Animal and sample collection
This study utilized a mosaic swine population to uncover the relationship of m6A regulation mechanism and IMF deposition. The heterogeneous pig stock was derived from eight founder breeds (F0) consisting of the four Western commercial breeds (Duroc, Large White, Landrace and Pietrain pigs) and the four Chinese indigenous breeds (Erhualian, Laiwu, Bamaxiang and Tibetan pigs). All the pigs were raised under the same condition and purposeful mating, crossbreed strategy in detail was described in (Yang et al., 2022; Zhang et al., 2021). We selected the longissimus dorsi muscle (LDM) from the 6th generation (F6; Average IMF: 2.28, range 0.92–7.45) (Zhang et al., 2021). Animals were slaughtered at 240±10 days, tissues were flash frozen in liquid nitrogen and stored at -80°C. Intramuscular preadipocytes cells were isolated from the LDM of 3-day-old Duroc-Landrace-Yorkshire piglets under sterile conditions (Jiang et al., 2019), and experimental procedures were in compliance with guidelines of the Committee on Animal Care and Use and Committee on the Ethic of Animal Experiments of Zhejiang University (Hangzhou, China).
Phenotypes and RNA extraction
Longissimus muscle tissue were obtained between the 3rd and 4th lumbar vertebrae, and then measured the intramuscular fat content using the routine Soxhlet extraction method (Cameron et al., 2000). Total RNA was isolated and purified using Trizol reagent (Invitrogen, Carlsbad, CA, USA) refer to the instruction, criteria with RIN > 7.0, total RNA > 5 μg, concentration > 50ng/μL and OD260/D280 >1.8 were left for subsequent use.
RNA mapping and gene expression analysis
Raw data were evaluated with FastQC v0.11.9 (Andrews, 2017), the heading 10bp were removed using trimmomatic v0.39 on account of GC bias (Bolger, Lohse, & Usadel, 2014). Clean data were mapped to Sus scrofa 11.1 using STAR v2.7.8a, samtools v1.11 was used for sorting and marking duplicated reads (Dobin et al., 2013; Li et al., 2009). Input data were used for annotating, merging and quantifying with StringTie v2.1.7, raw counts of transcripts then were normalized and differential expression transcripts/genes were uncovered by the DESeq2 software (Love, Huber, & Anders, 2014; Pertea et al., 2015).
mRNA m6A sequencing and quantification
Total RNA was randomly fragmented to ~100 nucleotides using Magnesium RNA Fragmentation Module (NEB, cat.e6150, USA) under 86℃ 7min (Meyer et al., 2012). The methylated RNA-specific antibodies (No. 202003, Synaptic Systems, Germany) were incubated by immunoprecipitation (IP), and captured for sequencing under an illumina Novaseq™ 6000 (LC-Bio Technology CO., Ltd., Hangzhou, China) following the vendor's recommended protocol. Simultaneously, the input sample (Input) was used to eliminate the background, which is essentially RNA sequencing. The total amount of m6A in RNA was measured using LC-MS/MS (Shafik et al., 2021).
Analyses of m6A-seq data and functional enrichment
IP data were performed the same procedure as input data, m6A peak calling was conducted by MACS2 with “--nomodel -g 2.5e9 --broad --keep-dup all” on the whole genome level. VEP software was using for annotating the differential peaks, HOMER software was applying for uncovering the motif in conserved peak regions.
Gene ontology (GO) and Kyoto cyclopedia of genes and genomes (KEGG) pathway enrichment analyses were conducted by ClueGO in Cytoscape v3.9.0. Pathways with p-value ≤ 0.05 were selected, p-value was chosen from the Term P-Value Corrected with Bonferroni step down. GO ontologies involve biological process, cellular component and molecular function.
