2007).
Pu, D. C., Cao, M. & Yu, M. Study on the growth and anticoagulant activity of Hirudo Nipponia in different cultivation areas. J. Anhui Agric. Sci. 49, 121–123. Chinse. (2021).
Siddall, M. E., Brugler, M. R. & Kvist, S. Comparative transcriptomic analyses of three species of Placobdella (Rhynchobdellida: Glossiphoniidae) confirms a single origin of blood feeding in leeches. J. Parasitol. 102, 143–150 (2016).
Kvist, S., Min, G. S. & Siddall, M. E. Diversity and selective pressures of anticoagulants in three medicinal leeches (Hirudinida: Hirudinidae, Macrobdellidae). Ecol. Evol. 3, 918–933 (2013).
Min, G. S., Sarkar, I. N. & Siddall, M. E. Salivary transcriptome of the North American medicinal leech, Macrobdella decora. J. Parasitol. 96, 1211–1221 (2010).
Gallagher, S. R. SDS-polyacrylamide gel electrophoresis (SDS-PAGE). Curr. Protoc. Essent. Lab. Tech. (2012).
Griessbach, U., Stürzebecher, J. & Markwardt, F. Assay of hirudin in plasma using a chromogenic thrombin substrate. Thromb. Res. 37, 347–350 (1985).
Müller, C. et al. More than just one: multiplicity of Hirudins and Hirudin-like factors in the medicinal leech, Hirudo medicinalis. Mol. Genet. Genomics. 291, 227–240 (2016).
Müller, C., Haase, M., Lemke, S. & Hildebrandt, J. P. Hirudins and hirudin-like factors in Hirudinidae: implications for function and phylogenetic relationships. Parasitol. Res. 116, 313–325 (2017).
Scharf, M., Engels, J. & Tripier, D. Primary structures of new “iso-hirudins”. FEBS Lett. 255, 105–110 (1989).
Tulinsky, A. & Qiu, X. Active site and exosite binding of alpha-thrombin. Blood Coagul. Fibrinolysis. 4, 305–312 (1993).
Electricwala, A., Hartwell, R., Scawen, M. D. & Atkinson, T. The complete amino acid sequence of a hirudin variant from the leech Hirudinaria manillensis. J. Protein Chem. 12, 365–370 (1993).

Table 1. Primers used in the present study.

Primer name	Sequence (5′ to 3′)	Application
Hir-F	GATCTGAAAAAATCTCAACG	CDS cloning
Hir-R	TTAATAATAATCGTAATCAG	CDS cloning
5′-RACE-1 (GSP1)	TCGGATTGCTGTCTGA	5′-RACE
5′-RACE-2 (GSP2)	ATGCTGAGCTTGAGACGT
5′-RACE-3 (GSP3)	TGCCAACAGAACGACGAA
3′-RACE-1	TTTGCATCTGCACGTCTCAAGCTCA	3'-RACE
3′-RACE-2	GGGCCCACCAAAGAAATGCATCA	3'-RACE
Hir-p-F	CCGGAATTCATGTTCTCTCTGAAATTG	Vector construction
Hir-p-R	TTTGCGGCCGCTTAGTGGTGGTGGTGGTGGTGATAATAATCGTAATC	Vector construction
5′AOX1	GACTGGTTCCAATTGACAAGC	Identification of positive clones
3′AOX1	GCAAATGGCATTCTGACATCC	Identification of positive clones

Note: Underlined text indicates the EcoRI-NotI insertion site.

Abbreviations: CDS, coding sequence; RACE, rapid amplification of cDNA ends.

Table 2. Relevant species and their hirudin proteins.

Species	Protein	Protein accession number	Identity (%)^*	E-value	Reference^**
Hirudo nipponia	Hirudin-HN	QDZ37419.1	57	6e-21	²⁶
Hirudo medicinalis	HV2	ALA14576.1	53	2e-22	⁵³
Hirudo medicinalis	HV3-PA	ALA22935.1	52	2e-23	⁵³
Hirudo orientalis	HV3-PAF	APA20857.1	50	1e-22	⁵⁴
Hirudo medicinalis	HV3-PA Subtype AFN	ALA22954.1	50	2e-22	⁵³
Hirudo medicinalis	HV1(VV)	ALA22934.1	50	4e-24	⁵³
Hirudo verbana	HV1-VV	APA20831.1	49	2e-22	⁵⁴
Hirudinaria manillensis	HM1	Q07558.1	49	2e-22	²⁴
Hirudinaria manillensis	HM2	P81492.2	48	9e-21	²⁴
Poecilobdella manillensis	Hirudin	CAA51293.1	48	9e-21	²⁴
Poecilobdella manillensis	HM3	APA20847.1	46	5e-16	⁵⁴
Poecilobdella viridis	Hirudin	P84590	36	1e-09	⁴⁹
Hirudo medicinalis	Hirudin	P28504	36	2e-09	⁵⁵
Hirudinaria manillensis	Hirudin	P26631	33	1e-04	⁵⁶
Hirudinaria manillensis	Hirudin P18	AAB21616.1	33	1e-04	²³
Hirudinaria manillensis	Hirudin HV1	A53883	33	1e-07	⁵⁷
Hirudinaria manillensis	Hirudin P6	AAB21615.1	30	3e-06	²³

Note: ^*Identity with hirudin was calculated using protein BLAST (protein vs. protein).

^**The initial report of the hirudin sequence of these organisms.

No competing interests reported.

Download PDF

Journal Publication

published 27 Mar, 2023

Read the published version in Scientific Reports →

Editorial decision: Major revision
06 Oct, 2022
Reviews received at journal
27 Sep, 2022
Reviewers agreed at journal
25 Sep, 2022
Reviews received at journal
09 Sep, 2022
Reviewers agreed at journal
02 Sep, 2022
Reviewers invited by journal
01 Sep, 2022
Editor assigned by journal
01 Sep, 2022
Editor invited by journal
29 Aug, 2022
Submission checks completed at journal
29 Aug, 2022
First submitted to journal
15 Aug, 2022

You are reading this latest preprint version

Cloning, Characterization, and Heterologous Expression of a Candidate Hirudin Gene from the Salivary Gland Transcriptome of Hirudo nipponia

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Results

Sequence analysis and multiple sequence alignment of hirudin

Identification of the recombinant plasmid pPIC9K-Hirudin

PCR detection of the recombinant yeast transformant GS115/pPIC9K-Hirudin

Target protein quantification by SDS-PAGE and western blot

Antithrombin activity of hirudin

Discussion

Conclusion

Materials And Methods

Declarations

References

Tables

Additional Declarations

Status:

Journal Publication

Version 1