Western blot analysis
Cells were lysed with the mixture containing Cell lysis buffer for Western and IP and 1% phenylmethanesulfonyl fluoride (PMSF) (Biosharp, Beijing, China) on ice to extract protein. Protein samples were separated by SDS-PAGE and then transferred to polyvinylidene difluoride membranes. And the membranes were blocked with 5% non-fat milk at room temperature for 1 h, then incubated with primary and secondary antibodies. The protein bands were visualized using ECL Protect from Light (Biosharp, Beijing, China) and quantified using Image J software. The primary antibodies used in this study were as follows: ADIPOQ (1:200, sc-136131, Santa Cruz, CA, USA), FLAG (1:1000, 20543-1-AP, Proteintech, IL, USA), YTHDF1 (1:1000, 17479-1-AP, Proteintech, IL, USA), GFP (1:5000, ET160-25, Huabio, Hangzhou, China), β-actin (1:5000, M1210-2, Huabio, Hangzhou, China). The secondary antibodies were as follows: goat anti-mouse IgG-HRP (1:2000, HA1006, Huabio, Hangzhou, China), goat anti-rabbit IgG-HRP (1:2000, HA1001, Huabio, Hangzhou, China).
Real-time quantitative PCR (qPCR) analysis and Oil red O staining
The total RNA was extracted using TRIzol (Biosharp, Beijing, China) according to the product protocol. qPCR analysis was performed using the SYBR Green PCR Master Mix (Roche, NJ, USA) with the ABI Step-One PlusTM Real-Time PCR System (Applied Biosystems). Primers used in this study were listed in Table 1.
Table 1. Primer sequences used in this work.
Name
|
Forward primer (5’-3’)
|
Reverse primer (5’-3’)
|
ADIPOQ
|
TATGATGTCACCACTGGCAAA
|
TAGAGGAGCACAGAGCCAGAG
|
PPARγ
|
AGGACTACCAAAGTGCCATCAAA
|
GAGGCTTTATCCCCACAGACAC
|
c/EBPβ
|
GCACAGCGACGAGTACAAGA
|
TATGCTGCGTCTCCAGGTTG
|
FABP4
|
CAGGAAAGTCAAGAGCACC
|
ATGATACATTCCACCACCAA
|
GAPDH
|
ACACTCACTCTTCCACTTTTG
|
CAAATTCATTGTCGTACCAG
|
Oil red-O staining was performed as following procedures: Cells were washed and fixed with 10% formalin for 1 h, and then washed 3 times with 60% isopropanol. Cells were stained with Oil Red O working solution (0.35% Oil Red O dye in 60% isopropanol) for 10 min, and further washed 4 times with distilled water. Cells were eluted the stained lipid droplets using 100% isopropanol for 10 min, and then measuring optical density (OD) at 500nm to conduct the quantitative of lipid content.
Cell culture and adipocyte differentiation
Cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) containing 10% fetal bovine serum and 1% penicillin-streptomycin (Gibco, CA, USA). At 2 days after confluence, defined as day 0, cells were induced to differentiation medium containing 0.5mM 3-Isobutyl-1-methylxanthine (IBMX), 1μM dexamethasone and 5 μg/ml insulin (Sigma, MO, USA). On day 2, the medium was replaced with maintenance medium containing 5 μg/ml insulin (Sigma, MO, USA) every 2 days until day 8. 293T cells were cultured in DMEM/F12 medium containing 10% fetal bovine serum and 1% penicillin-streptomycin (Gibco, CA, USA). Cells were uniformly cultured in a 5% CO2 incubator with 37°C.
Cell transfection, plasmids and RNA knockdown
The plasmids and siRNA transfections were performed using Hieff TransTM Liposomal Transfection Reagent and Hieff TransTM in vitro siRNA/miRNA Transfection Reagent (Yeasen, Shanghai, China), according to the product protocol. The adenoviruses ADV4-ADIPOQ CDS wild-type (ADV4-ADIPOQ-CDS-WT), ADV4-ADIPOQ-CDS mutant (m6A C534 and C570 were replaced by T, ADV4-ADIPOQ-CDS-MUT) and ADV4-ADIPOQ-CDS negative control (ADV4-ADIPOQ-CDS-NC) were generated by GenePharma (Shanghai, China). IMF cells were infected with the multiplicity of infection (MOI) of 25:1 by ADV4-ADIPOQ-CDS-WT, ADV4-ADIPOQ-CDS-MUT and ADV4-ADIPOQ-CDS-NC, respectively, and added 1 μg/ml polybrene to improve the infection efficiency, according to GenePharma’s protocol. The porcine FLAG-YTHDF1 overexpression plasmid were cloned into a pPB vector. Sequences of siRNA, synthesizd by GenePharma (Shanghai, China), were as follows: siADIPOQ-F, 5’- AGAAAGCGCCUAUGUCUACTT-3’ and siADIPOQ-R, 5’-GUAGACAUAGGCGCUUUCUCC-3’; siYTHDF1-F, 5ʹ-UUAGUAUCCUGUCCUUUUGUU-3ʹ and siYTHDF1-R, 5ʹ-CAAAAGGACAGGAUACUAAAG-3ʹ.
m6A-specific methylated RNA immunoprecipitation coupled with qPCR analysis
m6A-qPCR analysis was conducted according to previously report (Dominissini, Moshitch-Moshkovitz, Amariglio, & Rechavi, 2015). Briefly, mRNA fragmented by RNA Fragmentation reagent (Invitrogen, CA, USA) at 70°C for 15 min. 10% of fragmented RNA was used as input RNA. The other was immunoprecipitated with anti-m6A antibody coupled to Dynabeads (Invitrogen, CA, USA) in immunoprecipitation buffer (RNase inhibitor, 10 mM Tris-HCl, 150mM NaCl, 0.1% Igepal CA-630 [Sigma, MO, USA]) at 4°C for 2 h. m6A containing mRNAs were eluted twice with m6A 5’-monophosphate sodium salt (Sigma, MO, USA) at 4°C for 1 h. After ethanol precipitation, all RNAs were reversely transcribed into cDNA by M-MLV reverse transcriptase (Invitrogen, CA, USA). And then m6A enrichment was determined by qPCR. The primers were as follows: ADIPOQ-CDS-F, 5’- TCCTTCCACATCACGGTCTACT-3’ and ADIPOQ-CDS-R, 5’- CTCCAGATAGAGGAGCACAGAG-3’; ADIPOQ-3’UTR-F, 5’-CCACTGTGTTTCCTCAGGTTC-3’ and ADIPOQ-3’UTR-R, 5’- CCACAGCCCTGTGTTTGACTT-3’.
RNA immunoprecipitation-qPCR
The experiment pipeline was performed according to the previous research (Peritz et al., 2006). Briefly, FLAG-YTHDF1 overexpressed IMF cells were lysed in lysis buffer for 30 min at 4°C and the supernatant was collected for further use. We saved 50-μl aliquot of cell lysate as input, and the remaining was incubated with anti-FLAG or immunoglobulin G (IgG) antibody-conjugated magnetic beads (Sigma, St. Louis, MO, USA) for 4 h at 4 °C. The beads were washed with buffer containing 0.1% SDS and proteinase K (Invitrogen, USA), detecting fold enrichment with qPCR.
Dual-luciferase reporter and mutagenesis assays
To evaluate the effect of 3’UTR m6A site on ADIPOQ expression, wild type or mutant (m6A A650 was replaced by T) of ADIPOQ-3’UTR was inserted into downstream of pmirGLO Dual-Luciferase vector (Promega, WI, USA). After 48 h post transfection, the activities of firefly luciferase and Renilla luciferase in each 24-well plates’ well were determined by a Dual-Luciferase Reporter Gene Assay Kit (Yeasen, Shanghai, China) according to the product protocol.
Statistical analysis
All data were presented as mean ± SEM. Statistical significance between multiple groups were determined by Student’s t-test with GraphPad Prism 9. p < 0.05 was considered exceeding the significant level.